glyceraldehyde 3 phosphate dehydrogenase gapdh Abcam Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Millipore glyceraldehyde 3 phosphate dehydrogenase
    Glyceraldehyde 3 Phosphate Dehydrogenase, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 1570 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase/product/Millipore
    Average 95 stars, based on 1570 article reviews
    Price from $9.99 to $1999.99
    glyceraldehyde 3 phosphate dehydrogenase - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    99
    Abcam glyceraldehyde 3 phosphate dehydrogenase gapdh
    Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 1070 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase gapdh/product/Abcam
    Average 99 stars, based on 1070 article reviews
    Price from $9.99 to $1999.99
    glyceraldehyde 3 phosphate dehydrogenase gapdh - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    81
    Abcam protein glyceraldehyde 3 phosphate dehydrogenase gapdh
    Protein Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh, supplied by Abcam, used in various techniques. Bioz Stars score: 81/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/protein glyceraldehyde 3 phosphate dehydrogenase gapdh/product/Abcam
    Average 81 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    protein glyceraldehyde 3 phosphate dehydrogenase gapdh - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    99
    Abcam anti glyceraldehyde 3 phosphate dehydrogenase gapdh
    Western blot analysis of FOXM1 protein expression in noncancerous and tumor tissues. ( a ) Bands of FOXM1 and glyceraldehyde 3‐phosphate dehydrogenase <t>(GAPDH)</t> and ( b ) quantitative analysis of FOXM1/GAPDH in noncancerous and tumor tissues.
    Anti Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 308 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti glyceraldehyde 3 phosphate dehydrogenase gapdh/product/Abcam
    Average 99 stars, based on 308 article reviews
    Price from $9.99 to $1999.99
    anti glyceraldehyde 3 phosphate dehydrogenase gapdh - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    92
    Santa Cruz Biotechnology gapdh glyceraldehyde 3 phosphate dehydrogenase antibody
    Western blot analysis of FOXM1 protein expression in noncancerous and tumor tissues. ( a ) Bands of FOXM1 and glyceraldehyde 3‐phosphate dehydrogenase <t>(GAPDH)</t> and ( b ) quantitative analysis of FOXM1/GAPDH in noncancerous and tumor tissues.
    Gapdh Glyceraldehyde 3 Phosphate Dehydrogenase Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gapdh glyceraldehyde 3 phosphate dehydrogenase antibody/product/Santa Cruz Biotechnology
    Average 92 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    gapdh glyceraldehyde 3 phosphate dehydrogenase antibody - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    90
    Abcam glyceraldehyde 3 phosphate dehydrogenase
    Alterations of calpains activity in the ALIM supernates with the calpain inhibitor (calpeptin). A. Calpain activity in the ALIM supernate maintained on a high level. B. The effect of different doses of calpeptin on calpains activity. C. Expressions of IL-6, IL-8 and TNF-α in ALIM were significantly reduced by calpeptin. D. The expression of PCNA protein was lower when the calpeptin was added. RFU, relative fluorescence units; NC, negative control; PCNA, proliferating cell nuclear antigen; GAPDH, <t>glyceraldehyde-3-phosphate</t> dehydrogenase; IL, interleukin; TNF, tumor necrosis factor; ALIM, acute lung infection model. *, P
    Glyceraldehyde 3 Phosphate Dehydrogenase, supplied by Abcam, used in various techniques. Bioz Stars score: 90/100, based on 1147 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase/product/Abcam
    Average 90 stars, based on 1147 article reviews
    Price from $9.99 to $1999.99
    glyceraldehyde 3 phosphate dehydrogenase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Abcam glyceraldehyde 3 phosphate dehydrogenase gapdh monoclonal antibody
    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; <t>GAPDH,</t> glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.
    Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh Monoclonal Antibody, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase gapdh monoclonal antibody/product/Abcam
    Average 99 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    glyceraldehyde 3 phosphate dehydrogenase gapdh monoclonal antibody - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    82
    Abcam glyceraldehyde 3 phosphate dehydrogenase gapdh 1 600 000
    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; <t>GAPDH,</t> glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.
    Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh 1 600 000, supplied by Abcam, used in various techniques. Bioz Stars score: 82/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase gapdh 1 600 000/product/Abcam
    Average 82 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    glyceraldehyde 3 phosphate dehydrogenase gapdh 1 600 000 - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    86
    Abcam anti glyceraldehyde 3 phosphate dehydrogenase gapdh primary antibody
    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; <t>GAPDH,</t> glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.
    Anti Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh Primary Antibody, supplied by Abcam, used in various techniques. Bioz Stars score: 86/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti glyceraldehyde 3 phosphate dehydrogenase gapdh primary antibody/product/Abcam
    Average 86 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    anti glyceraldehyde 3 phosphate dehydrogenase gapdh primary antibody - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    86
    Abcam glyceraldehyde 3 phosphate dehydrogenase gapdh rabbit polyclonal antibody
    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; <t>GAPDH,</t> glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.
    Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh Rabbit Polyclonal Antibody, supplied by Abcam, used in various techniques. Bioz Stars score: 86/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase gapdh rabbit polyclonal antibody/product/Abcam
    Average 86 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    glyceraldehyde 3 phosphate dehydrogenase gapdh rabbit polyclonal antibody - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    77
    Abcam mouse mab against glyceraldehyde 3 phosphate dehydrogenase gapdh
    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; <t>GAPDH,</t> glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.
    Mouse Mab Against Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh, supplied by Abcam, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse mab against glyceraldehyde 3 phosphate dehydrogenase gapdh/product/Abcam
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    mouse mab against glyceraldehyde 3 phosphate dehydrogenase gapdh - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    75
    Abcam anti glyceraldehyde 3 phosphate dehydrogenase anti gapdh igg
    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; <t>GAPDH,</t> glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.
    Anti Glyceraldehyde 3 Phosphate Dehydrogenase Anti Gapdh Igg, supplied by Abcam, used in various techniques. Bioz Stars score: 75/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti glyceraldehyde 3 phosphate dehydrogenase anti gapdh igg/product/Abcam
    Average 75 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    anti glyceraldehyde 3 phosphate dehydrogenase anti gapdh igg - by Bioz Stars, 2020-02
    75/100 stars
      Buy from Supplier

    90
    Abcam anti gapdh antibody epr16884
    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; <t>GAPDH,</t> glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.
    Anti Gapdh Antibody Epr16884, supplied by Abcam, used in various techniques. Bioz Stars score: 90/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti gapdh antibody epr16884/product/Abcam
    Average 90 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    anti gapdh antibody epr16884 - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Abcam rat glyceraldehyde 3 phosphate dehydrogenase gapdh
    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; <t>GAPDH,</t> glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.
    Rat Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh, supplied by Abcam, used in various techniques. Bioz Stars score: 90/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rat glyceraldehyde 3 phosphate dehydrogenase gapdh/product/Abcam
    Average 90 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    rat glyceraldehyde 3 phosphate dehydrogenase gapdh - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Abcam control glyceraldehyde 3 phosphate dehydrogenase
    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; <t>GAPDH,</t> glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.
    Control Glyceraldehyde 3 Phosphate Dehydrogenase, supplied by Abcam, used in various techniques. Bioz Stars score: 90/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control glyceraldehyde 3 phosphate dehydrogenase/product/Abcam
    Average 90 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    control glyceraldehyde 3 phosphate dehydrogenase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    76
    Abcam rabbit polyclonal igg against glyceraldehyde 3 phosphate dehydrogenase gapdh
    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; <t>GAPDH,</t> glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.
    Rabbit Polyclonal Igg Against Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh, supplied by Abcam, used in various techniques. Bioz Stars score: 76/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit polyclonal igg against glyceraldehyde 3 phosphate dehydrogenase gapdh/product/Abcam
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rabbit polyclonal igg against glyceraldehyde 3 phosphate dehydrogenase gapdh - by Bioz Stars, 2020-02
    76/100 stars
      Buy from Supplier

    77
    Abcam gapdh glyceraldehyde 3 phosphate dehydrogenase expression
    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; <t>GAPDH,</t> glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.
    Gapdh Glyceraldehyde 3 Phosphate Dehydrogenase Expression, supplied by Abcam, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gapdh glyceraldehyde 3 phosphate dehydrogenase expression/product/Abcam
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    gapdh glyceraldehyde 3 phosphate dehydrogenase expression - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    79
    Abcam glyceraldehyde 3 phosphate dehydrogenase gapdh recombinant proteins
    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; <t>GAPDH,</t> glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.
    Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh Recombinant Proteins, supplied by Abcam, used in various techniques. Bioz Stars score: 79/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase gapdh recombinant proteins/product/Abcam
    Average 79 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    glyceraldehyde 3 phosphate dehydrogenase gapdh recombinant proteins - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    88
    Abcam mouse anti human glyceraldehyde 3 phosphate dehydrogenase gapdh antibody
    Western blot analysis of proteins involved in intracellular pathway initiated by D6 engagement by active ligands and leading to cofilin-inactivation and actin filaments depolymerization. Phosphorylated (p)-LIMK1 (A) and p-Cofilin (B) were increased in trophoblast cell lysates from PE patients compared to controls. <t>GAPDH:</t> <t>glyceraldehyde-3-phosphate</t> dehydrogenase (loading control). Results are expressed as mean ± SE of six experiments. *p
    Mouse Anti Human Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh Antibody, supplied by Abcam, used in various techniques. Bioz Stars score: 88/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse anti human glyceraldehyde 3 phosphate dehydrogenase gapdh antibody/product/Abcam
    Average 88 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    mouse anti human glyceraldehyde 3 phosphate dehydrogenase gapdh antibody - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    83
    Abcam rabbit monoclonal anti glyceraldehyde 3 phosphate dehydrogenase anti gapdh
    Western blot analysis of proteins involved in intracellular pathway initiated by D6 engagement by active ligands and leading to cofilin-inactivation and actin filaments depolymerization. Phosphorylated (p)-LIMK1 (A) and p-Cofilin (B) were increased in trophoblast cell lysates from PE patients compared to controls. <t>GAPDH:</t> <t>glyceraldehyde-3-phosphate</t> dehydrogenase (loading control). Results are expressed as mean ± SE of six experiments. *p
    Rabbit Monoclonal Anti Glyceraldehyde 3 Phosphate Dehydrogenase Anti Gapdh, supplied by Abcam, used in various techniques. Bioz Stars score: 83/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit monoclonal anti glyceraldehyde 3 phosphate dehydrogenase anti gapdh/product/Abcam
    Average 83 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    rabbit monoclonal anti glyceraldehyde 3 phosphate dehydrogenase anti gapdh - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    94
    Abcam mouse anti glyceraldehyde 3 phosphate dehydrogenase gapdh gapdh loading control antibody
    Effect of acute and chronic 2-(2-(5-methoxy-1 H -indol-3-yl)ethyl)-5-methyl-1,3,4-oxadiazole (IQM316) or melatonin administration on hippocampal oxidative phosphorylation (OXPHOS) protein levels. Animals were treated with vehicle (Vhc), IQM316 (IQM), or melatonin (Mel). Quantitative analysis of the effect of acute (A) and chronic (C) administrations on hippocampal OXPHOS protein levels. Glyceraldehyde 3-phosphate dehydrogenase <t>(GAPDH)</t> was used for normalization. Representative Western blots for acute (B) and chronic (D) administrations quantified in A and C, respectively. Acute administration of either IQM316 or melatonin significantly increased subunit B of complex II and complex I subunit (COX I) protein levels but reduced COX IV and ATP-5β. Nonetheless, chronic IQM316 or melatonin administration only increased the protein levels of NDUFB8. Data are mean ± SEM, n = 8 animals per group. * P
    Mouse Anti Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh Gapdh Loading Control Antibody, supplied by Abcam, used in various techniques. Bioz Stars score: 94/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse anti glyceraldehyde 3 phosphate dehydrogenase gapdh gapdh loading control antibody/product/Abcam
    Average 94 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    mouse anti glyceraldehyde 3 phosphate dehydrogenase gapdh gapdh loading control antibody - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    79
    Abcam rabbit anti human glyceraldehyde 3 phosphate dehydrogenase gapdh antibody
    Effect of acute and chronic 2-(2-(5-methoxy-1 H -indol-3-yl)ethyl)-5-methyl-1,3,4-oxadiazole (IQM316) or melatonin administration on hippocampal oxidative phosphorylation (OXPHOS) protein levels. Animals were treated with vehicle (Vhc), IQM316 (IQM), or melatonin (Mel). Quantitative analysis of the effect of acute (A) and chronic (C) administrations on hippocampal OXPHOS protein levels. Glyceraldehyde 3-phosphate dehydrogenase <t>(GAPDH)</t> was used for normalization. Representative Western blots for acute (B) and chronic (D) administrations quantified in A and C, respectively. Acute administration of either IQM316 or melatonin significantly increased subunit B of complex II and complex I subunit (COX I) protein levels but reduced COX IV and ATP-5β. Nonetheless, chronic IQM316 or melatonin administration only increased the protein levels of NDUFB8. Data are mean ± SEM, n = 8 animals per group. * P
    Rabbit Anti Human Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh Antibody, supplied by Abcam, used in various techniques. Bioz Stars score: 79/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit anti human glyceraldehyde 3 phosphate dehydrogenase gapdh antibody/product/Abcam
    Average 79 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    rabbit anti human glyceraldehyde 3 phosphate dehydrogenase gapdh antibody - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    75
    Abcam anti glyceraldehyde 3 phosphate dehydrogenase gapdh hrp conjugated antibodies
    Effect of acute and chronic 2-(2-(5-methoxy-1 H -indol-3-yl)ethyl)-5-methyl-1,3,4-oxadiazole (IQM316) or melatonin administration on hippocampal oxidative phosphorylation (OXPHOS) protein levels. Animals were treated with vehicle (Vhc), IQM316 (IQM), or melatonin (Mel). Quantitative analysis of the effect of acute (A) and chronic (C) administrations on hippocampal OXPHOS protein levels. Glyceraldehyde 3-phosphate dehydrogenase <t>(GAPDH)</t> was used for normalization. Representative Western blots for acute (B) and chronic (D) administrations quantified in A and C, respectively. Acute administration of either IQM316 or melatonin significantly increased subunit B of complex II and complex I subunit (COX I) protein levels but reduced COX IV and ATP-5β. Nonetheless, chronic IQM316 or melatonin administration only increased the protein levels of NDUFB8. Data are mean ± SEM, n = 8 animals per group. * P
    Anti Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh Hrp Conjugated Antibodies, supplied by Abcam, used in various techniques. Bioz Stars score: 75/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti glyceraldehyde 3 phosphate dehydrogenase gapdh hrp conjugated antibodies/product/Abcam
    Average 75 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti glyceraldehyde 3 phosphate dehydrogenase gapdh hrp conjugated antibodies - by Bioz Stars, 2020-02
    75/100 stars
      Buy from Supplier

    Image Search Results


    Western blot analysis of FOXM1 protein expression in noncancerous and tumor tissues. ( a ) Bands of FOXM1 and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) and ( b ) quantitative analysis of FOXM1/GAPDH in noncancerous and tumor tissues.

    Journal: Thoracic Cancer

    Article Title: FOXM1: A potential indicator to predict lymphatic metastatic recurrence in stage IIA esophageal squamous cell carcinoma

    doi: 10.1111/1759-7714.12776

    Figure Lengend Snippet: Western blot analysis of FOXM1 protein expression in noncancerous and tumor tissues. ( a ) Bands of FOXM1 and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) and ( b ) quantitative analysis of FOXM1/GAPDH in noncancerous and tumor tissues.

    Article Snippet: Membranes were incubated overnight at 4°C with primary antibodies anti‐FOXM1 (1:500) and anti‐glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) (1: 5000; Abcam, Cambridge, MA, USA).

    Techniques: Western Blot, Expressing

    Normal expression of actin and the proteins involved in dense granule formation and secretion in platelets of Nbea +/- mice. (A) Western blot analysis detected no changes in the total actin levels in platelets of Nbea +/- mice compared to Nbea +/+ mice. Actin expression was normalized to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) content and the expression in platelets of wild-type mice was set at 100% (n = 4/genotype). (B) The total amount of Munc13-4, Rab27b and Calmodulin was unaltered in platelets of Nbea +/- mice. Protein levels were normalized to actin and the expression level in platelets of Nbea +/+ mice was set at 100% (n = 4 samples/genotype).

    Journal: Molecular Autism

    Article Title: Platelets of mice heterozygous for neurobeachin, a candidate gene for autism spectrum disorder, display protein changes related to aberrant protein kinase A activity

    doi: 10.1186/2040-2392-4-43

    Figure Lengend Snippet: Normal expression of actin and the proteins involved in dense granule formation and secretion in platelets of Nbea +/- mice. (A) Western blot analysis detected no changes in the total actin levels in platelets of Nbea +/- mice compared to Nbea +/+ mice. Actin expression was normalized to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) content and the expression in platelets of wild-type mice was set at 100% (n = 4/genotype). (B) The total amount of Munc13-4, Rab27b and Calmodulin was unaltered in platelets of Nbea +/- mice. Protein levels were normalized to actin and the expression level in platelets of Nbea +/+ mice was set at 100% (n = 4 samples/genotype).

    Article Snippet: Equal amounts of actin protein expression were verified after incubation with an anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (Abcam, Cambridge, UK; 1/15,000).

    Techniques: Expressing, Mouse Assay, Western Blot

    HSP 47 is present on the surface of platelet progenitor primary megakaryocytes and platelets. The presence of HSP 47 on the surface of primary megakaryocytes isolated from mouse bone marrow was demonstrated using epi‐fluorescence microscopy under non‐permeabilizing conditions using rabbit monoclonal anti‐ HSP 47 antibody. (A) Representative images for HSP 47 (green), GPI b (red) and DAPI (blue). (B) The presence of HSP 47 at the human platelet surface was evaluated by means of a biotin‐based labelling approach. Resting (Tyrodes‐ HEPES buffer treated) and stimulated (2 μg mL −1 CRP ‐ XL ) platelet cell‐surface proteins (from 1 × 10 9 cells) were biotinylated using EZ link sulfo LC ‐ NHS biotin and purified from platelet lysates by NeutrAvidin affinity chromatography. (Bi) Biotinylated platelet surface proteins were probed using anti‐ HSP 47 antibody. (Bii) Immunoblots were re‐probed with streptavidin‐ HRP conjugate to reveal total biotinylation. (Biii) Immunoblots were also re‐probed for glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH), a cytosolic protein. Data is representative of three separate experiments. [Color figure can be viewed at wileyonlinelibrary.com ]

    Journal: Journal of Thrombosis and Haemostasis

    Article Title: The chaperone protein HSP47: a platelet collagen binding protein that contributes to thrombosis and hemostasis. The chaperone protein HSP47: a platelet collagen binding protein that contributes to thrombosis and hemostasis

    doi: 10.1111/jth.13998

    Figure Lengend Snippet: HSP 47 is present on the surface of platelet progenitor primary megakaryocytes and platelets. The presence of HSP 47 on the surface of primary megakaryocytes isolated from mouse bone marrow was demonstrated using epi‐fluorescence microscopy under non‐permeabilizing conditions using rabbit monoclonal anti‐ HSP 47 antibody. (A) Representative images for HSP 47 (green), GPI b (red) and DAPI (blue). (B) The presence of HSP 47 at the human platelet surface was evaluated by means of a biotin‐based labelling approach. Resting (Tyrodes‐ HEPES buffer treated) and stimulated (2 μg mL −1 CRP ‐ XL ) platelet cell‐surface proteins (from 1 × 10 9 cells) were biotinylated using EZ link sulfo LC ‐ NHS biotin and purified from platelet lysates by NeutrAvidin affinity chromatography. (Bi) Biotinylated platelet surface proteins were probed using anti‐ HSP 47 antibody. (Bii) Immunoblots were re‐probed with streptavidin‐ HRP conjugate to reveal total biotinylation. (Biii) Immunoblots were also re‐probed for glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH), a cytosolic protein. Data is representative of three separate experiments. [Color figure can be viewed at wileyonlinelibrary.com ]

    Article Snippet: The presence of HSP47 was analyzed by immunoblotting and detected with anti‐HSP47 (mouse anti‐HSP47, clone M16.10A1, Stressgen Biotechnologies, Victoria, BC, Canada; 1:500), and the immunoblots were re‐probed using streptavidin‐HRP to reveal total cell‐surface biotinylation and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) antibody (Abcam) as a negative control for cytosolic proteins.

    Techniques: Isolation, Fluorescence, Microscopy, Purification, Affinity Chromatography, Western Blot

    MSC expression and activity of antioxidants in standard culture conditions. Densitometric analysis of Western blots was used to examine protein expression in standard culture conditions (C‐MSC n = 3; MS‐MSC n = 7). (A): SOD1 expression was reduced in MS‐MSC compared to C‐MSC (regression analysis, ##, p = .002, CI −0.737 to −0.159). (B): GSTP1 expression was reduced in MS‐MSC (regression analysis, ##, p = .006, CI −1.39 to −0.23). (C): Catalase expression was unaltered. (D): Representative bands are shown. (E): SOD activity was reduced in MS‐MSC ( n = 4) compared to C‐MSC ( n = 4; regression analysis, ##, p = .003, CI −25.706 to −5.288). (F): GST activity was reduced in MS‐MSC ( n = 6) compared to C‐MSC ( n = 3; Mann Whitney test, *, p = .038; regression analysis, ##, p = .006, CI −0.854 to −0.14). The data are the means ± SEM of multiple biological replicates as listed. Abbreviations: CI, confidence interval; C‐MSC, control mesenchymal stromal cells; GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase; GSTP1, Glutathione S‐Transferase Pi 1; MS, multiple sclerosis; MSC, mesenchymal stromal cell; MS‐MSC, mesenchymal stromal cells from patients with multiple sclerosis; SOD1, superoxide dismutase 1.

    Journal: Stem Cells Translational Medicine

    Article Title: Dysregulation of Mesenchymal Stromal Cell Antioxidant Responses in Progressive Multiple Sclerosis

    doi: 10.1002/sctm.18-0045

    Figure Lengend Snippet: MSC expression and activity of antioxidants in standard culture conditions. Densitometric analysis of Western blots was used to examine protein expression in standard culture conditions (C‐MSC n = 3; MS‐MSC n = 7). (A): SOD1 expression was reduced in MS‐MSC compared to C‐MSC (regression analysis, ##, p = .002, CI −0.737 to −0.159). (B): GSTP1 expression was reduced in MS‐MSC (regression analysis, ##, p = .006, CI −1.39 to −0.23). (C): Catalase expression was unaltered. (D): Representative bands are shown. (E): SOD activity was reduced in MS‐MSC ( n = 4) compared to C‐MSC ( n = 4; regression analysis, ##, p = .003, CI −25.706 to −5.288). (F): GST activity was reduced in MS‐MSC ( n = 6) compared to C‐MSC ( n = 3; Mann Whitney test, *, p = .038; regression analysis, ##, p = .006, CI −0.854 to −0.14). The data are the means ± SEM of multiple biological replicates as listed. Abbreviations: CI, confidence interval; C‐MSC, control mesenchymal stromal cells; GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase; GSTP1, Glutathione S‐Transferase Pi 1; MS, multiple sclerosis; MSC, mesenchymal stromal cell; MS‐MSC, mesenchymal stromal cells from patients with multiple sclerosis; SOD1, superoxide dismutase 1.

    Article Snippet: Antibodies used were mouse anti‐SOD1 (1:2,000, R & D USA), mouse anti‐GSTP1 (1:2,000; Santa Cruz USA), rabbit anti‐peroxisome proliferator‐activated receptor‐gamma coactivator‐1alpha (PGC1α) (1:3,000; Santa Cruz), rabbit anti‐nuclear factor erythroid 2‐related factor 2 (Nrf2) (1:3,000; Santa Cruz), rabbit anticatalase (1:5,000; Abcam UK), mouse anti‐glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) (1:5,000; Abcam), and antiactin (1:5,000; Abcam).

    Techniques: Expressing, Activity Assay, Western Blot, Mass Spectrometry, MANN-WHITNEY

    Proteomic identification of CoAlated proteins in H 2 O 2 -treated heart and in the liver of starved rats. ( A ) LC–MS/MS spectrum of a CoAlated peptide derived from heart protein, showing an increase in 765 Da, corresponding to covalently bound CoA. The inset (a) shows the structure of CoA and indicates the neutral loss of the ATP moiety ( m / z 507 and 427), which can occur under CID (collision-induced dissociation) fragmentation of the precursor ion. The major ions identifying these neutral losses are annotated on the spectrum. ( B ) Nudix7 cleaves the diphosphate bond of CoA, generating a unique signature for MS/MS analysis. ( C and D ) Examples of the MS/MS spectra of CoA-modified peptides, corresponding to mitochondrial S-type CK 2 (CKMT2) and GAPDH. Proteins identified to be CoAlated in H 2 O 2 -treated heart ( E ) and liver mitochondria of a 24 h-starved rat ( F ) were grouped into major functional categories. See Supplementary Tables S1 and S2 for full lists of identified proteins. ( G ) Major metabolic enzymes are CoAlated in H 2 O 2 -treated heart (blue circles) and liver mitochondria of a 24 h-starved rat (red circles), ACC, acetyl CoA carboxylase; MCD, malonyl CoA decarboxylase; CPT1, carnitine palmitoyl transferase 1; CACT, carnitine/acylcarnitine carrier protein; DH, dehydrogenase; CS, citrate synthase; IDH, isocitrate dehydrogenase; OGDH, oxoglutarate dehydrogenase; SDH, succinyl-CoA dehydrogenase; MDH, malate dehydrogenase; PDK, pyruvate dehydrogenase kinase; PDH, pyruvate dehydrogenase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; SCOT, succinyl-CoA: 3-ketoacid CoA transferase; ACAT1, acetyl-CoA acetyltransferase; I-IV, electron transport chain complexes I–IV; Q, coenzyme Q; CytC; cytochrome C ; F0/F1, ATP synthase; ANT, adenine nucleotide translocase; CK, creatine kinase; BDH1, d -β-hydroxybutyrate dehydrogenase; HMGCL, hydroxymethylglutaryl-CoA lyase; HMGCS2, hydroxymethylglutaryl-CoA synthase; ALDH4A1, Δ-1-pyrroline-5-carboxylate dehydrogenase; ALDH5A1, succinate-semialdehyde dehydrogenase; ALDH6A1, methylmalonate-semialdehyde dehydrogenase [acylating]; ALDH7A1, α-aminoadipic semialdehyde dehydrogenase; Glud1, glutamate dehydrogenase 1; Got2, aspartate aminotransferase; GSTZ1, maleylacetoacetate isomerise; HIBADH, 3-hydroxyisobutyrate dehydrogenase; Kat3, kynurenine–oxoglutarate transaminase 3; PCCA, propionyl-CoA carboxylase. Larger-format versions of panels A-G are available in the Supplementary Material.

    Journal: Biochemical Journal

    Article Title: Protein CoAlation: a redox-regulated protein modification by coenzyme A in mammalian cells

    doi: 10.1042/BCJ20170129

    Figure Lengend Snippet: Proteomic identification of CoAlated proteins in H 2 O 2 -treated heart and in the liver of starved rats. ( A ) LC–MS/MS spectrum of a CoAlated peptide derived from heart protein, showing an increase in 765 Da, corresponding to covalently bound CoA. The inset (a) shows the structure of CoA and indicates the neutral loss of the ATP moiety ( m / z 507 and 427), which can occur under CID (collision-induced dissociation) fragmentation of the precursor ion. The major ions identifying these neutral losses are annotated on the spectrum. ( B ) Nudix7 cleaves the diphosphate bond of CoA, generating a unique signature for MS/MS analysis. ( C and D ) Examples of the MS/MS spectra of CoA-modified peptides, corresponding to mitochondrial S-type CK 2 (CKMT2) and GAPDH. Proteins identified to be CoAlated in H 2 O 2 -treated heart ( E ) and liver mitochondria of a 24 h-starved rat ( F ) were grouped into major functional categories. See Supplementary Tables S1 and S2 for full lists of identified proteins. ( G ) Major metabolic enzymes are CoAlated in H 2 O 2 -treated heart (blue circles) and liver mitochondria of a 24 h-starved rat (red circles), ACC, acetyl CoA carboxylase; MCD, malonyl CoA decarboxylase; CPT1, carnitine palmitoyl transferase 1; CACT, carnitine/acylcarnitine carrier protein; DH, dehydrogenase; CS, citrate synthase; IDH, isocitrate dehydrogenase; OGDH, oxoglutarate dehydrogenase; SDH, succinyl-CoA dehydrogenase; MDH, malate dehydrogenase; PDK, pyruvate dehydrogenase kinase; PDH, pyruvate dehydrogenase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; SCOT, succinyl-CoA: 3-ketoacid CoA transferase; ACAT1, acetyl-CoA acetyltransferase; I-IV, electron transport chain complexes I–IV; Q, coenzyme Q; CytC; cytochrome C ; F0/F1, ATP synthase; ANT, adenine nucleotide translocase; CK, creatine kinase; BDH1, d -β-hydroxybutyrate dehydrogenase; HMGCL, hydroxymethylglutaryl-CoA lyase; HMGCS2, hydroxymethylglutaryl-CoA synthase; ALDH4A1, Δ-1-pyrroline-5-carboxylate dehydrogenase; ALDH5A1, succinate-semialdehyde dehydrogenase; ALDH6A1, methylmalonate-semialdehyde dehydrogenase [acylating]; ALDH7A1, α-aminoadipic semialdehyde dehydrogenase; Glud1, glutamate dehydrogenase 1; Got2, aspartate aminotransferase; GSTZ1, maleylacetoacetate isomerise; HIBADH, 3-hydroxyisobutyrate dehydrogenase; Kat3, kynurenine–oxoglutarate transaminase 3; PCCA, propionyl-CoA carboxylase. Larger-format versions of panels A-G are available in the Supplementary Material.

    Article Snippet: The following antibodies and dilutions were used: mouse anti-CoA antibody (0.17 µg/ml); rabbit anti-actin antibody (Cell Signaling Technology #4968, 1:2000); rabbit anti-tubulin antibody (Cell Signaling Technology #2148, 1:2000); rabbit anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody (Abcam #ab181602, 1:6000); mouse anti-GSH antibody (Millipore #MAB5310, 1:1000) and rabbit anti-pyruvate dehydrogenase kinase 2 (PDK2) antibody (Abcam #ab68164, 0.5 µg/ml).

    Techniques: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Derivative Assay, Modification, Functional Assay

    Characterization of human mammary epithelial cells. a Schematic representation of steps for the derivation of two human mammary epithelial cell types, breast primary epithelial cells ( BPECs ) and human mammary epithelial cells ( HMECs ). b Images of BPECs and HMECs showing: I BPECs that have been grown in WIT medium and on tissue culture plates with a modified attachment surface (Primaria); II HMEC that have been grown in mammary epithelial growth medium-basal (MEpiCM) and on regular culture plates; III and IV detection of luminal-specific Claudin-4 ( green ) and myoepithelial specific CD-10 ( red ) proteins in BPECs and HMECs by immunofluorescence. c Paraffin section of a breast sample after immunofluorescent detection of Claudin-4 ( green ) and CD-10 ( red ). d Western blot for detection of Claudin-4, p16 INK4a , basal p53 and human telomerase reverse transcriptase ( hTERT ) in BPECs at an early, a mid and a late population doubling (PD) and in HMECs at pre-stasis and post-stasis; glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) was used as loading control. e Sorting of BPEC and HMEC cultures for CD-227 and CD-10. f Immunofluorescent detection of keratins 14 ( K14 ) and 19 ( K19 ) on BPEC and HMEC cultures. In the BPEC cultures, we found cells positive for K14 and positive for K19 ( i and ii ). But in the HMEC culture ( iii ), we only observed K14-positive cells. g mRNA levels of K19 in 12BPECs, 14BPECs and HMECs, as obtained by qRT-PCR. h Western blot for detection of basal p53 and the s15 phosphorylated form of p53 in irradiated and non-irradiated BPECs. DAPI 4',6-diamidino-2-phenylindole

    Journal: Breast Cancer Research : BCR

    Article Title: Breast primary epithelial cells that escape p16-dependent stasis enter a telomere-driven crisis state

    doi: 10.1186/s13058-015-0667-z

    Figure Lengend Snippet: Characterization of human mammary epithelial cells. a Schematic representation of steps for the derivation of two human mammary epithelial cell types, breast primary epithelial cells ( BPECs ) and human mammary epithelial cells ( HMECs ). b Images of BPECs and HMECs showing: I BPECs that have been grown in WIT medium and on tissue culture plates with a modified attachment surface (Primaria); II HMEC that have been grown in mammary epithelial growth medium-basal (MEpiCM) and on regular culture plates; III and IV detection of luminal-specific Claudin-4 ( green ) and myoepithelial specific CD-10 ( red ) proteins in BPECs and HMECs by immunofluorescence. c Paraffin section of a breast sample after immunofluorescent detection of Claudin-4 ( green ) and CD-10 ( red ). d Western blot for detection of Claudin-4, p16 INK4a , basal p53 and human telomerase reverse transcriptase ( hTERT ) in BPECs at an early, a mid and a late population doubling (PD) and in HMECs at pre-stasis and post-stasis; glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) was used as loading control. e Sorting of BPEC and HMEC cultures for CD-227 and CD-10. f Immunofluorescent detection of keratins 14 ( K14 ) and 19 ( K19 ) on BPEC and HMEC cultures. In the BPEC cultures, we found cells positive for K14 and positive for K19 ( i and ii ). But in the HMEC culture ( iii ), we only observed K14-positive cells. g mRNA levels of K19 in 12BPECs, 14BPECs and HMECs, as obtained by qRT-PCR. h Western blot for detection of basal p53 and the s15 phosphorylated form of p53 in irradiated and non-irradiated BPECs. DAPI 4',6-diamidino-2-phenylindole

    Article Snippet: Antibodies used were rabbit anti-Claudin-4 (1:1000, Abcam, Ref 1504), mouse anti-p16INK4a (1:1000, Neomarkers, Freemont, CA, USA), mouse anti-p53 (1:1000, Santa Cruz Biotechnologies, Heidelberg, Germany), rabbit anti-phospho S15 p53 (1:1000, Invitrogen) and mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:1000, Abcam) diluted on 1 × PBS-3 % BSA 0.1 % Tween20.

    Techniques: Modification, Immunofluorescence, Paraffin Section, Western Blot, Quantitative RT-PCR, Irradiation

    Propagation of human mammary epithelial cells. a Growth kinetics of 12-breast primary epithelial cells ( 12BPEC ) and 14BPEC (population doubling ( PD ) vs days in culture). b Frequencies of 12BPEC at PD8 and PD41 expressing senescence-associated β-galactosidase marker. c Methylation mean of the p16 INK4a gene promoter in 12BPECs at different population doublings, as obtained by pyrosequencing methylation analyses. The red horizontal line represents the frequency of p16 INK4a promoter methylation in post-M0 human mammary epithelial cells. d Expression profile of p16 and p53 in 12BPEC at pre-stasis, stasis and post-stasis population doublings. Expression was tested using qRT-PCR, and data were normalized using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA levels

    Journal: Breast Cancer Research : BCR

    Article Title: Breast primary epithelial cells that escape p16-dependent stasis enter a telomere-driven crisis state

    doi: 10.1186/s13058-015-0667-z

    Figure Lengend Snippet: Propagation of human mammary epithelial cells. a Growth kinetics of 12-breast primary epithelial cells ( 12BPEC ) and 14BPEC (population doubling ( PD ) vs days in culture). b Frequencies of 12BPEC at PD8 and PD41 expressing senescence-associated β-galactosidase marker. c Methylation mean of the p16 INK4a gene promoter in 12BPECs at different population doublings, as obtained by pyrosequencing methylation analyses. The red horizontal line represents the frequency of p16 INK4a promoter methylation in post-M0 human mammary epithelial cells. d Expression profile of p16 and p53 in 12BPEC at pre-stasis, stasis and post-stasis population doublings. Expression was tested using qRT-PCR, and data were normalized using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA levels

    Article Snippet: Antibodies used were rabbit anti-Claudin-4 (1:1000, Abcam, Ref 1504), mouse anti-p16INK4a (1:1000, Neomarkers, Freemont, CA, USA), mouse anti-p53 (1:1000, Santa Cruz Biotechnologies, Heidelberg, Germany), rabbit anti-phospho S15 p53 (1:1000, Invitrogen) and mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:1000, Abcam) diluted on 1 × PBS-3 % BSA 0.1 % Tween20.

    Techniques: Expressing, Marker, Methylation, Quantitative RT-PCR

    Identification and cloning of transcription start site in transcription factor-related Brn-3a regulator isolated from brain cDNA (Brn-3b) promoter . (a) Homology plots (VISTA Genome Browser) showing regions of similarity in Brn-3b gene and 5' upstream sequences between human (top) and dog, horse and mouse (bottom) genome sequences. Regions of homology are indicated by peaks and grey shading, and positions of Brn-3b exons and intronic sequences are shown. (b) Schematic showing cloned Bst X1 (B)/ Stu 1 (S)/ Xho 1 (X) (BSX) construct containing putative Brn-3b promoter and regulatory sequences or the BSX exon-intron-exon (BSXEIE) expression construct containing the promoter, regulatory and coding sequences, which were used for subsequent studies. Promoter and regulatory sequences are shown in grey-striped area. 5' noncoding sequences at the beginning of exon 1 are indicated by the black bar. The white stripe at the start of exon 2 represents unique sequences that are present in Brn-3b(s) transcripts, but not in Brn-3b(l) transcripts. The positions of restriction enzyme sites Bst X1 (B), Stu 1 (S) and Xho 1 (X) used for cloning are also shown. (c) Luciferase activity of Brn-3b reporter constructs following transfection into MCF-7 cells is compared with baseline luciferase activity of the empty reporter vector. Values, shown as relative luciferase units (RLU),, were equalised with Renilla internal control (d) Schematic showing positions of putative start sites identified by in silico analysis. Initiator element and proximal TATA sequences are shown relative to ATG in exon 1, and putative intronic TATA sequences are indicated. Half-arrows show relative positions of primers used for polymerase chain reaction (PCR) assay following chromatin immunoprecipitation (ChIP) assay with α-TATA box binding protein (α-TBP) antibody (Ab) to analyse TBP binding to the different sites. (e) PCR products obtained when ChIP DNA (obtained with α-TBP Ab or secondary control Ab) was used for amplification with primers that flanked the upstream initiator elements (-1,048 bp) (A), -278TATA (B) or the intronic TA sequences (C). Primers for sequences within exon 2 ( > 1 kb from ATG) were used for amplification in the negative control (D). Positive controls represent PCR products derived by using primers that amplified the known start site of the glyceraldehyde 3-phosphate dehydrogenase ( GAPDH ) gene using α-TBP or control ChIP DNA (E). Input represents amplification using one-tenth of DNA isolated before performing the ChIP assay. Right column (labeled 2nd Ab) shows the products obtained following amplification of control ChIP Ab (α-rabbit secondary Ab) using the indicated primers.

    Journal: Breast Cancer Research : BCR

    Article Title: Proliferation-associated POU4F2/Brn-3b transcription factor expression is regulated by oestrogen through ER? and growth factors via MAPK pathway

    doi: 10.1186/bcr2809

    Figure Lengend Snippet: Identification and cloning of transcription start site in transcription factor-related Brn-3a regulator isolated from brain cDNA (Brn-3b) promoter . (a) Homology plots (VISTA Genome Browser) showing regions of similarity in Brn-3b gene and 5' upstream sequences between human (top) and dog, horse and mouse (bottom) genome sequences. Regions of homology are indicated by peaks and grey shading, and positions of Brn-3b exons and intronic sequences are shown. (b) Schematic showing cloned Bst X1 (B)/ Stu 1 (S)/ Xho 1 (X) (BSX) construct containing putative Brn-3b promoter and regulatory sequences or the BSX exon-intron-exon (BSXEIE) expression construct containing the promoter, regulatory and coding sequences, which were used for subsequent studies. Promoter and regulatory sequences are shown in grey-striped area. 5' noncoding sequences at the beginning of exon 1 are indicated by the black bar. The white stripe at the start of exon 2 represents unique sequences that are present in Brn-3b(s) transcripts, but not in Brn-3b(l) transcripts. The positions of restriction enzyme sites Bst X1 (B), Stu 1 (S) and Xho 1 (X) used for cloning are also shown. (c) Luciferase activity of Brn-3b reporter constructs following transfection into MCF-7 cells is compared with baseline luciferase activity of the empty reporter vector. Values, shown as relative luciferase units (RLU),, were equalised with Renilla internal control (d) Schematic showing positions of putative start sites identified by in silico analysis. Initiator element and proximal TATA sequences are shown relative to ATG in exon 1, and putative intronic TATA sequences are indicated. Half-arrows show relative positions of primers used for polymerase chain reaction (PCR) assay following chromatin immunoprecipitation (ChIP) assay with α-TATA box binding protein (α-TBP) antibody (Ab) to analyse TBP binding to the different sites. (e) PCR products obtained when ChIP DNA (obtained with α-TBP Ab or secondary control Ab) was used for amplification with primers that flanked the upstream initiator elements (-1,048 bp) (A), -278TATA (B) or the intronic TA sequences (C). Primers for sequences within exon 2 ( > 1 kb from ATG) were used for amplification in the negative control (D). Positive controls represent PCR products derived by using primers that amplified the known start site of the glyceraldehyde 3-phosphate dehydrogenase ( GAPDH ) gene using α-TBP or control ChIP DNA (E). Input represents amplification using one-tenth of DNA isolated before performing the ChIP assay. Right column (labeled 2nd Ab) shows the products obtained following amplification of control ChIP Ab (α-rabbit secondary Ab) using the indicated primers.

    Article Snippet: Negative control ChIP assay was performed using antibody to glyceraldehyde 3-phosphate dehydrogenase (anti-GAPDH) (Abcam) or secondary Ab (Dako) only.

    Techniques: Clone Assay, Isolation, Construct, Expressing, Luciferase, Activity Assay, Transfection, Plasmid Preparation, In Silico, Polymerase Chain Reaction, Chromatin Immunoprecipitation, Binding Assay, Amplification, Negative Control, Derivative Assay, Labeling

    Alterations of calpains activity in the ALIM supernates with the calpain inhibitor (calpeptin). A. Calpain activity in the ALIM supernate maintained on a high level. B. The effect of different doses of calpeptin on calpains activity. C. Expressions of IL-6, IL-8 and TNF-α in ALIM were significantly reduced by calpeptin. D. The expression of PCNA protein was lower when the calpeptin was added. RFU, relative fluorescence units; NC, negative control; PCNA, proliferating cell nuclear antigen; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IL, interleukin; TNF, tumor necrosis factor; ALIM, acute lung infection model. *, P

    Journal: Bioengineered

    Article Title: Effect and mechanism of calpains on pediatric lobar pneumonia

    doi: 10.1080/21655979.2016.1234544

    Figure Lengend Snippet: Alterations of calpains activity in the ALIM supernates with the calpain inhibitor (calpeptin). A. Calpain activity in the ALIM supernate maintained on a high level. B. The effect of different doses of calpeptin on calpains activity. C. Expressions of IL-6, IL-8 and TNF-α in ALIM were significantly reduced by calpeptin. D. The expression of PCNA protein was lower when the calpeptin was added. RFU, relative fluorescence units; NC, negative control; PCNA, proliferating cell nuclear antigen; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IL, interleukin; TNF, tumor necrosis factor; ALIM, acute lung infection model. *, P

    Article Snippet: The primer sequences were: proliferating cell nuclear antigen (PCNA), forward primer: 5′AAACTAGCTACACTTTCCTC’3, reverse primer: 5′TCACGCCCATGGCCAGGTTG’3; Calpain, forward primer: 5′TCGTGCTCGCCCTTAT GC’3, reverse primer: 5′CTTGTCCAGGTCAAACTTCC’3; glyceraldehyde-3- phosphate dehydrogenase (GAPDH, Abcam, Cambridge, United Kingdom), forward primer: 5′ATC TGGCACCACACCTTCTACA’3, reverse primer: 5′GTTTGGTGGATGCCACAGGACT’3.

    Techniques: Activity Assay, Expressing, Fluorescence, Negative Control, Infection

    The effect of calpains on the lung cells MRC-5. A. The transfection efficiency of siRNA-calpains 1 and 2 to lung fibroblast MRC-5 cells. B. Expressions of IL-6, IL-8 and TNF-α in transferred lung cells with calpains silence. C. The expressions of PCNA protein in transferred lung cells with calpains silence. NC, negative control; si, small interfering; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IL, interleukin; TNF, tumor necrosis factor; PCNA, proliferating cell nuclear antigen. *, P

    Journal: Bioengineered

    Article Title: Effect and mechanism of calpains on pediatric lobar pneumonia

    doi: 10.1080/21655979.2016.1234544

    Figure Lengend Snippet: The effect of calpains on the lung cells MRC-5. A. The transfection efficiency of siRNA-calpains 1 and 2 to lung fibroblast MRC-5 cells. B. Expressions of IL-6, IL-8 and TNF-α in transferred lung cells with calpains silence. C. The expressions of PCNA protein in transferred lung cells with calpains silence. NC, negative control; si, small interfering; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IL, interleukin; TNF, tumor necrosis factor; PCNA, proliferating cell nuclear antigen. *, P

    Article Snippet: The primer sequences were: proliferating cell nuclear antigen (PCNA), forward primer: 5′AAACTAGCTACACTTTCCTC’3, reverse primer: 5′TCACGCCCATGGCCAGGTTG’3; Calpain, forward primer: 5′TCGTGCTCGCCCTTAT GC’3, reverse primer: 5′CTTGTCCAGGTCAAACTTCC’3; glyceraldehyde-3- phosphate dehydrogenase (GAPDH, Abcam, Cambridge, United Kingdom), forward primer: 5′ATC TGGCACCACACCTTCTACA’3, reverse primer: 5′GTTTGGTGGATGCCACAGGACT’3.

    Techniques: Transfection, Negative Control

    The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.

    Journal: Neuropsychiatric Disease and Treatment

    Article Title: Effect of dexmedetomidine on hippocampal neuron development and BDNF-TrkB signal expression in neonatal rats

    doi: 10.2147/NDT.S120078

    Figure Lengend Snippet: The expression of BDNF and TrkB in the four groups by the Western blot: ( A ) the electrophoretogram of Western blot; ( B ) the bar charts of the expression of BDNF and TrkB. Note: *Indicates the significance compared to the control group. Abbreviations: BDNF, brain-derived neurotrophic factor; Ctrl, control group; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; NMDAR, N-methyl-D-aspartate receptor.

    Article Snippet: Main reagents and instruments The following reagents and chemicals were used for the experiments: Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum, Neurobasal® , and B27 additives (Thermo Fisher Scientific, Waltham, MA, USA); L-glutamine (Sigma-Aldrich Co., St Louis, MO, USA); DEX (Jiangsu Hengrui Medicine Co., Lianyungang, People’s Republic of China); terminal deoxynucleotidyl transferase-mediated biotinylated uridine triphosphate (UTP) nick end labeling (TUNEL) kit (Vazyme Biotech Co., Piscataway, NJ, USA); MTT detection kit (Beijing Boosen Biological Technology Co., Beijing, People’s Republic of China); RNA purification kit (QIAGEN Translational Medicine Co., Suzhou, People’s Republic of China); reverse transcription kit (Applied Biosystems Co., Foster City, CA, USA); SYBR Green real-time PCR premixed liquid (Applied Biosystems Co.); ReadyPrep protein extraction kit (Bio-Rad Laboratories Inc., Hercules, CA, USA); MAP-2 monoclonal antibody (Santa Cruz Biotechnology Inc., Dallas, TX, USA); BDNF, TrkB, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) monoclonal antibody (Abcam, Cambridge, UK); p-N-methyl-D-aspartate receptor (p-NMDAR) and NMDAR-2B monoclonal antibody (CST Co., Danvers, MA, USA); horseradish peroxidase (HRP)-labeled secondary antibody (Wuhan Boster Bioengineering Limited Co., Wuhan, People’s Republic of China).

    Techniques: Expressing, Western Blot, Derivative Assay

    The relative expression and quantitative curves of SYN ( A and C ) and PSD95 ( B and D ) in the four groups. Abbreviations: Ctrl, control group; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RFU, relative fluorescence unit; SYN, synaptophysin.

    Journal: Neuropsychiatric Disease and Treatment

    Article Title: Effect of dexmedetomidine on hippocampal neuron development and BDNF-TrkB signal expression in neonatal rats

    doi: 10.2147/NDT.S120078

    Figure Lengend Snippet: The relative expression and quantitative curves of SYN ( A and C ) and PSD95 ( B and D ) in the four groups. Abbreviations: Ctrl, control group; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RFU, relative fluorescence unit; SYN, synaptophysin.

    Article Snippet: Main reagents and instruments The following reagents and chemicals were used for the experiments: Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum, Neurobasal® , and B27 additives (Thermo Fisher Scientific, Waltham, MA, USA); L-glutamine (Sigma-Aldrich Co., St Louis, MO, USA); DEX (Jiangsu Hengrui Medicine Co., Lianyungang, People’s Republic of China); terminal deoxynucleotidyl transferase-mediated biotinylated uridine triphosphate (UTP) nick end labeling (TUNEL) kit (Vazyme Biotech Co., Piscataway, NJ, USA); MTT detection kit (Beijing Boosen Biological Technology Co., Beijing, People’s Republic of China); RNA purification kit (QIAGEN Translational Medicine Co., Suzhou, People’s Republic of China); reverse transcription kit (Applied Biosystems Co., Foster City, CA, USA); SYBR Green real-time PCR premixed liquid (Applied Biosystems Co.); ReadyPrep protein extraction kit (Bio-Rad Laboratories Inc., Hercules, CA, USA); MAP-2 monoclonal antibody (Santa Cruz Biotechnology Inc., Dallas, TX, USA); BDNF, TrkB, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) monoclonal antibody (Abcam, Cambridge, UK); p-N-methyl-D-aspartate receptor (p-NMDAR) and NMDAR-2B monoclonal antibody (CST Co., Danvers, MA, USA); horseradish peroxidase (HRP)-labeled secondary antibody (Wuhan Boster Bioengineering Limited Co., Wuhan, People’s Republic of China).

    Techniques: Expressing, Fluorescence

    Western blot analysis of proteins involved in intracellular pathway initiated by D6 engagement by active ligands and leading to cofilin-inactivation and actin filaments depolymerization. Phosphorylated (p)-LIMK1 (A) and p-Cofilin (B) were increased in trophoblast cell lysates from PE patients compared to controls. GAPDH: glyceraldehyde-3-phosphate dehydrogenase (loading control). Results are expressed as mean ± SE of six experiments. *p

    Journal: PLoS ONE

    Article Title: Placental Chemokine Receptor D6 Is Functionally Impaired in Pre-Eclampsia

    doi: 10.1371/journal.pone.0164747

    Figure Lengend Snippet: Western blot analysis of proteins involved in intracellular pathway initiated by D6 engagement by active ligands and leading to cofilin-inactivation and actin filaments depolymerization. Phosphorylated (p)-LIMK1 (A) and p-Cofilin (B) were increased in trophoblast cell lysates from PE patients compared to controls. GAPDH: glyceraldehyde-3-phosphate dehydrogenase (loading control). Results are expressed as mean ± SE of six experiments. *p

    Article Snippet: Trophoblast cell lysates were incubated overnight at +4°C with anti human D6 antibody and mouse anti human Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (dilution 1:1000; Abcam, Cambridge, UK), a cytoplasmic protein.

    Techniques: Western Blot

    Effect of acute and chronic 2-(2-(5-methoxy-1 H -indol-3-yl)ethyl)-5-methyl-1,3,4-oxadiazole (IQM316) or melatonin administration on hippocampal oxidative phosphorylation (OXPHOS) protein levels. Animals were treated with vehicle (Vhc), IQM316 (IQM), or melatonin (Mel). Quantitative analysis of the effect of acute (A) and chronic (C) administrations on hippocampal OXPHOS protein levels. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for normalization. Representative Western blots for acute (B) and chronic (D) administrations quantified in A and C, respectively. Acute administration of either IQM316 or melatonin significantly increased subunit B of complex II and complex I subunit (COX I) protein levels but reduced COX IV and ATP-5β. Nonetheless, chronic IQM316 or melatonin administration only increased the protein levels of NDUFB8. Data are mean ± SEM, n = 8 animals per group. * P

    Journal: Cell Transplantation

    Article Title: The Melatonin Analog IQM316 May Induce Adult Hippocampal Neurogenesis and Preserve Recognition Memories in Mice

    doi: 10.1177/0963689717721217

    Figure Lengend Snippet: Effect of acute and chronic 2-(2-(5-methoxy-1 H -indol-3-yl)ethyl)-5-methyl-1,3,4-oxadiazole (IQM316) or melatonin administration on hippocampal oxidative phosphorylation (OXPHOS) protein levels. Animals were treated with vehicle (Vhc), IQM316 (IQM), or melatonin (Mel). Quantitative analysis of the effect of acute (A) and chronic (C) administrations on hippocampal OXPHOS protein levels. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for normalization. Representative Western blots for acute (B) and chronic (D) administrations quantified in A and C, respectively. Acute administration of either IQM316 or melatonin significantly increased subunit B of complex II and complex I subunit (COX I) protein levels but reduced COX IV and ATP-5β. Nonetheless, chronic IQM316 or melatonin administration only increased the protein levels of NDUFB8. Data are mean ± SEM, n = 8 animals per group. * P

    Article Snippet: To control for the amount of protein loaded, we used a mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH)-GAPDH-loading control antibody (1:10,000, Abcam).

    Techniques: Western Blot

    Effect of acute 2-(2-(5-methoxy-1 H -indol-3-yl)ethyl)-5-methyl-1,3,4-oxadiazole (IQM316) or melatonin administration on mitochondrial biogenesis. Animals were treated with vehicle (Vhc) or IQM316 (IQM) or melatonin (Mel). (A) Quantitative analysis of the complex I subunit (COX I)/COX IV protein level ratio upon acute and chronic administrations. Acute administration of either IQM316 or melatonin increased the COXI/COXIV ratio, suggesting activation of mitochondrial DNA replication or translation. Chronic administration had no effect on the ratio. (B) Quantification of the mitochondrial DNA/nuclear DNA ratio upon acute and chronic administrations. Acute administrations increased the ratio, whereas chronic administrations did not. (C) Quantification of relative mRNA expression levels of peroxisome proliferator-activated receptor gamma coactivator 1α (PGC-1α), mitochondrial transcription factor A (Tfam), and nuclear respiratory factor 1 (NRF-1) upon acute administration. Expression levels were normalized to hypoxanthine guanine phosphoribosyltransferase and relative to vehicle. Acute administration of either compound did not activate the expression mitochondrial biogenesis genes. (D) Quantitative analysis and representative Western blots of Voltage-dependent anion-selective channel 1 (VDAC1) protein levels upon acute administration. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the normalization control. Acute administration of either compounds did not alter the mitochondrial protein levels, indicating that mitochondrial biogenesis was not affected. Data are mean ± SEM, n = 8 animals per group. * P

    Journal: Cell Transplantation

    Article Title: The Melatonin Analog IQM316 May Induce Adult Hippocampal Neurogenesis and Preserve Recognition Memories in Mice

    doi: 10.1177/0963689717721217

    Figure Lengend Snippet: Effect of acute 2-(2-(5-methoxy-1 H -indol-3-yl)ethyl)-5-methyl-1,3,4-oxadiazole (IQM316) or melatonin administration on mitochondrial biogenesis. Animals were treated with vehicle (Vhc) or IQM316 (IQM) or melatonin (Mel). (A) Quantitative analysis of the complex I subunit (COX I)/COX IV protein level ratio upon acute and chronic administrations. Acute administration of either IQM316 or melatonin increased the COXI/COXIV ratio, suggesting activation of mitochondrial DNA replication or translation. Chronic administration had no effect on the ratio. (B) Quantification of the mitochondrial DNA/nuclear DNA ratio upon acute and chronic administrations. Acute administrations increased the ratio, whereas chronic administrations did not. (C) Quantification of relative mRNA expression levels of peroxisome proliferator-activated receptor gamma coactivator 1α (PGC-1α), mitochondrial transcription factor A (Tfam), and nuclear respiratory factor 1 (NRF-1) upon acute administration. Expression levels were normalized to hypoxanthine guanine phosphoribosyltransferase and relative to vehicle. Acute administration of either compound did not activate the expression mitochondrial biogenesis genes. (D) Quantitative analysis and representative Western blots of Voltage-dependent anion-selective channel 1 (VDAC1) protein levels upon acute administration. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the normalization control. Acute administration of either compounds did not alter the mitochondrial protein levels, indicating that mitochondrial biogenesis was not affected. Data are mean ± SEM, n = 8 animals per group. * P

    Article Snippet: To control for the amount of protein loaded, we used a mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH)-GAPDH-loading control antibody (1:10,000, Abcam).

    Techniques: Activation Assay, Expressing, Pyrolysis Gas Chromatography, Western Blot