|
Thermo Fisher
gene exp hdac7 hs00248789 m1 Gene Exp Hdac7 Hs00248789 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp hdac7 hs00248789 m1/product/Thermo Fisher Average 87 stars, based on 1 article reviews
gene exp hdac7 hs00248789 m1 - by Bioz Stars,
2026-03
87/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
phospho s259 hdac5 Phospho S259 Hdac5, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phospho s259 hdac5/product/Cell Signaling Technology Inc Average 94 stars, based on 1 article reviews
phospho s259 hdac5 - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
phosphorylated bad Phosphorylated Bad, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phosphorylated bad/product/Cell Signaling Technology Inc Average 96 stars, based on 1 article reviews
phosphorylated bad - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
hdac7 ![]() Hdac7, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hdac7/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
hdac7 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
OriGene
hdac7 ![]() Hdac7, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hdac7/product/OriGene Average 90 stars, based on 1 article reviews
hdac7 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp hdac7 hs01045864 m1 ![]() Gene Exp Hdac7 Hs01045864 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp hdac7 hs01045864 m1/product/Thermo Fisher Average 93 stars, based on 1 article reviews
gene exp hdac7 hs01045864 m1 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
hdac7 ![]() Hdac7, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hdac7/product/Cell Signaling Technology Inc Average 94 stars, based on 1 article reviews
hdac7 - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
BPS Bioscience
hdac7 bps bioscience ![]() Hdac7 Bps Bioscience, supplied by BPS Bioscience, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hdac7 bps bioscience/product/BPS Bioscience Average 94 stars, based on 1 article reviews
hdac7 bps bioscience - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Bethyl
hdac7 ![]() Hdac7, supplied by Bethyl, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hdac7/product/Bethyl Average 90 stars, based on 1 article reviews
hdac7 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
pcdna3 1 vector addgene 13824 m789 flag hdac8 ![]() Pcdna3 1 Vector Addgene 13824 M789 Flag Hdac8, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcdna3 1 vector addgene 13824 m789 flag hdac8/product/Addgene inc Average 93 stars, based on 1 article reviews
pcdna3 1 vector addgene 13824 m789 flag hdac8 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp hdac7 mm00469527 m1 ![]() Gene Exp Hdac7 Mm00469527 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp hdac7 mm00469527 m1/product/Thermo Fisher Average 85 stars, based on 1 article reviews
gene exp hdac7 mm00469527 m1 - by Bioz Stars,
2026-03
85/100 stars
|
Buy from Supplier |
|
Proteintech
hdac7 ![]() Hdac7, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hdac7/product/Proteintech Average 93 stars, based on 1 article reviews
hdac7 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Frontiers in Pharmacology
Article Title: Class IIa histone deacetylase inhibition ameliorates acute kidney injury by suppressing renal tubular cell apoptosis and enhancing autophagy and proliferation
doi: 10.3389/fphar.2022.946192
Figure Lengend Snippet: Expression of HDAC4, HDAC5, HDAC7, and HDAC9 in the kidney following ischemia/reperfusion (I/R) and folic acid (FA) injury (A) At 48 h after sham operation or I/R, kidneys were collected and tissue lysates were subjected to immunoblot analysis with antibodies against HDAC4, 5, 7, 9, and GAPDH. Representative immunoblots are three samples in each group (B) Expression levels of HDAC4, 5, 7, 9 were quantified by densitometry and normalized with GAPDH. Data are expressed as means ± SD ( n = 3). ** p < 0.01 (C) At 48 h after sham operation, FA, or I/R, kidneys were collected and tissue sections were subjected to immunohistochemical staining followed by photomicrograph illustrating protein expression of individual class IIa HDACs. Scale bar, 20 µm. Original magnification, ×200.
Article Snippet: Antibodies to HDAC4, HDAC5,
Techniques: Expressing, Western Blot, Immunohistochemical staining, Staining
Journal: Oncogene
Article Title: Identification of a cancer stem cell-specific function for the histone deacetylases, HDAC1 and HDAC7, in breast and ovarian cancer
doi: 10.1038/onc.2016.337
Figure Lengend Snippet: CSC-Like BPLER cells are associated with high HDAC1 and HDAC7 expression and sensitivity to pan-HDAC inhibitors. ( a ) The pan-HDAC inhibitor TSA preferentially inhibits BPLER proliferation (blue line), compared to HMLER (red line). The results are representative of at least three independent experiments, presented as a percentage of vehicle treated control, the error bars represent standard deviation of the mean ( P <0.005). ( b ) Short-term (24 h) pretreatment with TSA (0.35 μ M ), preferentially inhibits BPLER sphere formation (3D) in drug-free medium with no effect on 2D proliferation in either BPLER or HMLER. In contrast, pretreatment with Taxol (50 n M ) and 5-Fluorouracil (1.0 μ M ), preferentially inhibit 2D proliferation as compared to 3D sphere formation. The number of viable colonies from triplicate wells were determined by 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-phenyl-2H-tetrazolium chloride (INT) staining. Results are representative of at least three independent experiments presented as percentage of vehicle treated control ( P <0.05). BPLER: 2D proliferation (white bars with blue outline) vs 3D sphere formation (blue bars). HMLER: 2D proliferation (white bars with red outline) vs 3D sphere formation (red bars). The error bars represent standard deviation of the mean. ( c ) BPLER cell lines express higher levels of HDAC1 and HDAC7 proteins compared to matched HMLER lines. Western blot of whole-cell lysates. β-Actin represents loading control. ( d ) Heatmap of the mRNA expression profile of HDAC1-11 does not reveal any consistent differences between BPLER and HMLER lines (red, increased expression; green, decreased expression). ( e ) Treatment of BPLER cells for 48 h with TSA (0.35 μ M ) leads to downregulation of HDAC1, HDAC7, CD44 and CD166 protein expression in BPLER cells. Western blot of whole-cell lysates. β-Actin represents loading control. ( f ) Double immunofluorescence staining of BPLER cells simultaneously with HDAC7 and CD44 antibodies demonstrate that HDAC7 and CD44 are co-expressed. DAPI (blue), HDAC7 (red) CD44 (green). Scale bar 25 μ M .
Article Snippet: HDAC1-Flag (provided by Eric Verdin through Addgene, Cambridge, MA, USA; plasmid#13820) and
Techniques: Expressing, Standard Deviation, Staining, Western Blot, Double Immunofluorescence Staining
Journal: Oncogene
Article Title: Identification of a cancer stem cell-specific function for the histone deacetylases, HDAC1 and HDAC7, in breast and ovarian cancer
doi: 10.1038/onc.2016.337
Figure Lengend Snippet: CSCs isolated from standard breast and ovarian cancer cell lines express higher protein levels of HDAC1 and HDAC7, and have increased HDAC enzymatic activity. ( a ) The higher sphere forming capacity of CD44 high /CD166 high CSCs (black bars) compared to CD44 low /CD166 low nsTC cells (white bars) is observed in multiple breast (SUM159, MDA-231, and MCF7) and ovarian (SKOV3 and OV90) cell lines. The data are presented as the mean of sphere counts from triplicate wells, the error bars represent standard deviation of the mean ( P <0.01). The results are representative of at least three independent experiments. ( b ) The higher HDAC enzyme activity is observed CD44 high /CD166 high CSCs (black bars) compared to CD44 low /CD166 low nsTCs (white bars) in multiple breast (SUM159, MDA-231, and MCF7) and ovarian (SKOV3 and OV90) and colon (HT29) cancer cell lines. Results are representative of at least three independent experiments. The error bars represent standard deviation of the mean ( P <0.01). ( c ) HDAC1 and HDAC7 protein expression is significantly higher in CD44 high /CD166 high CSCs ( +/+ ) from multiple breast (BPLER, MDA-MB-231, MCF7, SUM159) and ovarian (SKOV3) cancer cell lines compared to nsTC ( −/− , CD44 low /CD166 low ). Merged image of two Western blots run with whole-cell lysates, gel#1(BPLER, MDA-MB-231, MCF7, SUM159) and gel#2(SKOV3). β-Actin represents loading control. ( d ) HDAC7 high (red) and CD44 high (green) co-expression in ovarian cancer cell line SKOV3, demonstrated with double IF staining. Scale bar 25 μ M . ( e ) Double IF staining identifies co-expression of CSC-markers (CD44, CD326, CD166, ALDH1, CD29) with HDAC7 in standard breast cell lines (MDA-MB-231, MCF7, SUM159), and primary human ovarian (OCI-P5x and OCI-E1p) and breast cancer cells (BCI-1009 and BCI-1133). ( Y ) represents consistent positive correlation of HDAC7 and CSC marker expression in surveyed lines. ( y ) represents positive, but inconsistent correlation. ( N ) represents lack of correlation. ( n/a ), not analyzed. ( n/e ) CSC marker not expressed in cell line. IF staining was repeated a minimum of two times for each line. See for additional markers and cell lines.
Article Snippet: HDAC1-Flag (provided by Eric Verdin through Addgene, Cambridge, MA, USA; plasmid#13820) and
Techniques: Isolation, Activity Assay, Standard Deviation, Expressing, Western Blot, Staining, Marker
Journal: Oncogene
Article Title: Identification of a cancer stem cell-specific function for the histone deacetylases, HDAC1 and HDAC7, in breast and ovarian cancer
doi: 10.1038/onc.2016.337
Figure Lengend Snippet: Confirmation of CSC sensitivity to pan-HDAC inhibitors in other model systems. ( a ) The black lines within the red and green regions indicate different CMAP experiments that display significant upregulation (red) or downregulation (green) of the 154 BPLER lethality genes upon treatment with the indicated drugs. Black lines in the gray area indicate CMAP experiments with no significant variation. ( b ) The percent viability of BPLER and HMLER cells that were treated with TSA, Vorinostat, Loperamide and Triamterene at the indicated doses. A vehicle-treated control was used to estimate relative percent cell viability for each treatment. BPLER (blue line), HMLER cells (red line). The error bars represent standard deviation of the mean ( P <0.005). ( c ) HDAC1, HDAC7 and CD166 proteins are expressed significantly higher in the CD44 high /CD24 low+ CSCs ( CD24 L ) compared to CD44 high /CD24 Neg ns-TS ( CD24 N ) MDA-MB-231 cells. Western blot of whole-cell lysates. β-Actin represents loading control. ( d ) The mRNA expression heatmap of CD44 high /CD24 low+ CSCs ( CD24 L ) compared to CD44 high /CD24 Neg nsTC ( CD24 N ) MDA-MB-231 cells, with high (red) and low (green) expression. The difference in expression for any HDAC family members between the two populations was less than 1.1 fold. ( e ) The sensitivity of CD24-negative ( CD24 N ) vs CD24-low ( CD24 L ) MDA-MB-231 cells to 60 epigenetic compounds was measured. The upward sloping curve marked with blue stars indicate 12 of drugs that preferentially inhibit the proliferation CD44 high /CD24 low+ MDA-MB-231 CSCs. including Trichostatin (a1), Apicidin (a6), Scriptaid (a8), Vorinistat (a12), M-344 (b8), Fluoro-SAHA (b12), Oxamflatin (c10), BML-281 (d6), Rocilinostat (e5), CUDC-907 (e6), CUDC-101 (e7). Dimethyl sulfoxide controls are shown in the last two rows. The red star identifies one compound (GSK126) that selectively killed CD24 neg cells.
Article Snippet: HDAC1-Flag (provided by Eric Verdin through Addgene, Cambridge, MA, USA; plasmid#13820) and
Techniques: Standard Deviation, Western Blot, Expressing
Journal: Oncogene
Article Title: Identification of a cancer stem cell-specific function for the histone deacetylases, HDAC1 and HDAC7, in breast and ovarian cancer
doi: 10.1038/onc.2016.337
Figure Lengend Snippet: Knockdown of HDAC1 or HDAC7 alters the CSC phenotype in breast and ovarian cancer cell lines. ( a ) The knockdown of HDAC1 with shRNA reduces HDAC1, CD44 and CD166 protein levels in breast (MDA-MB-468/MCF7) and ovarian (SKOV3) cancer cell lines compared to a scramble shRNA control. Western blot of whole-cell lysates. β-Actin represents loading control. ( b ) HDAC1 knock-down with shRNA decreases 3D sphere formation (dark blue bars) more significantly than 2D proliferation (light blue bars) as compared a scramble shRNA-expressing control (white bars) in breast (MDA-MB-468, and MCF7) and ovarian (SKOV3) carcinoma cell lines. The data are presented as a percentage of the scramble shRNA controls. The error bars represent standard deviation of the mean from three replicates (* P <0.05)(** P <0.005). The results are representative of at least three independent experiments. Similar results were observed with additional HDAC1 shRNA constructs and in additional cell lines . ( c ) HDAC1 knockdown decreases tumour size in SUM159 breast cancer xenografts expressing two different stable HDAC1-shRNAs (shH1#1 and shH1#2) as compared to control scramble shRNA (shCntrl). Mean xenograft size measured from mice injected with 10 000 cells and plotted over time weeks) ( P <0.05). ( d ) HDAC1 knockdown decreases tumour frequency in MDA-MB-231 xenografts expressing stable HDAC1-shRNA as compared to a scramble shRNA control line. TIC frequency calculated by limiting dilution analysis using http://bioinf.wehi.edu.au/software/elda/ . TIC frequency of control cells (1.05 × 10 −5 ), HDAC1 shRNA#1 (4.42 × 10 −5 ) ( P <0.005) and HDAC1 shRNA#2 (4.62 × 10 −5 ) ( P <0.005). ( e ) The knockdown of HDAC7 with shRNA reduces HDAC7, CD44 and CD166 protein levels compared to a scramble shRNA control in breast (MDA-MB-468, and MCF7) and ovarian (SKOV3) carcinoma cell line within 72 h western blot of whole-cell lysates. β-Actin represents loading control. ( f ) HDAC7 knockdown with shRNA decreases 3D sphere formation (dark green bars) more significantly than 2D proliferation (light green bars) as compared to a scramble shRNA-expressing control (white bars) in breast (MDA-MB-468, and MCF7) and ovarian (SKOV3) carcinoma cell lines. The results from one shRNA construct is shown, similar results were observed with additional HDAC7 shRNA constructs and in additional cell lines . The cells are counted after trypan blue (2D) or INT staining (3D), and the results are presented as a percentage of the scramble shRNA control. The error bars represent standard deviation of the mean from three replicates (* P <0.05) (** P <0.01). The results are representative of at least three independent experiments.
Article Snippet: HDAC1-Flag (provided by Eric Verdin through Addgene, Cambridge, MA, USA; plasmid#13820) and
Techniques: shRNA, Western Blot, Expressing, Standard Deviation, Construct, Injection, Software, Staining
Journal: Oncogene
Article Title: Identification of a cancer stem cell-specific function for the histone deacetylases, HDAC1 and HDAC7, in breast and ovarian cancer
doi: 10.1038/onc.2016.337
Figure Lengend Snippet: Overexpression of HDAC7 alters the CSC phenotype in breast and ovarian cancer cell lines. ( a ) HDAC7 over-expression (H7) increases CD44 and CD166 protein expression in MCF7 and SUM159, and CD44v(*) in SUM159 and HCC1937, compared to control cells expressing empty vector (EV). Western blot of whole-cell lysates. β-Actin represents loading control. ( b ) HDAC7 overexpression increases 3D sphere formation (dark green bars) with minimal effect on 2D proliferation (light green bars), as compared to an EV-expressing control (white bars), in breast (MCF7/HCC1937) and ovarian (CaOV3) cell lines. 2D growth assays were counted after trypan blue staining to assess viable cells counts. 3D sphere assays were counted after INT staining. The data is presented as a percentage of the EV-expressing control. The error bars represent standard deviation of the mean from triplicates (* P <0.05) (** P <0.01). The results are representative of at least three independent experiments. See for additional cell lines. ( c ) Image of a representative well corresponding to the counts of 3D spheres in panel b. These images illustrate that both the number and size of the spheres are increased in MCF7 and HCC1937 cells over-expressing HDAC7-GFP as compared to an EV-expressing control. ( d ) HDAC7 overexpression increases TIC frequency in MDA-MB-231 xenografts expressing HDAC7-CMV as compared to EV-control. TIC frequency calculated by limiting dilution analysis using http://bioinf.wehi.edu.au/software/elda/ . TIC frequency of control cells (1.14 × 10 −5 ) and HDAC7 over-expressing cells (H7-CMV) (5.56 × 10 −4 )( P <0.03).
Article Snippet: HDAC1-Flag (provided by Eric Verdin through Addgene, Cambridge, MA, USA; plasmid#13820) and
Techniques: Over Expression, Expressing, Plasmid Preparation, Western Blot, Staining, Standard Deviation, Software
Journal: Oncogene
Article Title: Identification of a cancer stem cell-specific function for the histone deacetylases, HDAC1 and HDAC7, in breast and ovarian cancer
doi: 10.1038/onc.2016.337
Figure Lengend Snippet: Isoform-specific HDACis that inhibit HDAC1 and HDAC7 can be used to selectively target CSCs. ( a ) The HDAC class I specific drugs that also downregulate HDAC7 (MS275 and MGCD) significantly inhibit BPLER proliferation (blue bar), with minimal effect on HMLERs (red bar). The class II specific HDACi MC1568 and MC1575 also preferentially inhibit BPLER proliferation compared to matched HMLER lines. In contrast, the HDACi that do not target HDAC1 or HDAC7 (Droxinostat and Apicidin) preferentially inhibit HMLER. The cells were treated with MS275 (1 μM), MGCD0103 (1 μM), MC1568 (1 μM), MC1575 (1 μM), Apicidin (0.1 μM) and Droxinostat (5 μM). Similar results were observed with two additional matched BPLER/HMLER pairs, in at least three independent experiments. The viable cells were assessed with trypan blue staining and counted after four days of treatment. Inhibition in proliferation is represented as a percentage of vehicle treated control (white bar). The error bars represent the standard deviation of the mean of triplicate samples ( P <0.005). ( b ) Isoform-specific HDACis that target HDAC1 and/or HDAC7 (MS-275 and MGCD0103) preferentially inhibit 3D sphere formation (black bars) compared to 2D proliferation (grey bars). The breast cancer (BPLER, SUM159, MCF7, ZR751) and ovarian cancer (SKOV3) cell lines were pre-treated for 24 h with MS-275 (1 μ M ), MGCD0103 (1 μ M ) or MC1568 (1 μ M ). The next day, 2D and 3D cultures were established in drug-free medium. In contrast, pre-treatment with Droxinostat (5 μ M ) has minimal effects on 2D or 3D cell proliferation. The number of viable cells for 2D growth was determined by trypan blue staining. The number of 3D spheres was determined by INT staining. Inhibition in proliferation is represented as a percentage of vehicle treated control (white bar). The error bars represent the standard deviation of the mean of triplicate samples (* P <0.05) (** P <0.01). ( c ) The level of HDAC7 protein expression is significantly downregulated by short-term (24 h) treatment with MS-275 or MGCD0103 at 1 μM (low) or 2 μM (high) doses, but not with MC1568 or Droxinostat at 1 μM (low) or 5 μM (high) doses in SUM159 cells. Similar results are observed with BPLER, MCF7 and MDA-MB-231 cells (data not shown). Western blots of whole-cell lysates. β-Actin ( * ) was used as a loading control. ( d ) MS-275 pretreatment preferentially inhibits 3D sphere formation (black bars) compared to 2D proliferation (grey bars) in a panel of primary human ovarian cancer cell lines, including; OCI-C5x (clear cell), OCI-P7a (papillary serous), OCI-P9a1 (papillary serous) and OCI-P5x (papillary serous). The lines were pre-treated for 24 h with 1 μ M MS-275, and plated into 2D and 3D cultures the following day in drug-free medium. The number of viable cells for 2D growth was determined by trypan blue staining. The number of 3D spheres was determined by INT staining. Inhibition in proliferation is represented as a percentage of vehicle treated control (white bar). The error bars represent the standard deviation of the mean of triplicate samples (* P <0.05) (** P <0.01).
Article Snippet: HDAC1-Flag (provided by Eric Verdin through Addgene, Cambridge, MA, USA; plasmid#13820) and
Techniques: Staining, Inhibition, Standard Deviation, Expressing, Western Blot
Journal: Nature Communications
Article Title: K235 acetylation couples with PSPC1 to regulate the m 6 A demethylation activity of ALKBH5 and tumorigenesis
doi: 10.1038/s41467-023-39414-4
Figure Lengend Snippet: a HADC7 overexpression reduced ALKBH5 acetylation at K235. HeLa cells were transfected with the indicated plasmids together with the ALKBH5-HA vector; ALKBH5-HA was IPed using anti-HA antibody, and K235 acetylation in the IPed ALKBH5-HA was determined using the anti-pan acetylated lysine antibody. b , c ALKBH5 interacted with HDAC7. The ALKBH5-HA and HDAC7-FLAG plasmids were cotransfected into HeLa cells, and the HDAC7-FLAG ( b ) and ALKBH5-HA ( c ) complexes were co-IPed using anti-FLAG and anti-HA antibodies, respectively. ALKBH5-HA and HDAC7-FLAG were detected. d Silencing of HDAC7 increased the endogenous K235 acetylation of ALKBH5. HeLa cells were transfected with anti-HDAC7 siRNAs, and K235 acetylation was determined. e HDAC7 overexpression decreased the endogenous K235 acetylation of ALKBH5. HeLa cells were transfected with the indicated dose of HDAC7 plasmid, and K235 acetylation was determined. f HDAC7 directly deacetylated ALKBH5 at K235 in a dose-dependent manner in the in vitro deacetylation reaction. Immunopurified wild-type ALKBH5 containing K235-acetylated ALKBH5 stimulated by KAT8 overexpression was incubated with the indicated dose of immunopurified HADC7, and ALKBH5 acetylation at K235 was determined using anti-Ac K235 and anti-pan acetylated lysine antibodies. Source data are provided as a Source Data file.
Article Snippet: The indicated proteins were detected using the following antibodies: anti-Ac-K235 (developed in our lab, 1:500), acetylated lysine (Pan-Ac) (9814, CST, RRID:AB_10544700, 1:1000), ALKBH5 (703570, Thermo Fisher Scientific, RRID: AB_2762417, 1:1000), FLAG (M185-3 L, MBL, RRID: AB_11123930, 1:2000), HA (561, MBL, RRID: AB_591839, 1:2000), V5 (66007-1-Ig, Proteintech, RRID: AB_2734694, 1:1000), KAT8 (ab200660, Abcam, 1:1000),
Techniques: Over Expression, Transfection, Plasmid Preparation, In Vitro, Incubation
Journal: Nature Communications
Article Title: K235 acetylation couples with PSPC1 to regulate the m 6 A demethylation activity of ALKBH5 and tumorigenesis
doi: 10.1038/s41467-023-39414-4
Figure Lengend Snippet: a , b K235 acetylation of ALKBH5 decreased the cellular mRNA m 6 A levels. The wild-type ALKBH5 and its mutant K235R and K235Q plasmids were transfected into ALKBH5 KO HeLa cells, and the cellular mRNA m 6 A level was determined by dot blotting ( a ) and quantified by LC‒MS/MS analysis ( b ) (n = 3, two-tailed unpaired Student’s t test, mean ± SD). c , d Wild-type ALKBH5, but not the K235R mutant, directly demethylated m 6 A in the m 6 A-RNA oligos in the in vitro demethylation reaction. Immunopurified wild-type ALKBH5 and its mutant K235R ( c ) or recombinant wild-type ALKBH5 and its mutant K235R ( d ) were incubated with m 6 A RNA oligos; the m 6 A level was determined by dot blotting or LC‒MS/MS assays. e Cumulative distribution curve for the m 6 A peak abundance in NC, WT and K235R cells. f Distribution of m 6 A peaks in the 5′ UTR, CDS, stop codon and 3′ UTR in NC, WT and K235R cells. g Top consensus motif identified by HOMER with m 6 A peaks in NC, WT and K235R cells. h The indicated ALKBH5 vectors together with the KAT8 plasmid were cotransfected into ALKBH5 KO HeLa cells, and the cellular RNA m 6 A level was determined. i , j Recombinant wild-type ALKBH5 or its K235R mutant was incubated with m 6 A RNA oligos after recombinant wild-type ALKBH5 or its K235R mutant was treated with immunopurified KAT8 ( i ) or immunopurified HDAC7 ( j ), and the m 6 A level was determined. Source data are provided as a Source Data file.
Article Snippet: The indicated proteins were detected using the following antibodies: anti-Ac-K235 (developed in our lab, 1:500), acetylated lysine (Pan-Ac) (9814, CST, RRID:AB_10544700, 1:1000), ALKBH5 (703570, Thermo Fisher Scientific, RRID: AB_2762417, 1:1000), FLAG (M185-3 L, MBL, RRID: AB_11123930, 1:2000), HA (561, MBL, RRID: AB_591839, 1:2000), V5 (66007-1-Ig, Proteintech, RRID: AB_2734694, 1:1000), KAT8 (ab200660, Abcam, 1:1000),
Techniques: Mutagenesis, Transfection, Two Tailed Test, In Vitro, Recombinant, Incubation, Plasmid Preparation
Journal: Nature Communications
Article Title: K235 acetylation couples with PSPC1 to regulate the m 6 A demethylation activity of ALKBH5 and tumorigenesis
doi: 10.1038/s41467-023-39414-4
Figure Lengend Snippet: a The in vitro binding of wild-type ALKBH5 and its mutant K235R to m 6 A-unmethylated or methylated RNA oligos was investigated in ALKBH5 KO HeLa cells stably re-expressing wild-type ALKBH5 or its mutant K235R using RNA pulldown assays. b The in vitro binding of recombinant wild-type ALKBH5 and its mutant K235R to m 6 A-unmethylated or methylated RNA oligos was investigated. c , d The in vitro binding of recombinant wild-type ALKBH5 and its mutant K235R to m 6 A-unmethylated or methylated RNA oligos was investigated after the recombinant wild-type ALKBH5 or its mutant K235R were treated by immunopurified KAT8 ( c ) or by immunopurified HDAC7 ( d ). Source data are provided as a Source Data file.
Article Snippet: The indicated proteins were detected using the following antibodies: anti-Ac-K235 (developed in our lab, 1:500), acetylated lysine (Pan-Ac) (9814, CST, RRID:AB_10544700, 1:1000), ALKBH5 (703570, Thermo Fisher Scientific, RRID: AB_2762417, 1:1000), FLAG (M185-3 L, MBL, RRID: AB_11123930, 1:2000), HA (561, MBL, RRID: AB_591839, 1:2000), V5 (66007-1-Ig, Proteintech, RRID: AB_2734694, 1:1000), KAT8 (ab200660, Abcam, 1:1000),
Techniques: In Vitro, Binding Assay, Mutagenesis, Methylation, Stable Transfection, Expressing, Recombinant
Journal: Nature Communications
Article Title: K235 acetylation couples with PSPC1 to regulate the m 6 A demethylation activity of ALKBH5 and tumorigenesis
doi: 10.1038/s41467-023-39414-4
Figure Lengend Snippet: a – d The ALKBH5 protein level ( a ); cell proliferation ( b ) ( n = 3); and migration, invasion ( c ) ( n = 5), and colony formation ( d ) ( n = 3) were determined in ALKBH5 KO HeLa cells stably re-expressing wild-type ALKBH5 or its mutants K235R or K235Q. e The in vivo tumorigenesis of the indicated ALKBH5 KO HeLa cells stably re-expressing wild-type ALKBH5 or its mutant K235R was examined, and the weights of the xenograft tumors were analyzed (n = 10 mice per group). f The levels of the indicated proteins were determined in ALKBH5 KO HeLa cells stably reexpressing wild-type ALKBH5 or its mutant K235R. g K235 acetylation and ALKBH5, KAT8, and HDAC7 levels were determined in ten pairs of fresh liver and gastric cancer tissues and their corresponding nontumor tissues. h A regulatory model of ALKBH5 m 6 A demethylation activity is elucidated in which K235-acetylated ALKBH5 primarily functions as the catalytic core, and PSPC1 serves as an RNA-binding platform to recruit and facilitate the recognition of RNA m 6 A by ALKBH5 by interacting with K235-acetylated ALKBH5, thereby promoting RNA m 6 A erasure. Two-tailed unpaired Student’s t test in c – e and two-way ANOVA in ( b ). The data are represented as the mean ± SD. ** p < 0.01, *** p < 0.001, ns indicates no significance. Source data are provided as a Source Data file.
Article Snippet: The indicated proteins were detected using the following antibodies: anti-Ac-K235 (developed in our lab, 1:500), acetylated lysine (Pan-Ac) (9814, CST, RRID:AB_10544700, 1:1000), ALKBH5 (703570, Thermo Fisher Scientific, RRID: AB_2762417, 1:1000), FLAG (M185-3 L, MBL, RRID: AB_11123930, 1:2000), HA (561, MBL, RRID: AB_591839, 1:2000), V5 (66007-1-Ig, Proteintech, RRID: AB_2734694, 1:1000), KAT8 (ab200660, Abcam, 1:1000),
Techniques: Migration, Stable Transfection, Expressing, In Vivo, Mutagenesis, Activity Assay, RNA Binding Assay, Two Tailed Test
Journal: Physiological Reports
Article Title: Differential regulation of K Ca 2.1 ( KCNN1 ) K + channel expression by histone deacetylases in atrial fibrillation with concomitant heart failure
doi: 10.14814/phy2.14835
Figure Lengend Snippet: TaqMan assays and CYBR‐green primers used for real‐time quantitative polymerase chain reactions
Article Snippet: HDAC7 , Hs01045864_m1 , F: 5‘‐CGGGAGCTCAAGAACGGTTT R: 5‘‐CCATGGCTGTGGAATGGTCT ,
Techniques: