Journal: The Journal of Biological Chemistry

Article Title: Assembly and Function of the Major Histocompatibility Complex (MHC) I Peptide-loading Complex Are Conserved Across Higher Vertebrates *

doi: 10.1074/jbc.M114.609263

Figure Lengend Snippet: Avian and mammalian TAP complexes interact with tapasin. Immunodetection of human tapasin after tandem-affinity purification of avian and mammalian TAP complexes expressed in HEK293T. Expression of TAP1 is colored in yellow, that of TAP2 in blue. A white signal indicates a spectral overlap of the YFP and the CFP channel. Tapasin was detected by the antibody 7F6. The input after solubilization (A) and the tandem-affinity purified PLC (B) are shown.

Article Snippet: Here, we cloned, expressed, and analyzed the function of more than 20 heterodimeric TAP complexes across different taxa: six mammals (human, cow, pig, dog, mouse, rat: Homo sapiens , Bos taurus , Sus scrofa, Canis familiaris , Mus musculus , and Rattus norvegicus, respectively), and four birds (duck, quail, chicken, turkey: Anas platyrhynchos , Coturnix coturnix , Gallus gallus, and Meleagris gallopavo, respectively).

Techniques: Immunodetection, Affinity Purification, Expressing

Journal:

Article Title: Inducible DNA-loop formation blocks transcriptional activation by an SV40 enhancer

doi: 10.1038/sj.emboj.7600531

Figure Lengend Snippet: Exclusion of internal contact and bead string models for enhancer regulation. (A) tHD with different DNA-binding and heterodimerization domains. (B, D) Transregulators are indicated schematically in column one. The predicted regulatory situations are shown in column two. Cells were cultured in the absence (white bars), in the presence (dark gray bars) of dox, in the presence of AP21967 (light gray bars) or in the presence of dox and AP21967 (black bars). Repression factors and basal luciferase activity are indicated. Values represent the means of triplicate samples with standard deviations given in corrected relative light units (corr. RLU) per μg of total cell protein. (C, E) Western blot analysis to detect the respective transregulators in HeLa cell extracts.

Article Snippet: The heterodimerization domains FRB(T2098L) and FKBP12 were PCR-amplified with the primers ‘5′-FRB-Dom' (CATGGCGCCGGCAATCCTCTGGCATGAGATGTGG ) and ‘FRB-Dom-3′' (GTACGGCCCGGGTCACTTTGAGATTCGTCGGAAC ACATG) or ‘5′-FKBP' (AAAGGTGCCGGCAGGAGTGCAGGTGGAAACCATC ) and ‘FKBP-3′' (TTCTCACCCGGGTTAATAACTAGTTTCCAGTTTT AG), respectively, from the templates pC 4 EN-F1 and pC 4 -RHE of the ARGENT TM Regulated Heterodimerization Kit of ARIAD Pharmaceuticals ( www.ariad.com/regulationkits ).

Techniques: Binding Assay, Cell Culture, Luciferase, Activity Assay, Western Blot

Journal: Antibodies

Article Title: Asymmetric Fc Engineering for Bispecific Antibodies with Reduced Effector Function

doi: 10.3390/antib6020007

Figure Lengend Snippet: Thermograms of exemplary asymmetric antibody constructs compared to wild-type antibody (WT). ( A ) The thermograms for WT, and AAC2-AAC6. ( B ) The identity of the two transitions in the WT. The first transition corresponds to the unfolding of the CH2 domain, the second transition corresponds to the unfolding of the CH3 + Fab. ( C ) The overlay of a number of samples showing how the CH2 transition of the variants has shifted to a higher Tm value, indicating higher stability.

Article Snippet: Recently, Leaver-Fay et al. [ ] produced new CH3 heterodimeric designs and compared the Tm of the CH3 domain for Genentech’s KH (69.9 °C) [ ], Amgen’s charge inversion (68.8 °C) [ ], their new designs (~71 °C) [ ], and the CH3 mutations employed here (81.2 °C) [ ].

Techniques: Construct