grna sequences Search Results


90
GenScript corporation grna (5’-caggguucuggauaucugu-3)
Grna (5’ Caggguucuggauaucugu 3), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna (5’-caggguucuggauaucugu-3)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
grna (5’-caggguucuggauaucugu-3) - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Bioscientifica Ltd guide rna (grna) dna target sequence
Guide Rna (Grna) Dna Target Sequence, supplied by Bioscientifica Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rna (grna) dna target sequence/product/Bioscientifica Ltd
Average 90 stars, based on 1 article reviews
guide rna (grna) dna target sequence - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Broad Institute Inc grna sequences
Grna Sequences, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna sequences/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
grna sequences - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Eton Bioscience grna sequences
Grna Sequences, supplied by Eton Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna sequences/product/Eton Bioscience
Average 90 stars, based on 1 article reviews
grna sequences - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GenScript corporation grna sequences for eomes knockdown
a Schematic representation of the experimental plan to characterise the functional relevance of MEK1/2, JNK and p38 pathways in endoderm differentiation. hPSCs were grown for 3 days in culture conditions inducing endoderm differentiation in the presence of small-molecule inhibitors. b QPCR, c FACS and d immunostaining were performed after 3 days for pluripotency markers (POU5F1/OCT4, NANOG and SOX2), mesendoderm/mesoderm markers (BRACHYURY/T, NKX2.5, CDX2 and MIXL1) and endoderm markers (SOX17, <t>EOMES,</t> GATA4 and FOXA2). For QPCR, the boxes show the interquartile range, with the median marked as a heavy horizontal band. Whiskers represent the highest (lowest) datapoint within 1.5 times the interquartile range of the 75th (25th) percentile. The diamonds represent each datapoint. For FACS, one-way ANOVA was performed, followed by Dunnett’s multiple comparisons test where each of the three treatment conditions was compared against the control in n = 5 experiments. The statistical significance for FACS marks adjusted P values: ** (0.0096), **** (<0.0001). For immunostaining, the scale bar represents 200 µm. Experiments represent three replicates. Statistical analysis was performed by two-way ANOVA with multiple comparisons and **** marks adjusted P value <0.0001. e Consensus binding motifs for AP-1 transcription factors (JUN and FOSL2), SMAD2/3 and SMAD4 were obtained from ATAC-seq analyses at 36 h time point with corresponding P values. f The switching of transcription factor complexes during hPSC differentiation to definitive endoderm. SMAD2/3 was immunoprecipitated from nuclear extracts of undifferentiated hPSCs, at 36 and at 72 h after initiating endoderm differentiation and analysed for the co-immunoprecipitation of NANOG, EOMES, GATA4, FOSL2 and JUN. g Schematic representation of the experimental outline for analysing the impact of p38-MAPK and TGFβ/Activin A signalling on SMAD2/3 and FOSL2/JUN binding and H3K27ac enrichment on mesendoderm at 24 h, and endoderm or mesoderm loci at 36 h by ChIP-qPCR. Cells were treated with p38-MAPK and TGFβ/Activin A inhibitors for 12 h in the presence of differentiation signals before sample collection. h FOSL2/JUN and SMAD2/3 cooperative binding to MIXL1 and EOMES regulatory regions at mesendoderm differentiation stage during hPSC differentiation. Early G1 phase synchronised cells were differentiated to endoderm for 12 h to receive the pluripotency exit signalling, and then treated with p38-MAPK inhibitor SB203580 or TGFβ/Activin signalling inhibitor SB431542 for 12 h, followed by cell fixation for ChIP-qPCR (before first cell division). Analyses reveal that p38-MAPK and TGFβ/Activin signalling regulate the cooperative binding of AP-1 TFs FOSL2/JUN and SMAD2/3 to mesendoderm genes at 24 h time point; n = 3 biologically independent experiments. i FOSL2/JUN and SMAD2/3 cooperative binding to CER1 , FOXA2 , LZTS1 , GATA4 and GSC regulatory regions at endoderm differentiation stage during hPSC differentiation. Early G1 phase synchronised cells were differentiated to endoderm for 24 h, and then treated with p38-MAPK inhibitor SB203580 or TGFβ/Activin signalling inhibitor for 12 h, followed by cell fixation for ChIP-qPCR (before second cell division). p38-MAPK and TGFβ/Activin signalling regulate the cooperative binding of AP-1 TFs FOSL2/JUN and SMAD2/3 to definitive endoderm genes at 36 h time point. n = 3 biologically independent experiments. j – m Activation of p38-MAPK signalling improves definitive endoderm and pancreatic differentiation. Cells were treated with 200 mM Sorbitol during 24 to 72 h of endoderm differentiation and analysed by j qPCR of FOXA2 and GSC expression at day 3, k , l FACS of PDX1, SOX9 and CD142 co-expression at day 12, m qPCR of NGN3 , SST , GSG and Insulin expression at day 18 of pancreatic differentiation. Experiments represent three replicates. n Activation of p38-MAPK signalling by Sorbitol improves definitive endoderm differentiation and the formation of endoderm-derived pancreatic cell types. Schematic representation <t>of</t> <t>hESC</t> and hiPSC differentiation to definitive endoderm, pancreatic progenitors and pancreatic islets of the Langerhans that contain ɑ, β, δ and F cells expressing their corresponding secreted factors such as insulin by β cells. Activation of p38-MAPK by Sorbitol improved definitive endoderm differentiation and the formation of subsequent pancreatic cells. Adapted from 'Pancreatic Islet of Langerhans', by BioRender.com (2023). Retrieved from https://app.biorender.com/biorender-templates . Statistical analyses in ( h , i , j , m ) were performed by two-way ANOVA with Tukey’s multiple comparisons tests and * marks adjusted P value <0.05 and ** marks adjusted P value <0.01, *** marks adjusted P value <0.001, **** marks adjusted P value <0.0001. Data were presented as mean values ± SD. Source data are provided as a Source Data file.
Grna Sequences For Eomes Knockdown, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna sequences for eomes knockdown/product/GenScript corporation
Average 90 stars, based on 1 article reviews
grna sequences for eomes knockdown - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GenScript corporation snx2 crispr grna plasmid (grna targeting sequence: 5′-tgatggcatgaatgcctata-3′)
Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of <t>CRISPR/Cas9-mediated</t> Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.
Snx2 Crispr Grna Plasmid (Grna Targeting Sequence: 5′ Tgatggcatgaatgcctata 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/snx2 crispr grna plasmid (grna targeting sequence: 5′-tgatggcatgaatgcctata-3′)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
snx2 crispr grna plasmid (grna targeting sequence: 5′-tgatggcatgaatgcctata-3′) - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GenScript corporation grna sequence of anxa5
Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of <t>CRISPR/Cas9-mediated</t> Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.
Grna Sequence Of Anxa5, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna sequence of anxa5/product/GenScript corporation
Average 90 stars, based on 1 article reviews
grna sequence of anxa5 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Transomic Technologies Inc grna sequences
Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of <t>CRISPR/Cas9-mediated</t> Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.
Grna Sequences, supplied by Transomic Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna sequences/product/Transomic Technologies Inc
Average 90 stars, based on 1 article reviews
grna sequences - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GenScript corporation sequence- based reagent grna- ex2 for ha- tag
Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of <t>CRISPR/Cas9-mediated</t> Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.
Sequence Based Reagent Grna Ex2 For Ha Tag, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence- based reagent grna- ex2 for ha- tag/product/GenScript corporation
Average 90 stars, based on 1 article reviews
sequence- based reagent grna- ex2 for ha- tag - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH spcas9:sgrna dual plasmid vectors
Restriction digest to linearize the <t> SpCas9:sgRNA dual plasmid </t> backbone
Spcas9:Sgrna Dual Plasmid Vectors, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/spcas9:sgrna dual plasmid vectors/product/VectorBuilder GmbH
Average 90 stars, based on 1 article reviews
spcas9:sgrna dual plasmid vectors - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Synthego Inc grna sequence ucuucccuaggaaugaugac
Restriction digest to linearize the <t> SpCas9:sgRNA dual plasmid </t> backbone
Grna Sequence Ucuucccuaggaaugaugac, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna sequence ucuucccuaggaaugaugac/product/Synthego Inc
Average 90 stars, based on 1 article reviews
grna sequence ucuucccuaggaaugaugac - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Synthego Inc grna targeting sequence cctgtcctcaggacaaacgc
Restriction digest to linearize the <t> SpCas9:sgRNA dual plasmid </t> backbone
Grna Targeting Sequence Cctgtcctcaggacaaacgc, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna targeting sequence cctgtcctcaggacaaacgc/product/Synthego Inc
Average 90 stars, based on 1 article reviews
grna targeting sequence cctgtcctcaggacaaacgc - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


a Schematic representation of the experimental plan to characterise the functional relevance of MEK1/2, JNK and p38 pathways in endoderm differentiation. hPSCs were grown for 3 days in culture conditions inducing endoderm differentiation in the presence of small-molecule inhibitors. b QPCR, c FACS and d immunostaining were performed after 3 days for pluripotency markers (POU5F1/OCT4, NANOG and SOX2), mesendoderm/mesoderm markers (BRACHYURY/T, NKX2.5, CDX2 and MIXL1) and endoderm markers (SOX17, EOMES, GATA4 and FOXA2). For QPCR, the boxes show the interquartile range, with the median marked as a heavy horizontal band. Whiskers represent the highest (lowest) datapoint within 1.5 times the interquartile range of the 75th (25th) percentile. The diamonds represent each datapoint. For FACS, one-way ANOVA was performed, followed by Dunnett’s multiple comparisons test where each of the three treatment conditions was compared against the control in n = 5 experiments. The statistical significance for FACS marks adjusted P values: ** (0.0096), **** (<0.0001). For immunostaining, the scale bar represents 200 µm. Experiments represent three replicates. Statistical analysis was performed by two-way ANOVA with multiple comparisons and **** marks adjusted P value <0.0001. e Consensus binding motifs for AP-1 transcription factors (JUN and FOSL2), SMAD2/3 and SMAD4 were obtained from ATAC-seq analyses at 36 h time point with corresponding P values. f The switching of transcription factor complexes during hPSC differentiation to definitive endoderm. SMAD2/3 was immunoprecipitated from nuclear extracts of undifferentiated hPSCs, at 36 and at 72 h after initiating endoderm differentiation and analysed for the co-immunoprecipitation of NANOG, EOMES, GATA4, FOSL2 and JUN. g Schematic representation of the experimental outline for analysing the impact of p38-MAPK and TGFβ/Activin A signalling on SMAD2/3 and FOSL2/JUN binding and H3K27ac enrichment on mesendoderm at 24 h, and endoderm or mesoderm loci at 36 h by ChIP-qPCR. Cells were treated with p38-MAPK and TGFβ/Activin A inhibitors for 12 h in the presence of differentiation signals before sample collection. h FOSL2/JUN and SMAD2/3 cooperative binding to MIXL1 and EOMES regulatory regions at mesendoderm differentiation stage during hPSC differentiation. Early G1 phase synchronised cells were differentiated to endoderm for 12 h to receive the pluripotency exit signalling, and then treated with p38-MAPK inhibitor SB203580 or TGFβ/Activin signalling inhibitor SB431542 for 12 h, followed by cell fixation for ChIP-qPCR (before first cell division). Analyses reveal that p38-MAPK and TGFβ/Activin signalling regulate the cooperative binding of AP-1 TFs FOSL2/JUN and SMAD2/3 to mesendoderm genes at 24 h time point; n = 3 biologically independent experiments. i FOSL2/JUN and SMAD2/3 cooperative binding to CER1 , FOXA2 , LZTS1 , GATA4 and GSC regulatory regions at endoderm differentiation stage during hPSC differentiation. Early G1 phase synchronised cells were differentiated to endoderm for 24 h, and then treated with p38-MAPK inhibitor SB203580 or TGFβ/Activin signalling inhibitor for 12 h, followed by cell fixation for ChIP-qPCR (before second cell division). p38-MAPK and TGFβ/Activin signalling regulate the cooperative binding of AP-1 TFs FOSL2/JUN and SMAD2/3 to definitive endoderm genes at 36 h time point. n = 3 biologically independent experiments. j – m Activation of p38-MAPK signalling improves definitive endoderm and pancreatic differentiation. Cells were treated with 200 mM Sorbitol during 24 to 72 h of endoderm differentiation and analysed by j qPCR of FOXA2 and GSC expression at day 3, k , l FACS of PDX1, SOX9 and CD142 co-expression at day 12, m qPCR of NGN3 , SST , GSG and Insulin expression at day 18 of pancreatic differentiation. Experiments represent three replicates. n Activation of p38-MAPK signalling by Sorbitol improves definitive endoderm differentiation and the formation of endoderm-derived pancreatic cell types. Schematic representation of hESC and hiPSC differentiation to definitive endoderm, pancreatic progenitors and pancreatic islets of the Langerhans that contain ɑ, β, δ and F cells expressing their corresponding secreted factors such as insulin by β cells. Activation of p38-MAPK by Sorbitol improved definitive endoderm differentiation and the formation of subsequent pancreatic cells. Adapted from 'Pancreatic Islet of Langerhans', by BioRender.com (2023). Retrieved from https://app.biorender.com/biorender-templates . Statistical analyses in ( h , i , j , m ) were performed by two-way ANOVA with Tukey’s multiple comparisons tests and * marks adjusted P value <0.05 and ** marks adjusted P value <0.01, *** marks adjusted P value <0.001, **** marks adjusted P value <0.0001. Data were presented as mean values ± SD. Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Epigenetic and transcriptional regulations prime cell fate before division during human pluripotent stem cell differentiation

doi: 10.1038/s41467-023-36116-9

Figure Lengend Snippet: a Schematic representation of the experimental plan to characterise the functional relevance of MEK1/2, JNK and p38 pathways in endoderm differentiation. hPSCs were grown for 3 days in culture conditions inducing endoderm differentiation in the presence of small-molecule inhibitors. b QPCR, c FACS and d immunostaining were performed after 3 days for pluripotency markers (POU5F1/OCT4, NANOG and SOX2), mesendoderm/mesoderm markers (BRACHYURY/T, NKX2.5, CDX2 and MIXL1) and endoderm markers (SOX17, EOMES, GATA4 and FOXA2). For QPCR, the boxes show the interquartile range, with the median marked as a heavy horizontal band. Whiskers represent the highest (lowest) datapoint within 1.5 times the interquartile range of the 75th (25th) percentile. The diamonds represent each datapoint. For FACS, one-way ANOVA was performed, followed by Dunnett’s multiple comparisons test where each of the three treatment conditions was compared against the control in n = 5 experiments. The statistical significance for FACS marks adjusted P values: ** (0.0096), **** (<0.0001). For immunostaining, the scale bar represents 200 µm. Experiments represent three replicates. Statistical analysis was performed by two-way ANOVA with multiple comparisons and **** marks adjusted P value <0.0001. e Consensus binding motifs for AP-1 transcription factors (JUN and FOSL2), SMAD2/3 and SMAD4 were obtained from ATAC-seq analyses at 36 h time point with corresponding P values. f The switching of transcription factor complexes during hPSC differentiation to definitive endoderm. SMAD2/3 was immunoprecipitated from nuclear extracts of undifferentiated hPSCs, at 36 and at 72 h after initiating endoderm differentiation and analysed for the co-immunoprecipitation of NANOG, EOMES, GATA4, FOSL2 and JUN. g Schematic representation of the experimental outline for analysing the impact of p38-MAPK and TGFβ/Activin A signalling on SMAD2/3 and FOSL2/JUN binding and H3K27ac enrichment on mesendoderm at 24 h, and endoderm or mesoderm loci at 36 h by ChIP-qPCR. Cells were treated with p38-MAPK and TGFβ/Activin A inhibitors for 12 h in the presence of differentiation signals before sample collection. h FOSL2/JUN and SMAD2/3 cooperative binding to MIXL1 and EOMES regulatory regions at mesendoderm differentiation stage during hPSC differentiation. Early G1 phase synchronised cells were differentiated to endoderm for 12 h to receive the pluripotency exit signalling, and then treated with p38-MAPK inhibitor SB203580 or TGFβ/Activin signalling inhibitor SB431542 for 12 h, followed by cell fixation for ChIP-qPCR (before first cell division). Analyses reveal that p38-MAPK and TGFβ/Activin signalling regulate the cooperative binding of AP-1 TFs FOSL2/JUN and SMAD2/3 to mesendoderm genes at 24 h time point; n = 3 biologically independent experiments. i FOSL2/JUN and SMAD2/3 cooperative binding to CER1 , FOXA2 , LZTS1 , GATA4 and GSC regulatory regions at endoderm differentiation stage during hPSC differentiation. Early G1 phase synchronised cells were differentiated to endoderm for 24 h, and then treated with p38-MAPK inhibitor SB203580 or TGFβ/Activin signalling inhibitor for 12 h, followed by cell fixation for ChIP-qPCR (before second cell division). p38-MAPK and TGFβ/Activin signalling regulate the cooperative binding of AP-1 TFs FOSL2/JUN and SMAD2/3 to definitive endoderm genes at 36 h time point. n = 3 biologically independent experiments. j – m Activation of p38-MAPK signalling improves definitive endoderm and pancreatic differentiation. Cells were treated with 200 mM Sorbitol during 24 to 72 h of endoderm differentiation and analysed by j qPCR of FOXA2 and GSC expression at day 3, k , l FACS of PDX1, SOX9 and CD142 co-expression at day 12, m qPCR of NGN3 , SST , GSG and Insulin expression at day 18 of pancreatic differentiation. Experiments represent three replicates. n Activation of p38-MAPK signalling by Sorbitol improves definitive endoderm differentiation and the formation of endoderm-derived pancreatic cell types. Schematic representation of hESC and hiPSC differentiation to definitive endoderm, pancreatic progenitors and pancreatic islets of the Langerhans that contain ɑ, β, δ and F cells expressing their corresponding secreted factors such as insulin by β cells. Activation of p38-MAPK by Sorbitol improved definitive endoderm differentiation and the formation of subsequent pancreatic cells. Adapted from 'Pancreatic Islet of Langerhans', by BioRender.com (2023). Retrieved from https://app.biorender.com/biorender-templates . Statistical analyses in ( h , i , j , m ) were performed by two-way ANOVA with Tukey’s multiple comparisons tests and * marks adjusted P value <0.05 and ** marks adjusted P value <0.01, *** marks adjusted P value <0.001, **** marks adjusted P value <0.0001. Data were presented as mean values ± SD. Source data are provided as a Source Data file.

Article Snippet: Inducible knockdown of EOMES was performed by using a dox-inducible CRISPR interference (CRISPRi) knock-in construct that was first targeted to the AAVS1 locus to create a stable hESC line as described in ref. . gRNA sequences for EOMES knockdown were obtained from the GenScript gRNA database and cloned into the gRNA construct according to the protocol from ref. . 2 mM Doxycyclin (Dox) was used for dCas9-KRAB mediated inducible knockdown of EOMES during endoderm differentiation.

Techniques: Functional Assay, Immunostaining, Control, Binding Assay, Immunoprecipitation, ChIP-qPCR, Activation Assay, Expressing, Derivative Assay

Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of CRISPR/Cas9-mediated Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.

Journal: The Journal of Cell Biology

Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

doi: 10.1083/jcb.201806153

Figure Lengend Snippet: Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of CRISPR/Cas9-mediated Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.

Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

Techniques: CRISPR, SDS Page, Two Tailed Test, Fluorescence, Western Blot, Expressing

SNX3 is required for the retrograde transport of CI-M6PR GCC88-tethered ETCs. (A) Equal amounts of cell lysates from HeLa, SNX1/2 dKO, SNX3 KO, and SNX27 KO cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, SNX1, SNX2, SNX5, SNX6, SNX27, SNX3, and tubulin. (B and C) HeLa, SNX3 KO, SNX1/2 dKO, and SNX27 cells were transiently transfected with HA-tagged mitochondria-targeting golgin constructs GCC88-MAO, Golgin-97-MAO, Golgin-245-MAO, or GM130-MAO; fixed; and coimmunolabeled with antibodies against HA and endogenous CI-M6PR (B) or CD-M6PR (C), followed by Alexa Fluor–conjugated secondary antibodies. The intensity plots of the fluorescent intensity (y-axis) against distance (x-axis) represent the overlap between channels. The colocalization of CI-M6PR (B) or CD-M6PR (C) with HA-tagged golgin-mito proteins was quantified by Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). **, P < 0.01; ****, P < 0.0001.

Journal: The Journal of Cell Biology

Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

doi: 10.1083/jcb.201806153

Figure Lengend Snippet: SNX3 is required for the retrograde transport of CI-M6PR GCC88-tethered ETCs. (A) Equal amounts of cell lysates from HeLa, SNX1/2 dKO, SNX3 KO, and SNX27 KO cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, SNX1, SNX2, SNX5, SNX6, SNX27, SNX3, and tubulin. (B and C) HeLa, SNX3 KO, SNX1/2 dKO, and SNX27 cells were transiently transfected with HA-tagged mitochondria-targeting golgin constructs GCC88-MAO, Golgin-97-MAO, Golgin-245-MAO, or GM130-MAO; fixed; and coimmunolabeled with antibodies against HA and endogenous CI-M6PR (B) or CD-M6PR (C), followed by Alexa Fluor–conjugated secondary antibodies. The intensity plots of the fluorescent intensity (y-axis) against distance (x-axis) represent the overlap between channels. The colocalization of CI-M6PR (B) or CD-M6PR (C) with HA-tagged golgin-mito proteins was quantified by Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). **, P < 0.01; ****, P < 0.0001.

Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

Techniques: SDS Page, Transfection, Construct, Two Tailed Test

Restriction digest to linearize the  SpCas9:sgRNA dual plasmid  backbone

Journal: STAR Protocols

Article Title: Fluorescent tagging of endogenous proteins with CRISPR/Cas9 in primary mouse neural stem cells

doi: 10.1016/j.xpro.2021.100744

Figure Lengend Snippet: Restriction digest to linearize the SpCas9:sgRNA dual plasmid backbone

Article Snippet: Use a commercial manufacturer to generate the SpCas9:sgRNA dual plasmid Vectors for expressing sgRNAs and SpCas9 can be commercially generated. (e.g., https://en.vectorbuilder.com/resources/vector-system/pRP_gRNA_parent.html )

Techniques: Plasmid Preparation