Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: DISC1 interacts with GluN1, TRAK1 associates with GluN2B. ( a ) HA-GluN1 co-immunoprecipitates FLAG-DISC1 from transfected COS7 cells. ( b ) Upper, GluN1 cytoplasmic tail (C0-C1-C2) peptide array hybridised with Flag-DISC1. Each spot represents a single peptide. red, black and green text marks the C0, C1 and C2 cassettes respectively. ER retention signals are in bold. ( c ) FLAG-DISC1 co-immunoprecipitates GST-tagged C0-C1-C2. ( d ) DISC1 peptide array probed with FLAG-C0-C1-C2. ( e ) DISC1 361-385 GluN1 binding region alanine scan probed with FLAG-C0-C1-C2. C, unmutated peptide. ( f ) HA-GluN1 co-immunoprecipitates GST-DISC1 amino acids 358-499 from transfected COS7 cells. ( g ) Co-localisation of FLAG-DISC1 and endogenous GluN1 in cultured DIV8 and DIV14 hippocampal neurons. Arrowheads and arrows indicate example sites of colocalisation. ( h ) COS7 cells transfected with GluN1 or HA-GluN2B expression constructs were labelled with antibodies specific for GluN1 or HA, plus the ER marker Calreticulin. ( i ) COS7 cells co-transfected with FLAG-TRAK1 plus GluN1 (left) or HA-GluN2B (right) expression constructs were labelled using antibodies specific for GluN1 or HA, plus antiFLAG and the mitochondrial dye Mitotracker CMXRos. ( j ) COS7 cells triple-transfected with FLAG-TRAK1, GluN1 plus HA-GluN2B expression constructs were labelled using antibodies specific for GluN1, HA and FLAG, plus Mitotracker CMXRos. COS7 cells were used because they are ideal for exogenous protein expression due to their high transfection efficiency, large size and low profile, which facilitate co-immunoprecipitation and colocalisation studies to complement endogenous protein studies in neurons. ( k ) Trak1 immunoprecipitates GluN2B from adult mouse brain synaptosome and light membrane fractions. Scale bars, 50μm in G, otherwise 20μm; white boxes indicate enlarged areas

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Transfection, Peptide Microarray, Binding Assay, Cell Culture, Expressing, Construct, Marker, Immunoprecipitation

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Altered distal dendritic NMDAR trafficking in Disc1 Der1/Der1 hippocampal neurons. ( a ) Green Dendra2 fluorescence in dendrites of a DIV8 mouse hippocampal neuron transfected with GluN1-Dendra2 plus HA-GluN2B. Scale bar, 5μm ( b )( c ) Mean red fluorescence intensity, b, or ROI dendritic length, c, in the central bin in Disc1 wt/wt and Disc1 Der1/Der1 DIV8 neurons was equal at time zero following photoconversion. ( d ) Quantification of fluorescence intensity over time in successive 5μm dendritic bins distal to the centre of the photoconversion ROI. Data analysed by timepoint-paired two tailed t-test. ( e ) Model of dendritic GluN1-Dendra2 motility. Photoconverted GluN1-Dendra2 progresses in a wave-like fashion, with the fastest and slowest moving GluN1-Dendra2 at the leading and trailing edges, respectively, and the bulk travelling as the ‘crest’. ( f ) Fluorescence peak velocity estimates for the 10μm and 15μm bins. Average time to peak fluorescence was converted to velocity, indicated above each bar. Average velocities were determined from the two bins. ( g ) Fast-moving GluN1-Dendra2 maximum velocity estimates for the 25μm-40μm bins. Average time to fluorescence appearance was converted to velocity, indicated above each bar. Average velocities were determined from the four bins. WT, Disc1 wt/wt ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; **** p<0.0001; *** p<0.001; ** p<0.01; *p<0.05; n indicated on graphs

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Fluorescence, Transfection, Two Tailed Test

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: NMDAR trafficking assay controls and analysis of photoconverted GluN1-Dendra2 movement along a dendrite. ( a ) Endogenous GluN1 detected in wild-type DIV8 hippocampal neurons by immunofluorescence exhibits a fine granular appearance. scale bar, 15μm ( b ) GluN1-Dendra2 (native green Dendra2 fluorescence) co-localises withendogenous PSD95 in DIV14 hippocampal neurons within dendritic spines. scale bar, 20μm, arrowheads point to synapses ( c )( d ) Green fluorescent (non photoconverted) and red fluorescent (photoconverted) GluN1-Dendra2 in the first image frame captured after photoconversion. scale bars in c-j, 50μm ( e ) The dendrite area to be analysed is defined by a segmentation mask (green) applied on the green channel. ( f ) The area delimited by the segmentation mask is shown as a green line in the corresponding red channel image. Only the intensity of the red pixels located within the segmentation mask is measured. ( g ) A ‘skeleton’ (white line) corresponding to the longitudinal axis of the primary dendrite and all its branches is superimposed on the red image, providing a guide along which the algorithm will quantify the intensity of the red pixels. ( h ) At the start of the analysis, the analysis circle (white circle, 10μm in diameter) is placed on the geometric centre of the photoconversion ROI. Red pixels delimited by the intersection of the measuring circle with the dendrite outline (green) are measured through the time series. ( i ) The analysis circle moves one step along the dendrite in the distal direction. The new position of the centre of the analysis circle is defined by the intersection point between its previous position (dotted circle) and the dendrite skeleton (white line). The previous position of the circle (dotted circle) has been measured, and the corresponding data have been deleted. ( j ) Once the measuring circle has covered the entire dendritic area included in the image, an image showing all generated segments and their distance (in pixels) from the geometric centre of the photoconversion ROI is displayed. Mean intensity measured in all subsequent segments is normalised to the mean intensity measured in this first segment. ( k ) Example fluorescence intensity plot from a 5μm bin where fluorescence peaked within the 10 seconds prior to imaging onset. ( l ) 15μm bin where fluorescence peaked within the imaging period. ( m ) 25μm bin where fluorescence increased steadily because the peak was not reached during the imaging period. ( n ) 25μm bin where fluorescence appearance above background was delayed for 90s. This plot illustrates the use of sigmoidal curves to identify when fluorescence appears, as indicated by the arrow. Yellow rectangles represent the photoconversion ROI (14μm wide on average); red dots indicate the geometric centre of the photoconversion ROI; white rectangles indicate enlarged areas

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Immunofluorescence, Fluorescence, Generated, Imaging

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Altered distal dendritic NMDAR trafficking in mouse hippocampal neurons overexpressing DISC1 or DISC1-37W. ( a )( b ) Mean red fluorescence intensity, b, or ROIdendritic length, c, in the central bin in Disc1 wt/wt and Disc1 Der1/Der1 DIV8 neurons was equal at time zero following photoconversion. ( c ) Quantification of fluorescence intensity over time in successive 5μm dendritic bins distal to the centre of the photoconversion ROI. Data analysed by timepoint-paired two tailed t-test. ( d ) Model of dendritic GluN1-Dendra2 motility. Photoconverted GluN1-Dendra2 progresses in a wave-like fashion, with the fastest and slowest moving GluN1-Dendra2 at the leading and trailing edges, respectively, and the bulk travelling as the ‘crest’. ( e ) Fluorescence peak velocity estimates for the 10μm and 15μm bins. Average time to peak fluorescence was converted to velocity, indicated above each bar. Average velocities were determined from the two bins. ( f ) Fast-moving GluN1-Dendra2 maximum velocity estimates for the 25μm-40μm bins. Average time to fluorescence appearance was converted to velocity, indicated above each bar. Average velocities were determined from the four bins. error bars represent SEM; **** p<0.0001; *** p<0.001; ** p<0.01; *p<0.05; n indicated on graphs

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Fluorescence, Two Tailed Test

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Altered proximal dendritic GluN1-Dendra2 motility due to DISC1 overexpression or the Der1 mutation. ( a ) Effect of DISC1 overexpression. Quantification of fluorescence intensity over time in successive 5μm dendritic bins proximal to the centre of the photoconversion ROI. Mean fluorescence intensity at each time point within each bin is normalised to mean fluorescence intensity in the central bin at time zero per neuron. Total neuron numbers from three independent cultures are indicated. To determine whether fluorescence intensity differed between the expression constructs within each bin, data were analysed by Friedman repeated measures test (p<0.0001, p<0.0001, p<0.0001, p=0.0008, p<0.0001, p=0.02, p<0.0001, for the 5μm to 35μm bins, respectively) with Dunn’s post-hoc testing. ( b ) Model of dendritic GluN1-Dendra2 motility as described in . Total neuron numbers from three independent cultures are indicated. EV, empty vector; DISC1, wild-type DISC1; 37W, DISC1-37W; error bars represent SEM; *** p<0.001; ** p<0.01; *p<0.05 ( c ) Effect of the Der1 mutation. Quantification of fluorescence intensity over time in successive 5μm bins proximal to the centre of the photoconversion ROI. Mean fluorescence intensity at each time point within each bin is normalised to mean fluorescence intensity in the central bin at time zero per neuron. Total neuron numbers from three independent cultures are indicated. To determine whether fluorescence intensity differed between the genotypes within each bin, data were analysed by paired two tailed t-test to make comparisons at each timepoint. ( d ) Model of dendritic GluN1-Dendra2 motility as described in . WT, Disc1 wt/wt ; HOM, Disc1 Der1/Der1 ; error bars represent SEM, **** p<0.0001, ** p<0.01, * p<0.05, ns not significant

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Over Expression, Mutagenesis, Fluorescence, Expressing, Construct, Plasmid Preparation, Two Tailed Test

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Dendritic NMDAR and PSD95 expression in hippocampal neurons. ( a ) 3D-SIM images of surface GluN1, GluN2A or Glun2B, and total PSD95 and βIII-tubulin (Tuj1). WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der1 ; HOM, Disc1 Der1/Der1 ; scale bars, 2μm in main images, 0.6μm in enlarged insets indicated by white boxes ( b ) 3D-SIM image of a dendrite segment showing PSD95 (green) and βIII-tubulin (Tuj1, magenta). Scale bar B-F, 1μm ( c ) Identification of Imaris surfaces for PSD95. These three-dimensional surfaces are counted and their volume is quantified by the software. ( d ) PSD95 surfaces split into individual nanodomains. ( e ) Identification of the centre of each individual nanodomain, and conversion to Imaris spots using a bespoke MATLAB (MathWorks) XTension script. ( f ) Individual nanodomains are assigned to clusters, and the number per cluster is counted using the Imaris spots MATLAB XTension ‘Split into Surface Objects’.

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Expressing, Software

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Altered dendritic NMDAR surface expression and GluN1 localisation to the post-synaptic density in Disc1 wt/Der1 and Disc1 Der1/Der1 hippocampal neurons. ( a ) Objects in 3D-SIM images visualised using the Imaris Isosurface tool. Touching objects are separated, with boundary lines between touching objects visible in the enlarged images. scale bars, 2μm in the full-size images, 0.6μm in enlarged insets indicated by white boxes ( b ) GluN1, GluN2A or GluN2B surface puncta density, total surface volume and individual surface puncta volume (all normalised to dendritic segment volume) from 3D reconstructions of primary dendrite segments of cultured DIV21 hippocampal neurons. Data analysed by Kruskal-Wallis (puncta density p=0.02, p=0.03, p=0.0004, total volume p=0.0025, p=0.4, p=0.003, puncta volume p=0.003, p<0.0001, p<0.0001 for GluN1, GluN2A and GluN2B respectively) followed by Dunn’s multiple comparison test. ( c ) Reconstructed 3D-SIM images of dendrites. Colocalised voxels, which contain signal from both PSD95 and surface-expressed GluN1 are shown in white. Scale bars, 3μm ( d ) GluN1 co-localisation with the PSD95 was evaluated on three measures. Pearson’s and Mander’s coefficients respectively indicate overall correlation of each signal or amount of GluN1 signal co-localised with PSD95 signal, and vice versa. Data analysed by Kruskal-Wallis (p=0.004, p=0.08, p=0.001 for Pearson’s, Mander’s M1 and Mander’s M2) followed by Dunn’s multiple comparison test. WT, Disc1 wt/wt ; HET, Disc1 wt/Der1 ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; *** p<0.001; ** p<0.01; * p<0.05; n indicated on graphs

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Expressing, Cell Culture

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: NMDAR subunit GluN2A and GluN2B co-localisation with the post-synaptic density marker PSD95. ( a ) Reconstructed 3D-SIM images of dendrites. Colocalised voxels, which contain signal from both PSD95 and surface-expressed GluN1 are shown in white. White boxes indicate enlarged regions. Scale bars, 3μm ( b ) Pearson’s coefficient indicates overall correlation of each signal. Mander’s coefficients measure the amount of subunit fluorescent signal co-localised with total PSD95 signal, and vice versa. Data were analysed by Kruskal-Wallis (p=0.02 for GluN2A Mander’s M1, p=0.06 for GluN2B Mander’s M1) followed by Dunn’s multiple comparison test. WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der1 ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; * p<0.05 ( c ) Immunoblots of hippocampus lysates were prepared from nine week mice, and probed with antibodies specific for GluN1. GluN2A and GluN2B NMDAR subunits, followed by loading controls Gapdh and Vcl. Subunit expression relative to the loading controls was quantified using densitometry. Data were analysed by Kruskal-Wallis test and no significant differences were found WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der(1) ; HOM, Disc1 Der(1)/Der(1) ; error bars represent SEM; n indicated on graphs

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Marker, Western Blot, Expressing

Journal: Blood

Article Title: Tissue-type plasminogen activator regulates macrophage activation and innate immunity

doi: 10.1182/blood-2017-04-780205

Figure Lengend Snippet: The NMDA-R functions as an anti-inflammatory tPA signaling receptor in macrophages. (A) RT-PCR analysis comparing NMDA-R subunit mRNA expression in BMDMs and, as a control, extracts of mouse brain. (B) IF microscopy to detect the NMDA-R NR1 subunit in BMDMs. Nuclei are counterstained with DAPI. Primary antibody was omitted in control studies. (C) BMDMs were pretreated for 30 min with MK801 (1.0 µM), as is indicated, and then with LPS (0.1 µg/mL), h-EI-tPA (12 nM), or both for 1 h, as is indicated. Samples were analyzed by immunoblot analysis to detect phospho-IκBα, total IκBα, and β-actin. (D) BMDMs were pretreated with MK801 (1.0 µM) or vehicle and then with h-EI-tPA (12 nM), RAP (150 nM), or vehicle for 1 h, as is indicated. Immunoblot analysis was performed to detect phospho-IκBα, total IκBα, phospho-ERK1/2, and total ERK1/2. (E-F) BMDMs were preincubated with TLR4-Ab (5 µg/mL) for 3 h or with MK801 (1.0 µM) for 30 min. The cells were then treated with LPS (0.1 µg/mL), h-EI-tPA (12 nM), or both, or with vehicle. RT-qPCR was performed to determine mRNA levels for TNFα (E) and IL-1β (F) (mean ± SEM; n = 4). **P < .01, ***P < .001.

Article Snippet: To identify cDNAs corresponding to the NR1/GluN1 NMDA-R subunit ( GRIN1 ), the NR2A/GluN2a subunit ( GRIN2A ), the NR2B/GluN2b subunit ( GRIN2B ), the NR2C/GluN2c subunit ( GRIN2C ), and the NR2D/GluN2d subunit ( GRIN2D ), we PCR-amplified (40 cycles) 500 ng of template cDNA by using primers from Origene and Phusion high-fidelity DNA polymerase.

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Microscopy, Western Blot, Quantitative RT-PCR

Journal: Cells

Article Title: MC4R Localizes at Excitatory Postsynaptic and Peri-Postsynaptic Sites of Hypothalamic Neurons in Primary Culture

doi: 10.3390/cells13151235

Figure Lengend Snippet: Hypothalamic neurons in primary culture express GluN1 localized at postsynaptic sites. ( A ) An orthogonal projection of six confocal images of a primary neuron expressing endogenous GluN1 and PSD95 visualized with the rabbit anti-GluN1 (AGC-001) and anti-PSD95 K28/43 antibody, respectively. The white rectangles indicate the inset regions shown at higher magnification in ( C ), and the yellow asterisk indicates the neuron of interest. ( B ) Left and right panels: Single confocal images from different positions of a Z-stack of 6 µm thickness showing the punctate distribution of PSD95 (left) and the negative staining of the nucleus (right) in the cell soma of the neuron shown in ( A ). ( C ) Enlarged images of the inset regions in ( A ). Yellow arrowheads indicate branching points. ( D ) A representative SR image of a point of PSD95 fluorescence with a representative yellow dashed line was used to determine the average diameter of PSD95 points. The graph on the right illustrates the average +/− SEM fluorescence (gray value) of PSD95 along the line, determined by measuring 180 spots of PSD95 fluorescence from 6 neurons. ( E , F ) SR images of a neurite expressing GluN1 and PSD95. The white arrow indicates a spot of PSD95 and GluN1 colocalization, and the green/magenta arrows indicate spots where PSD95 and GluN1 are adjacent. The regions indicated by the arrows are shown enlarged in ( F ). Yellow lines indicate those drawn for line segment analyses, with corresponding graphs displayed as means +/− SEM. ( G ) The distance (nm) between GluN1 and PSD95 fluorescence peaks was determined by the line segment analyses from 6 neurons from 2 independent experiments (n = 46 colocalizing points, n = 17 adjacent points), displayed as means +/− SD. The green dotted line is placed at the 216 nm cutoff that discriminates spots at which GluN1 and PSD95 colocalize (distance of fluorescence peaks < 216 nm) and those where GluN1 and PSD95 are adjacent (distance between fluorescence peaks > 216 nm and <450 nm), as indicated by the models.

Article Snippet: Primary antibodies: rabbit anti-PSD95 (Abcam #ab18258, 1:100 dilution), mouse anti-PSD95 (K28/43, NeuroMab 75-028, 1:200 dilution), mouse anti-PSD95 (Invitrogen MA1-046 1:25 dilution), rabbit anti-GluN1 (Alomone labs #AGC-001, 2 µg/mL final concentration), rabbit anti-NR2A/GluN2A (N327/95, NeuroMab 75-288, 1:50 dilution), rabbit anti-HA (C29F4, Cell Signaling Technology # 3724, 1:100 dilution), mouse anti-HA Tag (F-7) Alexa Fluor 647 (Santa Cruz Biotechnology, sc-7392 AF647, 1:100 dilution in live cells, 1:50 dilution in fixed cells).

Techniques: Expressing, Negative Staining, Fluorescence

Journal: Cells

Article Title: MC4R Localizes at Excitatory Postsynaptic and Peri-Postsynaptic Sites of Hypothalamic Neurons in Primary Culture

doi: 10.3390/cells13151235

Figure Lengend Snippet: HA-MC4R localizes together with and in the proximity of GluN1. ( A ) Confocal images (30 µm scale bar) and SR images (5 µm scale bar) of an HA-MC4R-expressing neuron, immunostained with antibodies with mouse anti-HA Tag (F-7) and rabbit anti-GluN1 (AGC-001) to visualize endogenous GluN1. The white rectangle indicates the enlarged region. The white arrow indicates a point of colocalization, and the cyan/magenta arrows indicate a site where GluN1 and HA-MC4R are adjacent. ( B ) Enlarged images of the neurite above where HA-MC4R and GluN1 colocalize (white arrow). ( C ) Enlarged images of the neurite above where HA-MC4R and GluN1 are adjacent (magenta and cyan arrows). ( B , C ) The yellow dashed lines indicate those drawn for the segment analyses, with the corresponding graphs displayed as means +/− SEM on the right. ( D ) The distance (nm) between HA-MC4R and GluN1 fluorescence peaks was determined by line segment analyses from 3 neurons from 2 independent experiments (n = 34 colocalizing points, 21 adjacent points). The green dotted line in the graph is as in . Models indicate the range of distances between colocalizing and adjacent peaks of HA-MC4R and GluN1 fluorescence, respectively.

Article Snippet: Primary antibodies: rabbit anti-PSD95 (Abcam #ab18258, 1:100 dilution), mouse anti-PSD95 (K28/43, NeuroMab 75-028, 1:200 dilution), mouse anti-PSD95 (Invitrogen MA1-046 1:25 dilution), rabbit anti-GluN1 (Alomone labs #AGC-001, 2 µg/mL final concentration), rabbit anti-NR2A/GluN2A (N327/95, NeuroMab 75-288, 1:50 dilution), rabbit anti-HA (C29F4, Cell Signaling Technology # 3724, 1:100 dilution), mouse anti-HA Tag (F-7) Alexa Fluor 647 (Santa Cruz Biotechnology, sc-7392 AF647, 1:100 dilution in live cells, 1:50 dilution in fixed cells).

Techniques: Expressing, Fluorescence