Journal: PLoS ONE

Article Title: Preferential activation of HIF-2α adaptive signalling in neuronal-like cells in response to acute hypoxia

doi: 10.1371/journal.pone.0185664

Figure Lengend Snippet: The forward (F) and reverse (R) oligonucleotides used in this study.

Article Snippet: Protein expression was analysed via immunoblotting using anti-NSE (AbCam, #AB16808), anti-KCC2 (Merck Millipore, #07–432), anti-actin (Santa Cruz, #SC-1615), anti-HIF1α (BD Sciences, #610958; Abcam, #ab1), anti-HIF-2α (1:500, R&D Systems, #AF2886), anti-HIF-3α (Acris antibodies, #AP20606PU-N), anti-CD44 (CST, #5640) or anti-Vimentin (BD Sciences, #550513) at a dilution of 1:1000 in 3% non-fat milk in 1x TBS-tween (0.1% v/v).

Techniques: Sequencing

Journal: PLoS ONE

Article Title: Preferential activation of HIF-2α adaptive signalling in neuronal-like cells in response to acute hypoxia

doi: 10.1371/journal.pone.0185664

Figure Lengend Snippet: A: Relative HIF1-3α mRNA expression was analysed in MCF7 and differentiated PC12 and NT2 cells exposed to 8 hours of hypoxia by qPCR. Data is expressed as mean ± SEM; n = 3; *p<0.05, **p≤0.01, ***p≤0.001. The dotted line represents basal gene expression. B-C: Representative immunoblots of HIF-1α ( B ), HIF-2α ( Ci ), HIF-3α ( Cii ) protein expression in MCF7 and differentiated PC12 and NT2 cells, 1, 2, 4, 8 or 24 hours after exposure to hypoxia. B and C : Equal protein loading was assessed by immunoblotting for actin.

Article Snippet: Protein expression was analysed via immunoblotting using anti-NSE (AbCam, #AB16808), anti-KCC2 (Merck Millipore, #07–432), anti-actin (Santa Cruz, #SC-1615), anti-HIF1α (BD Sciences, #610958; Abcam, #ab1), anti-HIF-2α (1:500, R&D Systems, #AF2886), anti-HIF-3α (Acris antibodies, #AP20606PU-N), anti-CD44 (CST, #5640) or anti-Vimentin (BD Sciences, #550513) at a dilution of 1:1000 in 3% non-fat milk in 1x TBS-tween (0.1% v/v).

Techniques: Expressing, Western Blot

Journal: PLoS ONE

Article Title: Preferential activation of HIF-2α adaptive signalling in neuronal-like cells in response to acute hypoxia

doi: 10.1371/journal.pone.0185664

Figure Lengend Snippet: A: Under physiological oxygen concentrations, HIF-1α/2α are hydroxylated by prolyl hydroxylases (PHD), promoting HIF-1α/2α binding to the E3 ligase, von Hippel-Lindau protein (pVHL), and their ubiquitination . This maintains very low basal expression of HIF-1α/2α due to rapid proteasomal degradation. B: Under hypoxic conditions, PHD activity is inhibited . This stabilises HIF-1α/2α expression, enhancing binding to HIFβ and translocation to the nucleus and transcription of various hypoxia-responsive genes. HIF-1α and -2α share regulation of several genes, yet also regulate distinct subsets [ , ]. HIF-3α function is not yet fully understood. Abbreviations: CHOP, CCAAT-enhancer-binding protein homologous protein; EPO, Erythropoietin; Grp, Glucose regulated protein; HIF: Hypoxia Inducible Factor; PDI, protein disulphide isomerase; PHD, Prolyl hydroxylase; VEGF, Vascular epithelial growth factor; VHL, Von Hippel Lindau.

Article Snippet: Protein expression was analysed via immunoblotting using anti-NSE (AbCam, #AB16808), anti-KCC2 (Merck Millipore, #07–432), anti-actin (Santa Cruz, #SC-1615), anti-HIF1α (BD Sciences, #610958; Abcam, #ab1), anti-HIF-2α (1:500, R&D Systems, #AF2886), anti-HIF-3α (Acris antibodies, #AP20606PU-N), anti-CD44 (CST, #5640) or anti-Vimentin (BD Sciences, #550513) at a dilution of 1:1000 in 3% non-fat milk in 1x TBS-tween (0.1% v/v).

Techniques: Binding Assay, Expressing, Activity Assay, Translocation Assay

Journal: Scientific reports

Article Title: Pro-inflammatory cytokines activate hypoxia-inducible factor 3α via epigenetic changes in mesenchymal stromal/stem cells.

doi: 10.1038/s41598-018-24221-5

Figure Lengend Snippet: Figure 2. HIF3α activation is dependent on NF-κB activation: (a) Immunoblotting analysis of IκBα: hMSCs cultured in normoxia and treated with IL6, IFNγ, TNFα, MCP1, EGF and VEGF for 24 h. Cells were pre-treated with TCPA-1 for 1 h before cytokines supplementation. (b) Immunofluorescence analysis of HIF3α protein in hMSCs cultured in standard oxygen conditions (Normoxia) in absence and in presence of indicated cytokines and probed with antibodies against HIF3α. Cells were pre-treated with TCPA-1 for 1 h before cytokines supplementation. Scale bars: 10 μm). (c) Schematic diagram of the HIF3A promoter region, where a putative NF-KB binding site is depicted (black triangle). NFκB (RelA) binding on HIF3A promoter: ChIP analysis was performed in hMSCs cultured in standard oxygen conditions and treated with IL6, IFNγ, TNFα, MCP1, EGF and VEGF for 24 h (black bars), or pre-treated with TCPA-1 for 1 h (grey bars) before adding cytokines. As control, species matched IgG were used. Data obtained by qRT-PCR are expressed as enrichment of chromatin- associated DNA fragments immunoprecipitated by NF-κB antibody compared with input (% Input) and expressed as means ± SEM of two independent experiments performed in triplicate.

Article Snippet: After desired treatment, cells were fixed in Methanol (10 min, −20C), then blocked with BSA 2% in TBST for 1 h and stained with anti-HIF3a antibodies (1:100, orb215263, Biorbyt Ldt, UK) diluted in PBS-BSA overnight.

Techniques: Activation Assay, Western Blot, Cell Culture, Immunofluorescence, Binding Assay, Control, Quantitative RT-PCR, Immunoprecipitation

Journal: Scientific reports

Article Title: Pro-inflammatory cytokines activate hypoxia-inducible factor 3α via epigenetic changes in mesenchymal stromal/stem cells.

doi: 10.1038/s41598-018-24221-5

Figure Lengend Snippet: Figure 3. DNA methylation status of human HIF3A promoter. (a) Schematic diagram of the HIF3A promoter region, CpG islands and DNAse I hypersensitive sites (DHS) surrounding the three transcription start sites. Vertical black lines represent the three methylation sites in intron 1 in association with high BMI25. (b) MS-PCR analysis of genomic DNA extracted from hMSCs exposed to different pro-inflammatory cytokines in normoxic and hypoxic conditions. The locations of PCR amplicons (#1 to #4) are shown in (a). Three independent experiments were performed and a representative experiment is reported. Images derived from different part of the same gel and cropped for layout reasons and included in Suppl. Information.

Article Snippet: After desired treatment, cells were fixed in Methanol (10 min, −20C), then blocked with BSA 2% in TBST for 1 h and stained with anti-HIF3a antibodies (1:100, orb215263, Biorbyt Ldt, UK) diluted in PBS-BSA overnight.

Techniques: DNA Methylation Assay, Methylation, Derivative Assay

Journal: Scientific reports

Article Title: Pro-inflammatory cytokines activate hypoxia-inducible factor 3α via epigenetic changes in mesenchymal stromal/stem cells.

doi: 10.1038/s41598-018-24221-5

Figure Lengend Snippet: Figure 4. ChIP-PCR analysis of histone modifications of human HIF3A promoter. (a) Schematic diagram of the HIF3A promoter region and primers used in ChIP analysis using specific antibodies to H3K4me3 and H3K27me3 histone modifications. qRT-PCR was performed on immunoprecipitated chromatin of hMSCs treated with different cytokines in normoxic and hypoxic conditions. (b) Six different regions (ChIP1-6) spanning the HIF3A gene were analysed. Results are expressed as means ± SEM of three different experiments and are reported as the ratio between treated hMSCs vs. untreated hMSCs (2-ΔΔCt method). *< 0.05 (p-value).

Article Snippet: After desired treatment, cells were fixed in Methanol (10 min, −20C), then blocked with BSA 2% in TBST for 1 h and stained with anti-HIF3a antibodies (1:100, orb215263, Biorbyt Ldt, UK) diluted in PBS-BSA overnight.

Techniques: Quantitative RT-PCR, Immunoprecipitation

Journal: Laboratory investigation; a journal of technical methods and pathology

Article Title: DNA binding - dependent glucocorticoid receptor activity promotes adipogenesis via krüppel-like factor 15 gene expression

doi: 10.1038/labinvest.2010.170

Figure Lengend Snippet: Microarray analysis of GR-regulated adipogenic genes

Article Snippet: Quantitative real-time RT-PCR was performed using TaqMan Gene Expression Assay probe for Adiponectin (Hs00605917_m1), C/EBP α (Hs00269972_s1), C/EBP δ (Hs00270931_s1), KLF15 (Hs00362736_m1), PPAR γ (Hs01115513_m1), GAPDH (Hs99999905_m1), mAdiponectin (Mm00456425_m1), mC/EBP α (Mm01265914_s1), m C/EBP δ (Mm00786711_s1), mGR (Mm00433832_m1), mHIF3 α (Mm00469373_m1), m KLF9 (Mm00495172_m1), mKLF15 (Hs00164004_m1), mPPAR γ (Mm01184322_m1), mZbtb (Mm01176868_m1), mZhx3 (Mm00770117_m1) and m GAPDH (Mm99999915_g1)(All Applied Biosystems, Carlsbad, CA, USA).

Techniques: Microarray, Sequencing, Binding Assay, Membrane, Zinc-Fingers

Journal: Science translational medicine

Article Title: PROTEOGLYCAN 4 EXPRESSION PROTECTS AGAINST THE DEVELOPMENT OF OSTEOARTHRITIS

doi: 10.1126/scitranslmed.3005409

Figure Lengend Snippet: a, Microarray heat map analysis comparing superficial zone cartilage of wild type and Prg4 transgenic mice. Genes with expression changes larger than 1.5 fold and p-value less than 0.05 are plotted. b, Transcription factor activity changes predicted by Ingenuity Pathway Analysis. All transcription factors shown here were predicted to be suppressed by Ingenuity Pathway Analysis. X-axis indicates the number of genes/gene groups controlled by each transcription pathway in the gene list submitted. c, Changes in gene expression (Prg4, Hif3a, Vegf, Col10a1 and Mmp13) in C3H10T1/2 cells under hypoxia (1% oxygen for 8 hours). Cells are sham treated, infected with empty HDV (vector) or with HDV-PRG4 (PRG4) (*P<0.05, n=3, ANOVA). d, Changes of Prg4 and Hif3α expression under normoxia and hypoxia in TC71 Ewing sarcoma cells (*P<0.05, n=3, t-test). e, Changes of gene expression after Hif3α knockdown by siRNA (*P<0.05, n=3, ANOVA). f, Proposed model of PRG4 function in prevention of osteoarthritis development. Error bars indicate s.e.m.

Article Snippet: Primers used in quantitative PCR are listed as follows: mouse Prg4: F: ACTTCAGCTAAAGAGACACGGAGT, R: GTTCAGGTGGTTCCTTGGTTGTAGTAA; Sox9 : F: AAGCCACACGTCAAGCGACC, R: GTGCTGCTGATGCCGTAACT; Col2a1 : F: GCTCATCCAGGGCTCCAATGATGTAG, R: CGGGAGGTCTTCTGTGATCGGTA; Gapdh : F: GCAAGAGAGGCCCTATCCCAA R: CTCCCTAGGCCCCTCCTGTTATT; Vegf : F: TGGACTTGTGTTGGGAGGAGGATG, R: GCCTCTTCTTCCACCACCGTGTC; Mmp13 : F: GCAATCTTTCTTTGGCTTAGAGGT, R: GGTGTTTTGGGATGCTTAGGGT; Col10a1 : F: AAAGCTTACCCAGCAGTAGG, R: ACGTACTCAGAGGAGTAGAG; GAPDH : F: ATACCAGGAAATGAGCTTGACAAA, R: TGAAGGTCGGAGTCAACGGA; VEGF : F: GATCGGTGACAGTCACTAGCTTATCT, R: TACACACAAATACAAGTTGCCA; MMP13 : F: TGCCCTTCTTCACACAGACACTAACGAAA, R: GGCCACATCTACTATTCTTACCACTGCTC COL10A1 : F: GCCCACTACCCAAGACCAAGAC; R: GACCCCTCTCACCTGGACGAC; HIF3A : F: GGCTGTTCCGCCTACGAGTA; R: AGCAAGGTGGATGCTCTTG; PRG4 : Hs00981633_m1(applied biosciences); mouse Hif3a : Mm00469375_m1 (applied biosciences).

Techniques: Microarray, Transgenic Assay, Expressing, Activity Assay, Gene Expression, Infection, Plasmid Preparation, Knockdown

Journal: Journal of Virology

Article Title: The Kaposi’s Sarcoma-Associated Herpesvirus ORF34 Protein Interacts and Stabilizes HIF-2α via Binding to the HIF-2α bHLH and PAS Domains

doi: 10.1128/JVI.00764-19

Figure Lengend Snippet: Mapping of ORF34 interacting domains with HIF-2α. (A) Schematic diagram showing the different deletion mutants of ORF34 used in binding assays. (B) Identification of ORF34 binding domains to HIF-2α. HEK293 cells were cotransfected with expression plasmids encoding different deletion mutants of GFP-tagged ORF34 and Flag-tagged degradation-resistant HIF-2α. Proteins from cell lysates were immunoprecipitated with anti-GFP trap beads, and Western blotting was performed with anti-Flag antibody. (C) Cell extracts were used to detect HIF-2α and deletion mutants of ORF34 proteins using specific antibodies. (D) In vitro binding assay showing the regions of ORF34 that bind to HIF-2α. In vitro-translated deletion mutants of GST34 protein immobilized to GST trap agarose, incubated with in vitro-translated HA-tagged HIF-2α, and subjected to Western blotting with anti-HA antibody. (E) Expression levels of in vitro-synthesized deletion mutants of GST34 proteins used in the binding experiment detected by Western blotting with anti-GST antibody. IVT, in vitro translation. (F) Identification of ORF34 binding domains for HIF-3α. HEK293 cells were cotransfected with expression plasmids encoding different deletion mutants of GFP-tagged ORF34 and Flag-tagged HIF-3α. Thirty hours posttransfection, proteins from whole-cell extracts were immunoprecipitated with anti-GFP trap agarose, and Western blotting was performed with anti-Flag antibody. (G). Whole-cell lysates were used to detect HIF-3α and deletion mutants of ORF34 proteins using specific antibodies.

Article Snippet: Myc-Flag-tagged HIF-3α plasmid (MR224296) was purchased from OriGene Technologies, Inc., Rockville, MD.

Techniques: Binding Assay, Expressing, Immunoprecipitation, Western Blot, In Vitro, Incubation, Synthesized

Journal: Scientific Reports

Article Title: miR-429 regulates the transition between Hypoxia-Inducible Factor (HIF)1A and HIF3A expression in human endothelial cells

doi: 10.1038/srep22775

Figure Lengend Snippet: (A) Hypoxia induces dynamic changes in the mRNA and protein expression profile of the HIF1A in HUVECs. The mRNA levels were monitored in qRT-PCR experiments. The results from 3 independent experiments (n = 12) are plotted normalized to TBP mRNA levels and expressed as a fold-change over the normoxic control. Error bars represent standard deviations. (B) Hypoxia induces dynamic changes of protein levels of HIF-1α and (C) the bar graphs show the relative protein amounts at each time point. The protein levels of were detected with SDS-PAGE and Western Blot and related to total protein levels. 2 individual samples (4 μg of total protein per lane) were tested for each time point and the experiments were repeated twice. The protein levels (bar graphs) are normalized to the normoxic control. Significant changes (p < 0.05) are marked with an “ * ”. (D) The predicted target site of miR-429 in HIF3A2-3. The localization of putative miR-429 sequence is shown aligned with the 3′UTR of HIF3A isoforms. The numbering is based on the human NCBI genomic sequence (RefSeq). (E) Hypoxia-induced changes in the expression profile of miR-429 in HUVECs. The miRNA level was monitored in quantitative real-time PCR experiments. The results from 3 independent experiments (n = 18) are plotted normalized to RNU44 and expressed as a fold change over the normoxic control ( * P < 0.05).

Article Snippet: TaqMan probes ids used were: 18 S - Hs99999901_s1; TBP - Hs4332659_m1; HIF1A - Hs00153153_m1; RNU44 - 001094; RNU48 - 001006; hsa-miR-429 - 001024, HIF3A - Hs00541711_m1; DDIT4 - Hs01111686_g1.

Techniques: Expressing, Quantitative RT-PCR, Control, SDS Page, Western Blot, Sequencing, Real-time Polymerase Chain Reaction

Journal: Scientific Reports

Article Title: miR-429 regulates the transition between Hypoxia-Inducible Factor (HIF)1A and HIF3A expression in human endothelial cells

doi: 10.1038/srep22775

Figure Lengend Snippet: ( A ) miR-429 alters the expression of HIF3A . HUVECs were transfected with miR-429 mimic or antagomir, and the mRNA levels were monitored in normoxic conditions and after 4 h and 8 h of exposure to hypoxia. HIF3A mRNA levels from 3 independent experiments (n = 12) are plotted normalized to 18S rRNA levels and expressed as a fold change over the transfection control. Significant changes (p < 0.05) are marked with an “ * ”. ( B ) The corresponding changes of HIF-3α2 protein levels of were detected with SDS-PAGE and Western Blot and normalized to the β-actin and total protein levels. (C) The bar graphs show the relative protein amounts at each condition normalized to the transfection control. (D) 2 individual samples (4 μg of total protein per lane) were tested for each treatment and the experiments were repeated twice. Mimic 429 (m429) and antagomir 429 (ant429) are shown for each condition.

Article Snippet: TaqMan probes ids used were: 18 S - Hs99999901_s1; TBP - Hs4332659_m1; HIF1A - Hs00153153_m1; RNU44 - 001094; RNU48 - 001006; hsa-miR-429 - 001024, HIF3A - Hs00541711_m1; DDIT4 - Hs01111686_g1.

Techniques: Expressing, Transfection, Control, SDS Page, Western Blot

Journal: Scientific Reports

Article Title: miR-429 regulates the transition between Hypoxia-Inducible Factor (HIF)1A and HIF3A expression in human endothelial cells

doi: 10.1038/srep22775

Figure Lengend Snippet: (A) HUVECs were transfected with HIF3A target sequence-specific target protector and/or the miR-429 analog (Mimic 429). Two days after transfection, the cells were placed in hypoxia for 4 h and the HIF3A mRNA levels were monitored in qRT-PCR experiments. The HIF3A levels results from 3 independent experiments (n = 12) are plotted normalized to TBP mRNA levels and expressed as a fold change over the transfection control. Significant changes (p < 0.05) are marked with an “ * ”. The corresponding changes of HIF-3α2 protein levels were detected with SDS-PAGE and Western Blot and normalized to the β-actin levels and total protein levels. (B) 2 individual samples (3 μg of total protein per lane) were tested for each treatment and the experiments were repeated twice.

Article Snippet: TaqMan probes ids used were: 18 S - Hs99999901_s1; TBP - Hs4332659_m1; HIF1A - Hs00153153_m1; RNU44 - 001094; RNU48 - 001006; hsa-miR-429 - 001024, HIF3A - Hs00541711_m1; DDIT4 - Hs01111686_g1.

Techniques: Transfection, Sequencing, Quantitative RT-PCR, Control, SDS Page, Western Blot

Journal: Scientific Reports

Article Title: miR-429 regulates the transition between Hypoxia-Inducible Factor (HIF)1A and HIF3A expression in human endothelial cells

doi: 10.1038/srep22775

Figure Lengend Snippet: Hypoxia induces dynamic changes in expression profiles of DDIT4 (A) in HUVECs. The results from 3 independent experiments (n = 18) are plotted normalized to TBP mRNA levels and expressed as a fold-change over the normoxic control. Error bars represent standard deviations. miR-429 mimic and antagomir modulate DDIT4 expression. (B) HUVECs were transfected with miR-429 mimic or antagomir and the mRNA levels were monitored in qRT-PCR experiments in normoxic conditions and after 4 and 8 hours of hypoxia. The mRNA levels from 3 independent experiments (n = 12) were normalized TBP mRNA levels and expressed as a fold change over the transfection control. miR-429 indirectly modulates the expression of DDIT4 mRNA levels during hypoxia through its actions on HIF3A mRNA. (C) mRNA levels were monitored in qRT-PCR experiments following transfection of HUVECs with HIF3A TP and HIF1A TP together with miR-429 analog (Mimic 429). The mRNA levels results from 3 independent experiments (n = 12) are normalized to TBP m RNA levels and expressed as a fold-change over the transfection control. Significant changes (p < 0.05) are marked with an “ * ”.

Article Snippet: TaqMan probes ids used were: 18 S - Hs99999901_s1; TBP - Hs4332659_m1; HIF1A - Hs00153153_m1; RNU44 - 001094; RNU48 - 001006; hsa-miR-429 - 001024, HIF3A - Hs00541711_m1; DDIT4 - Hs01111686_g1.

Techniques: Expressing, Control, Transfection, Quantitative RT-PCR

Journal: Scientific Reports

Article Title: miR-429 regulates the transition between Hypoxia-Inducible Factor (HIF)1A and HIF3A expression in human endothelial cells

doi: 10.1038/srep22775

Figure Lengend Snippet: HUVECs were transfected with miR-429 antagomir and the mRNA levels were monitored over the 48 h time course for HIF3A (A) and HIF1A (B) . The mRNA levels were monitored in qRT-PCR experiments. The results from 2 independent experiments (n = 6) are plotted normalized to 18S rRNA levels and expressed as a fold-change over the normoxic transfection control. Error bars represent standard deviation. Significant changes (p < 0.05) are marked with an “ * ”.

Article Snippet: TaqMan probes ids used were: 18 S - Hs99999901_s1; TBP - Hs4332659_m1; HIF1A - Hs00153153_m1; RNU44 - 001094; RNU48 - 001006; hsa-miR-429 - 001024, HIF3A - Hs00541711_m1; DDIT4 - Hs01111686_g1.

Techniques: Transfection, Quantitative RT-PCR, Control, Standard Deviation

Journal: Scientific Reports

Article Title: miR-429 regulates the transition between Hypoxia-Inducible Factor (HIF)1A and HIF3A expression in human endothelial cells

doi: 10.1038/srep22775

Figure Lengend Snippet: (A) Model of the miR-429 regulatory effects on the HIF-1/HIF-3 transition in HUVECs during hypoxia. During normoxia, miR-429 controls steady-state levels of HIF1A and HIF3A mRNA and keeps the levels low. Protein levels remain low through posttranslational modifications and subsequent degradation of these transcription factors when the oxygen levels are normal. During the early stages of hypoxia, HIF1A message and protein are dramatically elevated, while the HIF3A variants and protein remain low. HIF-1α drives a number of pro-survival and angiogenic target genes and also promotes miR-429 and HIF3A up regulation. miR-429 decreases the steady-state levels of both HIF1A and HIF3A mRNA. During prolonged hypoxia, HIF-1α levels and miR-429 are low, and HIF3A mRNA and HIF-3α protein accumulate over time, leading to the induction of HIF-3 pro-survival gene expression. (B) The HIF1A and HIF3A relative expression levels (Fragments Per Kilobase of transcript per Million mapped reads) in HUVECs, analysis made base on 2 NGS analysis of 2 independent samples of normoxic HUVEC cells passage 3. Error bars represent SEM.

Article Snippet: TaqMan probes ids used were: 18 S - Hs99999901_s1; TBP - Hs4332659_m1; HIF1A - Hs00153153_m1; RNU44 - 001094; RNU48 - 001006; hsa-miR-429 - 001024, HIF3A - Hs00541711_m1; DDIT4 - Hs01111686_g1.

Techniques: Gene Expression, Expressing