96
|
Addgene inc
christoph bock Christoph Bock, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide/pmc12808753-272-17-19?v=Addgene+inc Average 96 stars, based on 1 article reviews
christoph bock - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
95
|
OriGene
tgccagtcagaagaacgacc Tgccagtcagaagaacgacc, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide/bio_rxiv__2025__08__28__672891-224-23-35?v=OriGene Average 95 stars, based on 1 article reviews
tgccagtcagaagaacgacc - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
90
|
OriGene
crispr cas starter kit  Crispr Cas Starter Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide/pmc05116475-65-2-0?v=OriGene Average 90 stars, based on 1 article reviews
crispr cas starter kit - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
95
|
OriGene
pcas9 guide Pcas9 Guide, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide/pmc10170197-360-12-13?v=OriGene Average 95 stars, based on 1 article reviews
pcas9 guide - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
93
|
OriGene
crispri Crispri, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide/pm39889695-793-9-14?v=OriGene Average 93 stars, based on 1 article reviews
crispri - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
92
|
Addgene inc
perturb seq guide barcode gbc library Perturb Seq Guide Barcode Gbc Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide/pmc12680425-84-4-9?v=Addgene+inc Average 92 stars, based on 1 article reviews
perturb seq guide barcode gbc library - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
92
|
OriGene
plenti cas guide vector Plenti Cas Guide Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide/pm38008278-71-5-8?v=OriGene Average 92 stars, based on 1 article reviews
plenti cas guide vector - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
95
|
OriGene
com products gene expression crispr cas9 Com Products Gene Expression Crispr Cas9, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide/pmc07019046__mmc2-202-16-15?v=OriGene Average 95 stars, based on 1 article reviews
com products gene expression crispr cas9 - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
92
|
Danaher Inc
alt rtm crispr guide rnas Alt Rtm Crispr Guide Rnas, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide/bio_rxiv__2020__10__05__317925-593-11-16?v=Danaher+Inc Average 92 stars, based on 1 article reviews
alt rtm crispr guide rnas - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
92
|
OriGene
pcas guide crispra Pcas Guide Crispra, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide/pmc11338903-54-38-46?v=OriGene Average 92 stars, based on 1 article reviews
pcas guide crispra - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
93
|
Olympus
illuminator Illuminator, supplied by Olympus, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide/bio_rxiv__2021__05__05__442865-121-17-19?v=Olympus Average 93 stars, based on 1 article reviews
illuminator - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
94
|
Addgene inc
lenti multi guide plasmid Lenti Multi Guide Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide/pm33232305-230-9-16?v=Addgene+inc Average 94 stars, based on 1 article reviews
lenti multi guide plasmid - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Frontiers in Plant Science
Article Title: CRISPR-Cas9: Tool for Qualitative and Quantitative Plant Genome Editing
doi: 10.3389/fpls.2016.01740
Figure Lengend Snippet: Specific commercial products and services available to the researchers to implement CRISPR technology.
Article Snippet:
Techniques: CRISPR, Genome Wide, Clone Assay, Cloning, Stable Transfection, Selection, Transfection, Plasmid Preparation, Mutagenesis, Expressing, Negative Control, Positive Control, Construct, Knock-In, Multiplex Assay, Amplification, Sequencing