Journal: Biology Direct

Article Title: The role of SH3RF2 in lung squamous cell carcinoma and M2 polarization: insights into LZTS2 ubiquitination

doi: 10.1186/s13062-025-00677-0

Figure Lengend Snippet: ( A ) Cell viability of SKMES1 cells treated with ICG-001. ( B ) RNA level of CCL2 in SKMES1 cells. ( C ) Protein level of CCL2 in SKMES1 cells. ( D ) Cellular migration and invasion ability of THP-1 cells analyzed by transwell assay. ( E ) RNA levels of Arg-1, CD163 and IL-10 in M0 THP-1 cells treated with SKMES1 CM. ( F ) The proportion of CD206 + cells in M0 THP-1 cells with SKMES1 CM treatment. EV: empty vector, SR oe : SH3RF3 overexpression. **: p < 0.01, ***: p < 0.001

Article Snippet: Colonies were fixed with 4% paraformaldehyde at room temperature for 25 min and stained with crystal violet dye for 5 min. CCL2 levels were determined using the Human CCL2 ELISA Kit (Lianke Bio, China).

Techniques: Migration, Transwell Assay, Plasmid Preparation, Over Expression

Journal: Biology Direct

Article Title: The role of SH3RF2 in lung squamous cell carcinoma and M2 polarization: insights into LZTS2 ubiquitination

doi: 10.1186/s13062-025-00677-0

Figure Lengend Snippet: ( A & B ) SKMES1 cells with SH3RF2 overexpression or knockdown were injected subcutaneously into the right armpit of Balb/c nude mice. Tumor size was measured every 3 days. Tumors were removed and weighed after 33 days. ( C & D ) The protein level of CCL2 in tumor determined by ELISA. ( E ) Detection of SH3RF2 expression in tumor tissues by immunohistochemistry, bar = 50 μm. ( F ) Immunohistochemistry for Ki-67 in tumor tissues, bar = 50 μm. ( G ) The proportion of CD11b + F4/80 + CD206 + cells in tumor. NC sh : negative control shRNA, SR sh−1 : SH3RF2 shRNA-1, SR sh−2 : SH3RF2 shRNA-2, EV: empty vector, SR oe : SH3RF3 overexpression. **: p < 0.01, ***: p < 0.001

Article Snippet: Colonies were fixed with 4% paraformaldehyde at room temperature for 25 min and stained with crystal violet dye for 5 min. CCL2 levels were determined using the Human CCL2 ELISA Kit (Lianke Bio, China).

Techniques: Over Expression, Knockdown, Injection, Enzyme-linked Immunosorbent Assay, Expressing, Immunohistochemistry, Negative Control, shRNA, Plasmid Preparation

Journal: Biology Direct

Article Title: The role of SH3RF2 in lung squamous cell carcinoma and M2 polarization: insights into LZTS2 ubiquitination

doi: 10.1186/s13062-025-00677-0

Figure Lengend Snippet: ( A ) Protein level of LZTS2 in SKMES1 cells with SH3RF2 and LZTS2 overexpression. ( B ) Cell viability of SKMES1 cells with SH3RF2 and LZTS2 overexpression. ( C ) Immunofluorescence detection of the distribution of β-catenin in SKMES1 cells and quantitative analysis of nuclear-to-cytoplasmic ratio of β-catenin fluorescence intensity. ( D ) Protein level of CCL2 in SKMES1 cells. ( E ) RNA levels of Arg-1, CD163 and IL-10 in M0 THP-1 cells with SKMES1 CM treatment. ( F ) Cellular migration and invasion ability of M0 THP-1 cells with SKMES1 CM treatment. ( G ) The proportion of CD206 + cells in the M0 THP-1 cells treated with SKMES1 CM. EV: empty vector, SR oe : SH3RF3 overexpression. LZ oe : LZTS2 overexpression. **: p < 0.01, ***: p < 0.001

Article Snippet: Colonies were fixed with 4% paraformaldehyde at room temperature for 25 min and stained with crystal violet dye for 5 min. CCL2 levels were determined using the Human CCL2 ELISA Kit (Lianke Bio, China).

Techniques: Over Expression, Immunofluorescence, Fluorescence, Migration, Plasmid Preparation

Journal: Journal of Nanobiotechnology

Article Title: Therapies with CCL25 require controlled release via microparticles to avoid strong inflammatory reactions

doi: 10.1186/s12951-021-00830-7

Figure Lengend Snippet: Characteristic features of PLGA particles. PLGA particles were analyzed morphologically with SEM, evaluated for endotoxin contamination with the Limulus amebocyte lysate (LAL) test, and functionally assessed by their CCL25 release profile. Representative SEM images of the PLGA particles generated are shown in a i,ii with × 40 and 200 magnification at day one, iii, iv with × 40/ × 200 magnification after 14 days of degradation, v, vi with × 40/ × 200 magnification after 28 days of degradation and vii, viii with × 1000 magnification after 63 days of degradation. Scale bars represent 500 and 100 µm, respectively. b The results of the LAL test for the detection of endotoxins are shown for different stock solutions of CCL25 (10 and 500 nM) and the supernatant from PLGA particles (CL supernatant) compared to the test standards (0.1–10 nM). c The cumulative release in percent ± SD of CCL25 from PLGA particles over time until day 63 ( n = 3) was determined by ELISA. CL CCL25-loaded, PLGA Poly (lactic-co-glycolic acid)

Article Snippet: The amount of CCL25 released from the PLGA microparticles was measured using the human CCL25/TECK DuoSet® Enzyme linked immunosorbent assay (ELISA) kit (R&D Systems, Minneapolis, USA).

Techniques: Generated, Enzyme-linked Immunosorbent Assay

Journal: Frontiers in Immunology

Article Title: ACKR4 Recruits GRK3 Prior to β-Arrestins but Can Scavenge Chemokines in the Absence of β-Arrestins

doi: 10.3389/fimmu.2020.00720

Figure Lengend Snippet: General plasmids and primers.

Article Snippet: pSUMO hCCL25 , hCCL25 RC222128 (Origene) , GACTAGGTCTCCGGTGGGCAAGGTGTCTTTGAGGAC , GTGCTCGAGTTACAGTCCTGAATTAGCTGATATCAGGAGGG , -.

Techniques: Synthesized, Amplification, Plasmid Preparation

Journal: Arthritis Research & Therapy

Article Title: Abrogation of CC chemokine receptor 9 ameliorates collagen-induced arthritis of mice

doi: 10.1186/s13075-014-0445-9

Figure Lengend Snippet: CCR9 and CCL25 expression in the RA synovial tissues. (A) Western blots of CCR9 protein expression in three RA and three OA synovial tissues. Ratio of CCR9/β-actin protein level is indicated below. (B-J) Sections of RA synovial tissue were double-stained with CCR9 and CD68, cadherin-11 and DC-LAMP (B, CD68; C, CCR9; D, merged B with C; E, cadherin-11; F, CCR9; G, merged E with F; H, DC-LAMP; I, CCR9; J, merged H with I). Bar, 20 μm. (K) Western blots of CCL25 protein expression in four RA and four OA synovial tissues. Ratio of CCL25/β-actin protein level is indicated below. (L-N) Sections of RA synovial tissue were double-stained with CCL25 and CD68 (L, CD68; M, CCL25; N, merged L with M). Bars, 20 μm. CCL, chemokine (C-C motif) ligand; CCR, CC chemokine receptor; DC-LAMP, dendritic cell lysosome-associated membrane glycoprotein; OA, osteoarthritis; RA, rheumatoid arthritis.

Article Snippet: RA FLS were cultured with 10% fetal calf serum (FCS) for 48 hours with or without recombinant human CCL25 (R&D Systems).

Techniques: Expressing, Western Blot, Staining, Membrane

Journal: Arthritis Research & Therapy

Article Title: Abrogation of CC chemokine receptor 9 ameliorates collagen-induced arthritis of mice

doi: 10.1186/s13075-014-0445-9

Figure Lengend Snippet: Effects of CCL25 on cultured RA FLS. (A) CCR9 expression on in vitro cultured RA FLS was determined by flow cytometry. Horizontal line indicates fluorescence intensity (FI). (B) RA FLS were cultured for 48 hours with various concentrations of CCL25. Concentrations of IL-6 (i) and MMP-3 (ii) in the culture supernatant were measured with ELISA. Values are the mean ± SEM of three independent experiments. * P <0.05. CCL, chemokine (C-C motif) ligand; CCR, CC chemokine receptor; ELISA, enzyme-linked immunosorbent assay; FLS, fibroblast-like synoviocytes; IL, interleukin; MMP, metalloproteinase; RA, rheumatoid arthritis; SEM, standard error of the mean.

Article Snippet: RA FLS were cultured with 10% fetal calf serum (FCS) for 48 hours with or without recombinant human CCL25 (R&D Systems).

Techniques: Cell Culture, Expressing, In Vitro, Flow Cytometry, Fluorescence, Enzyme-linked Immunosorbent Assay

Journal: Arthritis Research & Therapy

Article Title: Abrogation of CC chemokine receptor 9 ameliorates collagen-induced arthritis of mice

doi: 10.1186/s13075-014-0445-9

Figure Lengend Snippet: Effects of CCL25 on human peripheral blood monocytes. (A) CCR9 expression on peripheral blood CD14 + monocytes was analyzed with flow cytometry. (B) Monocytes were cultured for 24 hours with various concentrations of CCL25. Concentrations of IL-6 (i) and TNF-α (ii) in the culture supernatant were measured with ELISA. Values are the mean ± SEM of three independent experiments. * P <0.05. CCL, chemokine (C-C motif) ligand; CCR, CC chemokine receptor; ELISA, enzyme-linked immunosorbent assay; IL, interleukin; SEM, standard error of the mean; TNF, tumor necrosis factor.

Article Snippet: RA FLS were cultured with 10% fetal calf serum (FCS) for 48 hours with or without recombinant human CCL25 (R&D Systems).

Techniques: Expressing, Flow Cytometry, Cell Culture, Enzyme-linked Immunosorbent Assay