human mal2 Search Results


93
OriGene human mal2
Top ten upregulated genes in PLC/PRF/5 Sor-R resistant cells.
Human Mal2, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human mal2/product/OriGene
Average 93 stars, based on 1 article reviews
human mal2 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

90
Human Protein Atlas ihc images of mal2
Top ten upregulated genes in PLC/PRF/5 Sor-R resistant cells.
Ihc Images Of Mal2, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ihc images of mal2/product/Human Protein Atlas
Average 90 stars, based on 1 article reviews
ihc images of mal2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Human Genome Sciences (HGS protein mal2 modulator
Top ten upregulated genes in PLC/PRF/5 Sor-R resistant cells.
Protein Mal2 Modulator, supplied by Human Genome Sciences (HGS, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/protein mal2 modulator/product/Human Genome Sciences (HGS
Average 90 stars, based on 1 article reviews
protein mal2 modulator - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
OriGene flotillin 1 (flot1) (nm_005803) human tagged orf clone
Top ten upregulated genes in PLC/PRF/5 Sor-R resistant cells.
Flotillin 1 (Flot1) (Nm 005803) Human Tagged Orf Clone, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/flotillin 1 (flot1) (nm_005803) human tagged orf clone/product/OriGene
Average 90 stars, based on 1 article reviews
flotillin 1 (flot1) (nm_005803) human tagged orf clone - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

N/A
GeneCopoeia offers genome-wide human, mouse and rat microRNA (miRNA) 3′ UTR target clones in mammalian expression vectors. miRNA 3′ UTR target clones can be used for miRNA target identification and functional validation of predicted targets,
  Buy from Supplier

N/A
MAL2 Human 4 unique 29mer shRNA constructs in lentiviral GFP vector
  Buy from Supplier

N/A
Lenti ORF particles MAL2 mGFP tagged Human mal T cell differentiation protein 2 gene pseudogene MAL2 200ul 10 7 TU mL
  Buy from Supplier

N/A
Transient overexpression lysate of mal, T-cell differentiation protein 2 (MAL2)
  Buy from Supplier

N/A
strong Human MAL2 knockdown cell line strong is engineered by our optimized transduction of the specific shRNA with lentivirus Knockdown levels are determined via qRT PCR AcceGen offers generation of stable knockdown RNAi cell lines
  Buy from Supplier

N/A
Recombinant Human MAL2 GST (N-Term) Protein
  Buy from Supplier

N/A
Lenti ORF clone of Human mal T cell differentiation protein 2 gene pseudogene MAL2 mGFP tagged
  Buy from Supplier

Image Search Results


Top ten upregulated genes in PLC/PRF/5 Sor-R resistant cells.

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides

doi: 10.3390/cancers15215280

Figure Lengend Snippet: Top ten upregulated genes in PLC/PRF/5 Sor-R resistant cells.

Article Snippet: The Lenti ORF clone of human MAL2 , Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs Kpn I-Kozak- MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and Eco RV- MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB- IL7 -GFP-Puro.

Techniques:

In vitro validation of the role of IL7 and MAL2 in HCC-associated Sorafenib drug resistance. ( A ) IL7 and MAL2 were significantly overexpressed in Sorafenib-resistant mutant PLC/PRF/5 cell pool (Sor-R) compared to the wild-type (WT) parental cell line by qPCR. ****, p < 0.0001; Student unpaired t -test. ( B ) Graphical representation showing significantly more colony forming ability by Sorafenib-resistant mutant PLC/PRF/5 (PLC5 Sor-R) cells when compared with wild-type (WT) parental PLC/PRF/5 (PLC5) cells under different Sorafenib concentrations (4 and 8 µM). ****, p < 0.0001; *, p < 0.05; two-way ANOVA test. ( C ) Overexpression of IL7 and/or MAL2 were confirmed in transfected PLC5 cells by qPCR compared with GFP control transfected cells. ****, p < 0.0001; Student unpaired t -test. Representative clonogenic survival assay images of PLC5 cells overexpressing IL7 and/or MAL2 under different Sorafenib concentrations. ( D ) Co-expression of IL7 and MAL2 in PLC5 cells treated with 10 µM Sorafenib induced greater anti-apoptotic effect compared with control GFP -overexpressing cells. Flow cytometry profiles represented intensity of Annexin-V-APC staining in X -axis and PI in Y -axis. ( E ) Graphical quantification of the apoptosis assay. ****, p < 0.0001; ***, p < 0.001; **, p < 0.01; two-way ANOVA test.

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides

doi: 10.3390/cancers15215280

Figure Lengend Snippet: In vitro validation of the role of IL7 and MAL2 in HCC-associated Sorafenib drug resistance. ( A ) IL7 and MAL2 were significantly overexpressed in Sorafenib-resistant mutant PLC/PRF/5 cell pool (Sor-R) compared to the wild-type (WT) parental cell line by qPCR. ****, p < 0.0001; Student unpaired t -test. ( B ) Graphical representation showing significantly more colony forming ability by Sorafenib-resistant mutant PLC/PRF/5 (PLC5 Sor-R) cells when compared with wild-type (WT) parental PLC/PRF/5 (PLC5) cells under different Sorafenib concentrations (4 and 8 µM). ****, p < 0.0001; *, p < 0.05; two-way ANOVA test. ( C ) Overexpression of IL7 and/or MAL2 were confirmed in transfected PLC5 cells by qPCR compared with GFP control transfected cells. ****, p < 0.0001; Student unpaired t -test. Representative clonogenic survival assay images of PLC5 cells overexpressing IL7 and/or MAL2 under different Sorafenib concentrations. ( D ) Co-expression of IL7 and MAL2 in PLC5 cells treated with 10 µM Sorafenib induced greater anti-apoptotic effect compared with control GFP -overexpressing cells. Flow cytometry profiles represented intensity of Annexin-V-APC staining in X -axis and PI in Y -axis. ( E ) Graphical quantification of the apoptosis assay. ****, p < 0.0001; ***, p < 0.001; **, p < 0.01; two-way ANOVA test.

Article Snippet: The Lenti ORF clone of human MAL2 , Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs Kpn I-Kozak- MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and Eco RV- MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB- IL7 -GFP-Puro.

Techniques: In Vitro, Mutagenesis, Over Expression, Transfection, Control, Clonogenic Cell Survival Assay, Expressing, Flow Cytometry, Staining, Apoptosis Assay

Activation of JAK/STAT and PI3K/AKT signaling pathways by IL7 and MAL2 in HCC-associated Sorafenib resistance. ( A ) Representative Western blot and relative protein level analyses confirming STAT3 activation in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells. *, p < 0.05; **, p < 0.01; two-way ANOVA test. ( B ) Representative Western blot and relative protein level analyses confirming PI3K/AKT activation in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells. *, p < 0.05; **, p < 0.01; two-way ANOVA test. ( C ) CDKN1A expression was significantly induced in IL7 and/or MAL2 overexpressing PLC/PRF/5 cells under Sorafenib treatment. **, p < 0.01; ***, p < 0.001; Student unpaired t -test. ( D ) Representative Western blot and relative protein level analyses showing reduced phosphorylated JNK (p-JNK) levels in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control cells under Sorafenib treatment in a dose dependent manner. ( E ) Summary diagram showing MAL2, a transmembrane protein, contributes to intracellular trafficking and secretion of IL7 to the plasma membrane. The binding of IL7 to cytokine receptors result in the activation of important downstream survival signaling pathways that contributes to Sorafenib resistance. The uncropped bolts are shown in .

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides

doi: 10.3390/cancers15215280

Figure Lengend Snippet: Activation of JAK/STAT and PI3K/AKT signaling pathways by IL7 and MAL2 in HCC-associated Sorafenib resistance. ( A ) Representative Western blot and relative protein level analyses confirming STAT3 activation in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells. *, p < 0.05; **, p < 0.01; two-way ANOVA test. ( B ) Representative Western blot and relative protein level analyses confirming PI3K/AKT activation in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells. *, p < 0.05; **, p < 0.01; two-way ANOVA test. ( C ) CDKN1A expression was significantly induced in IL7 and/or MAL2 overexpressing PLC/PRF/5 cells under Sorafenib treatment. **, p < 0.01; ***, p < 0.001; Student unpaired t -test. ( D ) Representative Western blot and relative protein level analyses showing reduced phosphorylated JNK (p-JNK) levels in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control cells under Sorafenib treatment in a dose dependent manner. ( E ) Summary diagram showing MAL2, a transmembrane protein, contributes to intracellular trafficking and secretion of IL7 to the plasma membrane. The binding of IL7 to cytokine receptors result in the activation of important downstream survival signaling pathways that contributes to Sorafenib resistance. The uncropped bolts are shown in .

Article Snippet: The Lenti ORF clone of human MAL2 , Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs Kpn I-Kozak- MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and Eco RV- MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB- IL7 -GFP-Puro.

Techniques: Activation Assay, Western Blot, Control, Expressing, Membrane, Binding Assay

Autophagy-inducing stapled peptides exerted a synergistic anti-proliferative effect with Sorafenib in resistant HCC cells that co-overexpress both IL7 and MAL2. ( A ) Autophagy markers p62 and LC3-II were measured by Western blot in IL7 and MAL2-overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells after treatment with or without the autophagy inducer rapamycin (500 nM, 3 h). ( B ) Statistic analysis of LC3-II and p62 level change of ( A ) after normalization to the level of β-Actin. ( C ) The two autophagy markers were assessed using Western blot in GFP control PLC/PRF/5 cells after treatment with Tat-SP9 (0, 10, 20 μM for 12 h) and Tat-SP4 (0, 10, 20 μM for 3 h) with or without 1 μM CQ. ( D ) Statistic analysis of LC3-II and p62 level change of ( C ) after normalization to the level of β-Actin. ( E ) Similar Western blots as ( C ), but cells are IL7 and MAL2-overexpressing PLC/PRF/5 cells. ( F ) Statistic analysis of LC3-II and p62 level change of ( E ) after normalization to the level of β-Actin. Bar represents mean ± SEM of three replicates. ( G ) Cell viability was assessed in IL7 and MAL2 -overexpressing PLC/PRF/5 cells and GFP control PLC/PRF/5 cells after treatment with different concentrations of Tat-SP9 and Tat-SP4. The estimated IC 50 value for Tat-SP9 was 12.63 μM in GFP control PLC/PRF/5 cells and 12.58 μM in Sorafenib-resistant cells, while the estimated IC 50 value for Tat-SP4 was 69.71 μM in control cells and 69.89 μM in resistant cells. ( H ) Clonogenic survival assay images were taken for both GFP control PLC/PRF/5 GFP cells and IL7 and MAL2-overexpressing PLC/PRF/5 cells under different concentrations of Tat-SP9 (10, 15, 20 μM). Bars represent mean ± SEM (n = 3). ( I ) Representative clonogenic survival assay images of GFP control PLC/PRF/5 cells and Sorafenib-resistant PLC/PRF/5 cells after treatment with Tat-SP9 (10 μM) or Sorafenib (2 or 4 μM), alone or combined. Bars represent mean ± SEM of three replicates. NS means no significant difference *, p < 0.05; **, p < 0.01; ***, p < 0.001,****, p < 0.0001 two-way ANOVA test. The uncropped bolts are shown in .

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides

doi: 10.3390/cancers15215280

Figure Lengend Snippet: Autophagy-inducing stapled peptides exerted a synergistic anti-proliferative effect with Sorafenib in resistant HCC cells that co-overexpress both IL7 and MAL2. ( A ) Autophagy markers p62 and LC3-II were measured by Western blot in IL7 and MAL2-overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells after treatment with or without the autophagy inducer rapamycin (500 nM, 3 h). ( B ) Statistic analysis of LC3-II and p62 level change of ( A ) after normalization to the level of β-Actin. ( C ) The two autophagy markers were assessed using Western blot in GFP control PLC/PRF/5 cells after treatment with Tat-SP9 (0, 10, 20 μM for 12 h) and Tat-SP4 (0, 10, 20 μM for 3 h) with or without 1 μM CQ. ( D ) Statistic analysis of LC3-II and p62 level change of ( C ) after normalization to the level of β-Actin. ( E ) Similar Western blots as ( C ), but cells are IL7 and MAL2-overexpressing PLC/PRF/5 cells. ( F ) Statistic analysis of LC3-II and p62 level change of ( E ) after normalization to the level of β-Actin. Bar represents mean ± SEM of three replicates. ( G ) Cell viability was assessed in IL7 and MAL2 -overexpressing PLC/PRF/5 cells and GFP control PLC/PRF/5 cells after treatment with different concentrations of Tat-SP9 and Tat-SP4. The estimated IC 50 value for Tat-SP9 was 12.63 μM in GFP control PLC/PRF/5 cells and 12.58 μM in Sorafenib-resistant cells, while the estimated IC 50 value for Tat-SP4 was 69.71 μM in control cells and 69.89 μM in resistant cells. ( H ) Clonogenic survival assay images were taken for both GFP control PLC/PRF/5 GFP cells and IL7 and MAL2-overexpressing PLC/PRF/5 cells under different concentrations of Tat-SP9 (10, 15, 20 μM). Bars represent mean ± SEM (n = 3). ( I ) Representative clonogenic survival assay images of GFP control PLC/PRF/5 cells and Sorafenib-resistant PLC/PRF/5 cells after treatment with Tat-SP9 (10 μM) or Sorafenib (2 or 4 μM), alone or combined. Bars represent mean ± SEM of three replicates. NS means no significant difference *, p < 0.05; **, p < 0.01; ***, p < 0.001,****, p < 0.0001 two-way ANOVA test. The uncropped bolts are shown in .

Article Snippet: The Lenti ORF clone of human MAL2 , Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs Kpn I-Kozak- MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and Eco RV- MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB- IL7 -GFP-Puro.

Techniques: Western Blot, Control, Clonogenic Cell Survival Assay