glun1 Search Results


94
Alomone Labs nr1
(A-E) Postnatal development of callosal projection in S1. (A) EGFP plasmid injected into lateral ventricle of embryo at embryonic day15.5 (E15.5) and electrical pulse given to enable the plasmid to enter cortical progenitor cells of layer II/III in the ventricular zone. (B, B’) At postnatal day 5 (P5), the callosal axons from S1 had reached the white matter underneath contralateral S1. (C, C’) At P8, the callosal axons were diffusely distributed in contralateral S1. (D, D’) By P12, pruning of excess projections led to a refined innervation pattern with a narrow band limited to the S1/S2 border. (E, E’) After P12, the pattern was stable as observed at P30. (F) In P14 control mice ( Emx1 cre/+ ; <t>NR1</t> fl/wt ), the callosal innervation pattern of S1 of the contralateral cortex is well-differentiated with a dense innervation at S1/S2 border. The pattern persists to P30 (J). (G) In NR1 KO mice ( Emx1 cre/+ ; NR1 fl/fl ), the innervation pattern was disrupted and projections were extremely diffuse which also persisted to P30 (K). (H) Quantification of fluorescent intensity across the medial to lateral extent of the S1. (I, L) Quantification of fluorescence density of S1 region of control vs. NR1 KO mice at P14 (I, P = 0.002) and P30 (L, P = 0.0003) Scale bar: 500μm for all images. S1: primary somatosensory cortex; S2: secondary somatosensory cortex.
Nr1, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glun1/bio_rxiv__2020__06__03__130559-202-18-25?v=Alomone+Labs
Average 94 stars, based on 1 article reviews
nr1 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
NeuroMab antibodies against nr1
A , B Bar graphs showing mRNA levels of NMDAR subunits ( <t>Grin1,</t> Grin2a, Grin2b ) and AMPAR ( Gria1, Gria2 ) subunits ( A ) and synaptic proteins ( Shank3 , Homber1b , Arc ) ( B ) in PFC of adult saline-treated WT or Shank3 +/ΔC mice treated with saline or Rom/GSK (0.25/5 mg/kg, i.p., 3x) at 8 days post-treatment. n = 7–11 mice per group. C, D Bar graphs showing total ( C ) or synaptic ( D ) protein levels of NMDAR subunits in the 3 groups at 8 days post-treatment. C, n = 7–9 mice/group; D, n = 5–7 mice per group. Insets: representative immunoblots. In all figures, # p < 0.1, * p < 0.05, **p < 0.01, *** p < 0.001.
Antibodies Against Nr1, supplied by NeuroMab, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glun1/pmc07862604-79-5-9?v=NeuroMab
Average 93 stars, based on 1 article reviews
antibodies against nr1 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc pglun1 ser897
Fig. 4. Western blot analysis of NMDA receptors in the hippocampus of control and CsA-treated rats. (A) Representative images of the levels of total (pan) GluN2, GluN2A, GluN2B, p-GluN1 <t>(Ser897)</t> and total GluN1. (B-F) Respective quantifications of immunodetections normalized to β-actin and presented as a percentage of the control mean. Data represent the mean ± SEM. Statistics: ** *p ≤0.001 as determined by Student’s t-test; n = 6.
Pglun1 Ser897, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glun1/10__1016_slash_j__jadr__2022__100394-83-55-60?v=Cell+Signaling+Technology+Inc
Average 93 stars, based on 1 article reviews
pglun1 ser897 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc glun1
mRNA and protein levels of <t>GluN1</t> subunits of NMDARs in hippocampal cells. ( A ) Relative expression of Grin1 gene in the hippocampus of rats consumed different F - doses normalized to that of a pair of reference genes ( Eef1a+Ppia ). Average values ± SEM (n = 10). ( B , C ) Protein expression of native and phosphorylated (Ser890) forms of GluN1 subunit in cytosolic and membrane fractions, respectively. Shown are typical immunoblots and average values ± SEM (n = 8).
Glun1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glun1/pmc11546234-245-13-29?v=Cell+Signaling+Technology+Inc
Average 95 stars, based on 1 article reviews
glun1 - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

94
Proteintech anti glun1
mRNA and protein levels of <t>GluN1</t> subunits of NMDARs in hippocampal cells. ( A ) Relative expression of Grin1 gene in the hippocampus of rats consumed different F - doses normalized to that of a pair of reference genes ( Eef1a+Ppia ). Average values ± SEM (n = 10). ( B , C ) Protein expression of native and phosphorylated (Ser890) forms of GluN1 subunit in cytosolic and membrane fractions, respectively. Shown are typical immunoblots and average values ± SEM (n = 8).
Anti Glun1, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glun1/pmc11848598-319-21-37?v=Proteintech
Average 94 stars, based on 1 article reviews
anti glun1 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc rabbit anti phospho nmda receptor 1
mRNA and protein levels of <t>GluN1</t> subunits of NMDARs in hippocampal cells. ( A ) Relative expression of Grin1 gene in the hippocampus of rats consumed different F - doses normalized to that of a pair of reference genes ( Eef1a+Ppia ). Average values ± SEM (n = 10). ( B , C ) Protein expression of native and phosphorylated (Ser890) forms of GluN1 subunit in cytosolic and membrane fractions, respectively. Shown are typical immunoblots and average values ± SEM (n = 8).
Rabbit Anti Phospho Nmda Receptor 1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glun1/pmc07939089-86-70-76?v=Cell+Signaling+Technology+Inc
Average 93 stars, based on 1 article reviews
rabbit anti phospho nmda receptor 1 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc rabbit anti phosphonmdar1 igg
mRNA and protein levels of <t>GluN1</t> subunits of NMDARs in hippocampal cells. ( A ) Relative expression of Grin1 gene in the hippocampus of rats consumed different F - doses normalized to that of a pair of reference genes ( Eef1a+Ppia ). Average values ± SEM (n = 10). ( B , C ) Protein expression of native and phosphorylated (Ser890) forms of GluN1 subunit in cytosolic and membrane fractions, respectively. Shown are typical immunoblots and average values ± SEM (n = 8).
Rabbit Anti Phosphonmdar1 Igg, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glun1/pm18021294-73-10-15?v=Cell+Signaling+Technology+Inc
Average 93 stars, based on 1 article reviews
rabbit anti phosphonmdar1 igg - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

91
OriGene human grin1
mRNA and protein levels of <t>GluN1</t> subunits of NMDARs in hippocampal cells. ( A ) Relative expression of Grin1 gene in the hippocampus of rats consumed different F - doses normalized to that of a pair of reference genes ( Eef1a+Ppia ). Average values ± SEM (n = 10). ( B , C ) Protein expression of native and phosphorylated (Ser890) forms of GluN1 subunit in cytosolic and membrane fractions, respectively. Shown are typical immunoblots and average values ± SEM (n = 8).
Human Grin1, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glun1/us11807650-1723-13-18?v=OriGene
Average 91 stars, based on 1 article reviews
human grin1 - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

nr1  (OriGene)
90
OriGene nr1
mRNA and protein levels of <t>GluN1</t> subunits of NMDARs in hippocampal cells. ( A ) Relative expression of Grin1 gene in the hippocampus of rats consumed different F - doses normalized to that of a pair of reference genes ( Eef1a+Ppia ). Average values ± SEM (n = 10). ( B , C ) Protein expression of native and phosphorylated (Ser890) forms of GluN1 subunit in cytosolic and membrane fractions, respectively. Shown are typical immunoblots and average values ± SEM (n = 8).
Nr1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glun1/pm36009192-48-7-26?v=OriGene
Average 90 stars, based on 1 article reviews
nr1 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
OriGene glun1
mRNA and protein levels of <t>GluN1</t> subunits of NMDARs in hippocampal cells. ( A ) Relative expression of Grin1 gene in the hippocampus of rats consumed different F - doses normalized to that of a pair of reference genes ( Eef1a+Ppia ). Average values ± SEM (n = 10). ( B , C ) Protein expression of native and phosphorylated (Ser890) forms of GluN1 subunit in cytosolic and membrane fractions, respectively. Shown are typical immunoblots and average values ± SEM (n = 8).
Glun1, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glun1/pmc12426952-109-23-25?v=OriGene
Average 93 stars, based on 1 article reviews
glun1 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
OriGene human grin1 gene transcript variant nr1 3
mRNA and protein levels of <t>GluN1</t> subunits of NMDARs in hippocampal cells. ( A ) Relative expression of Grin1 gene in the hippocampus of rats consumed different F - doses normalized to that of a pair of reference genes ( Eef1a+Ppia ). Average values ± SEM (n = 10). ( B , C ) Protein expression of native and phosphorylated (Ser890) forms of GluN1 subunit in cytosolic and membrane fractions, respectively. Shown are typical immunoblots and average values ± SEM (n = 8).
Human Grin1 Gene Transcript Variant Nr1 3, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glun1/pm26829109-220-1-7?v=OriGene
Average 90 stars, based on 1 article reviews
human grin1 gene transcript variant nr1 3 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
OriGene construct pcmv6 ac nr1 glun1 gfp
DISC1 interacts with <t>GluN1,</t> TRAK1 associates with GluN2B. ( a ) <t>HA-GluN1</t> co-immunoprecipitates FLAG-DISC1 from transfected COS7 cells. ( b ) Upper, GluN1 cytoplasmic tail (C0-C1-C2) peptide array hybridised with Flag-DISC1. Each spot represents a single peptide. red, black and green text marks the C0, C1 and C2 cassettes respectively. ER retention signals are in bold. ( c ) FLAG-DISC1 co-immunoprecipitates GST-tagged C0-C1-C2. ( d ) DISC1 peptide array probed with FLAG-C0-C1-C2. ( e ) DISC1 361-385 GluN1 binding region alanine scan probed with FLAG-C0-C1-C2. C, unmutated peptide. ( f ) HA-GluN1 co-immunoprecipitates GST-DISC1 amino acids 358-499 from transfected COS7 cells. ( g ) Co-localisation of FLAG-DISC1 and endogenous GluN1 in cultured DIV8 and DIV14 hippocampal neurons. Arrowheads and arrows indicate example sites of colocalisation. ( h ) COS7 cells transfected with GluN1 or HA-GluN2B expression constructs were labelled with antibodies specific for GluN1 or HA, plus the ER marker Calreticulin. ( i ) COS7 cells co-transfected with FLAG-TRAK1 plus GluN1 (left) or HA-GluN2B (right) expression constructs were labelled using antibodies specific for GluN1 or HA, plus antiFLAG and the mitochondrial dye Mitotracker CMXRos. ( j ) COS7 cells triple-transfected with FLAG-TRAK1, GluN1 plus HA-GluN2B expression constructs were labelled using antibodies specific for GluN1, HA and FLAG, plus Mitotracker CMXRos. COS7 cells were used because they are ideal for exogenous protein expression due to their high transfection efficiency, large size and low profile, which facilitate co-immunoprecipitation and colocalisation studies to complement endogenous protein studies in neurons. ( k ) Trak1 immunoprecipitates GluN2B from adult mouse brain synaptosome and light membrane fractions. Scale bars, 50μm in G, otherwise 20μm; white boxes indicate enlarged areas
Construct Pcmv6 Ac Nr1 Glun1 Gfp, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glun1/bio_rxiv__349365-270-23-26?v=OriGene
Average 90 stars, based on 1 article reviews
construct pcmv6 ac nr1 glun1 gfp - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


(A-E) Postnatal development of callosal projection in S1. (A) EGFP plasmid injected into lateral ventricle of embryo at embryonic day15.5 (E15.5) and electrical pulse given to enable the plasmid to enter cortical progenitor cells of layer II/III in the ventricular zone. (B, B’) At postnatal day 5 (P5), the callosal axons from S1 had reached the white matter underneath contralateral S1. (C, C’) At P8, the callosal axons were diffusely distributed in contralateral S1. (D, D’) By P12, pruning of excess projections led to a refined innervation pattern with a narrow band limited to the S1/S2 border. (E, E’) After P12, the pattern was stable as observed at P30. (F) In P14 control mice ( Emx1 cre/+ ; NR1 fl/wt ), the callosal innervation pattern of S1 of the contralateral cortex is well-differentiated with a dense innervation at S1/S2 border. The pattern persists to P30 (J). (G) In NR1 KO mice ( Emx1 cre/+ ; NR1 fl/fl ), the innervation pattern was disrupted and projections were extremely diffuse which also persisted to P30 (K). (H) Quantification of fluorescent intensity across the medial to lateral extent of the S1. (I, L) Quantification of fluorescence density of S1 region of control vs. NR1 KO mice at P14 (I, P = 0.002) and P30 (L, P = 0.0003) Scale bar: 500μm for all images. S1: primary somatosensory cortex; S2: secondary somatosensory cortex.

Journal: bioRxiv

Article Title: NMDA receptors control cortical axonal projections via EPHRIN-B/EPHB signaling

doi: 10.1101/2020.06.03.130559

Figure Lengend Snippet: (A-E) Postnatal development of callosal projection in S1. (A) EGFP plasmid injected into lateral ventricle of embryo at embryonic day15.5 (E15.5) and electrical pulse given to enable the plasmid to enter cortical progenitor cells of layer II/III in the ventricular zone. (B, B’) At postnatal day 5 (P5), the callosal axons from S1 had reached the white matter underneath contralateral S1. (C, C’) At P8, the callosal axons were diffusely distributed in contralateral S1. (D, D’) By P12, pruning of excess projections led to a refined innervation pattern with a narrow band limited to the S1/S2 border. (E, E’) After P12, the pattern was stable as observed at P30. (F) In P14 control mice ( Emx1 cre/+ ; NR1 fl/wt ), the callosal innervation pattern of S1 of the contralateral cortex is well-differentiated with a dense innervation at S1/S2 border. The pattern persists to P30 (J). (G) In NR1 KO mice ( Emx1 cre/+ ; NR1 fl/fl ), the innervation pattern was disrupted and projections were extremely diffuse which also persisted to P30 (K). (H) Quantification of fluorescent intensity across the medial to lateral extent of the S1. (I, L) Quantification of fluorescence density of S1 region of control vs. NR1 KO mice at P14 (I, P = 0.002) and P30 (L, P = 0.0003) Scale bar: 500μm for all images. S1: primary somatosensory cortex; S2: secondary somatosensory cortex.

Article Snippet: Antibodies for intraventricular injection : commercial anti-NMDAR antibody is against amino acid residues 385-399 in the N-terminus of NR1 and was made in Rabbit (AGC-001, Alomone labs).

Techniques: Plasmid Preparation, Injection, Control, Fluorescence

Examples of 12-μm coronal brain sections from P8 Emx1 cre/+ ; NR1 wt/wt (A) and Emx1 cre/+ ; NR1 fl/fl (B) of the same litter. Immunostaining of vesicular glutamate transporter 2 (VGult2) showed thalamocortical barrels in Layer IV of S1 which are pointed out by arrows. The VGlut2 staining in Emx1 cre/+ ; NR1 wt/wt mice revealed a clear barrel pattern (Aa). However, the barrel pattern in Emx1 cre/+ ; NR1 fl/fl mice was disrupted and less distinct (Ba). The NR1 staining in Emx1 cre/+ ; NR1 wt/wt mice were dense and strong in cortex (Ab, Ac). However, the staining in Emx1 cre/+ ; NR1 fl/fl mice was less bright and apparently reduced in Layer V and VI (Bb, Bc). Scale bar: 100μm for Ac and Bc; 500μm for rest of images.

Journal: bioRxiv

Article Title: NMDA receptors control cortical axonal projections via EPHRIN-B/EPHB signaling

doi: 10.1101/2020.06.03.130559

Figure Lengend Snippet: Examples of 12-μm coronal brain sections from P8 Emx1 cre/+ ; NR1 wt/wt (A) and Emx1 cre/+ ; NR1 fl/fl (B) of the same litter. Immunostaining of vesicular glutamate transporter 2 (VGult2) showed thalamocortical barrels in Layer IV of S1 which are pointed out by arrows. The VGlut2 staining in Emx1 cre/+ ; NR1 wt/wt mice revealed a clear barrel pattern (Aa). However, the barrel pattern in Emx1 cre/+ ; NR1 fl/fl mice was disrupted and less distinct (Ba). The NR1 staining in Emx1 cre/+ ; NR1 wt/wt mice were dense and strong in cortex (Ab, Ac). However, the staining in Emx1 cre/+ ; NR1 fl/fl mice was less bright and apparently reduced in Layer V and VI (Bb, Bc). Scale bar: 100μm for Ac and Bc; 500μm for rest of images.

Article Snippet: Antibodies for intraventricular injection : commercial anti-NMDAR antibody is against amino acid residues 385-399 in the N-terminus of NR1 and was made in Rabbit (AGC-001, Alomone labs).

Techniques: Immunostaining, Staining

(A, B) The callosal axons in S1 formed a bundle and grew into the ipsilateral CC at P0 in control and NR1 KO littermates ( Emx1 cre/+ ; NR1 fl/wt and Emx1 cre/+ ; NR1 fl/fl mice). The arrows show the extent of axon growth into the CC. By P3, the callosal axons crossed the midline (C, D) and by P5, the callosal axons have grown to underneath the contralateral S1 (E, F). Scale bar: 500μm for all images.

Journal: bioRxiv

Article Title: NMDA receptors control cortical axonal projections via EPHRIN-B/EPHB signaling

doi: 10.1101/2020.06.03.130559

Figure Lengend Snippet: (A, B) The callosal axons in S1 formed a bundle and grew into the ipsilateral CC at P0 in control and NR1 KO littermates ( Emx1 cre/+ ; NR1 fl/wt and Emx1 cre/+ ; NR1 fl/fl mice). The arrows show the extent of axon growth into the CC. By P3, the callosal axons crossed the midline (C, D) and by P5, the callosal axons have grown to underneath the contralateral S1 (E, F). Scale bar: 500μm for all images.

Article Snippet: Antibodies for intraventricular injection : commercial anti-NMDAR antibody is against amino acid residues 385-399 in the N-terminus of NR1 and was made in Rabbit (AGC-001, Alomone labs).

Techniques: Control

(A, A’) At P6, most axons in control grew into deeper layer VI of S1 (see “*”); a few axons grew to layer V from medial to lateral S1 (see arrows). However, axons projecting to lateral S2 had grown to layer IV which was apparently faster than the axons in S1 (see arrows). (B, B’) In NR1 KO mice, most axons had grown to layer V and some even grew to layer I (see arrows) at P6. (C, D) At P8, axons in control and mutant mice had grown to the superficial layer of cortex. However, the innervation patterns were different. Controls showed more axon innervation in the lateral S1 with dense callosal innervation at S1/S2 border (C). Mutants showed slightly more axon innervation in the medial S1 (D). (E) The fluorescence density of mutant mice in S1 was significantly higher than in control mice at P6 which suggested that the mutants had increased axon innervation in contralateral S1 at P6. P = 0.003. Scale bar: 500μm for all images. The square brackets in all images outline the S1. The arrow heads in all images outline the S1/S2 border. White lines outline different layers in the cortex of Figure A-D. M: medial; L: lateral.

Journal: bioRxiv

Article Title: NMDA receptors control cortical axonal projections via EPHRIN-B/EPHB signaling

doi: 10.1101/2020.06.03.130559

Figure Lengend Snippet: (A, A’) At P6, most axons in control grew into deeper layer VI of S1 (see “*”); a few axons grew to layer V from medial to lateral S1 (see arrows). However, axons projecting to lateral S2 had grown to layer IV which was apparently faster than the axons in S1 (see arrows). (B, B’) In NR1 KO mice, most axons had grown to layer V and some even grew to layer I (see arrows) at P6. (C, D) At P8, axons in control and mutant mice had grown to the superficial layer of cortex. However, the innervation patterns were different. Controls showed more axon innervation in the lateral S1 with dense callosal innervation at S1/S2 border (C). Mutants showed slightly more axon innervation in the medial S1 (D). (E) The fluorescence density of mutant mice in S1 was significantly higher than in control mice at P6 which suggested that the mutants had increased axon innervation in contralateral S1 at P6. P = 0.003. Scale bar: 500μm for all images. The square brackets in all images outline the S1. The arrow heads in all images outline the S1/S2 border. White lines outline different layers in the cortex of Figure A-D. M: medial; L: lateral.

Article Snippet: Antibodies for intraventricular injection : commercial anti-NMDAR antibody is against amino acid residues 385-399 in the N-terminus of NR1 and was made in Rabbit (AGC-001, Alomone labs).

Techniques: Control, Mutagenesis, Fluorescence

(A) In control mice ( Emx1 cre/+ ; NR1 fl/wt ), cleaved caspase-3 + cells were mostly detected in layer II/III of M1 (A’), only rare cell death was observed in other cortical regions, such as S1 (A’’). (B) Compared with controls, there was increased cell death in layer II/III of motor cortex in mutant mice ( Emx1 cre/+ ; NR1 fl/fl ) (B’). However, compared with controls, there was no increased cell death in other cortical regions in mutant mice, such as S1 (B’’). Scale bar: 500μm for A and B; 200μm for A’, A’’, B’ and B’’.

Journal: bioRxiv

Article Title: NMDA receptors control cortical axonal projections via EPHRIN-B/EPHB signaling

doi: 10.1101/2020.06.03.130559

Figure Lengend Snippet: (A) In control mice ( Emx1 cre/+ ; NR1 fl/wt ), cleaved caspase-3 + cells were mostly detected in layer II/III of M1 (A’), only rare cell death was observed in other cortical regions, such as S1 (A’’). (B) Compared with controls, there was increased cell death in layer II/III of motor cortex in mutant mice ( Emx1 cre/+ ; NR1 fl/fl ) (B’). However, compared with controls, there was no increased cell death in other cortical regions in mutant mice, such as S1 (B’’). Scale bar: 500μm for A and B; 200μm for A’, A’’, B’ and B’’.

Article Snippet: Antibodies for intraventricular injection : commercial anti-NMDAR antibody is against amino acid residues 385-399 in the N-terminus of NR1 and was made in Rabbit (AGC-001, Alomone labs).

Techniques: Control, Mutagenesis

(A-D) Deleting NMDAR specifically in projecting neurons. Vectors expressing Cre-recombinase (Cre) and EGFP were delivered into S1 of floxed NR1 mice ( NR1 fl/wt x NR1 fl/wt ) by in utero electroporation at E15.5 (A). Callosal innervation patterns at P14 in control NR1 ipsiS1+/+ mice (B) and NR1 ipsiS1−/− mice (C). (D) Quantification of fluorescence density. P = 0.317. (E-H) Deleting NMDAR specifically in target neurons. NR1 was deleted in target contralateral S1 by in utero electroporation of Cre at E12.5 in NR1 fl/fl ; Ai14 fl/fl mice, the ipsilateral projecting neurons were labeled by EGFP at E15.5 (E). Compared with control NR1 wt/wt ; Ai14 fl/fl (F), NR1 fl/fl ; Ai14 fl/fl mice which specifically deleted NR1 in target S1 showed increased callosal innervation in S1 as “*” shows (G). (H) Quantification of fluorescence density. P = 0.002. Scale bar: 500μm for all images.

Journal: bioRxiv

Article Title: NMDA receptors control cortical axonal projections via EPHRIN-B/EPHB signaling

doi: 10.1101/2020.06.03.130559

Figure Lengend Snippet: (A-D) Deleting NMDAR specifically in projecting neurons. Vectors expressing Cre-recombinase (Cre) and EGFP were delivered into S1 of floxed NR1 mice ( NR1 fl/wt x NR1 fl/wt ) by in utero electroporation at E15.5 (A). Callosal innervation patterns at P14 in control NR1 ipsiS1+/+ mice (B) and NR1 ipsiS1−/− mice (C). (D) Quantification of fluorescence density. P = 0.317. (E-H) Deleting NMDAR specifically in target neurons. NR1 was deleted in target contralateral S1 by in utero electroporation of Cre at E12.5 in NR1 fl/fl ; Ai14 fl/fl mice, the ipsilateral projecting neurons were labeled by EGFP at E15.5 (E). Compared with control NR1 wt/wt ; Ai14 fl/fl (F), NR1 fl/fl ; Ai14 fl/fl mice which specifically deleted NR1 in target S1 showed increased callosal innervation in S1 as “*” shows (G). (H) Quantification of fluorescence density. P = 0.002. Scale bar: 500μm for all images.

Article Snippet: Antibodies for intraventricular injection : commercial anti-NMDAR antibody is against amino acid residues 385-399 in the N-terminus of NR1 and was made in Rabbit (AGC-001, Alomone labs).

Techniques: Expressing, In Utero, Electroporation, Control, Fluorescence, Labeling

(A) NR1 was deleted in target contralateral S1 by in utero electroporation of Cre at E13.5 in NR1 fl/fl ; Ai14 fl/fl mice, the ipsilateral projecting neurons were labeled by EGFP at E15.5. Compared with control NR1 wt/wt ; Ai14 fl/fl (B), NR1 fl/fl ; Ai14 fl/fl , with NR1 specifically deleted in upper cortical layers did not show increased callosal innervation in (C). (D) Quantification of fluorescence density. P = 0.27. Scale bar: 500μm for all images.

Journal: bioRxiv

Article Title: NMDA receptors control cortical axonal projections via EPHRIN-B/EPHB signaling

doi: 10.1101/2020.06.03.130559

Figure Lengend Snippet: (A) NR1 was deleted in target contralateral S1 by in utero electroporation of Cre at E13.5 in NR1 fl/fl ; Ai14 fl/fl mice, the ipsilateral projecting neurons were labeled by EGFP at E15.5. Compared with control NR1 wt/wt ; Ai14 fl/fl (B), NR1 fl/fl ; Ai14 fl/fl , with NR1 specifically deleted in upper cortical layers did not show increased callosal innervation in (C). (D) Quantification of fluorescence density. P = 0.27. Scale bar: 500μm for all images.

Article Snippet: Antibodies for intraventricular injection : commercial anti-NMDAR antibody is against amino acid residues 385-399 in the N-terminus of NR1 and was made in Rabbit (AGC-001, Alomone labs).

Techniques: In Utero, Electroporation, Labeling, Control, Fluorescence

(A) Anti-NR1 antibodies were injected into the lateral ventricle from P2 to P8 and mice were perfused 3 hours later after last injection. Rabbit IgG served as control. Mouse brains then were stained with anti-Rabbit secondary coupled to Alexa594. The red fluorophore of Alexa594 indicated where the antibodies had distributed to. Scale bar: 500μm for all images. (B, B’) In control, the fluorescence signals were mostly detected in the cortex of the ipsilateral injection side, and few in the contralateral cortex. In the ipsilateral injection side, the signals were detected in all the cortical layers, but most strongly in the pia, layer I, layer V, layer VI, cingulum and corpus callosum (see arrows). The signals were also detected in the hippocampus and contralateral motor cortex (see arrows). (C, C’) The general antibody distribution pattern was similar as seen in control. Moreover, the anti-NR1 antibody can bind to NMDAR on the cell membranes, which thus showing beautiful cell membrane staining (see arrows in C’). Scale bar: 500 μm for Figure B, C; 200 μm for Figure B’, C’. CC: corpus callosum; cg: cingulum; Hip: hippocampus; M: motor cortex; S1: primary somatosensory cortex; S2: secondary somatosensory cortex.

Journal: bioRxiv

Article Title: NMDA receptors control cortical axonal projections via EPHRIN-B/EPHB signaling

doi: 10.1101/2020.06.03.130559

Figure Lengend Snippet: (A) Anti-NR1 antibodies were injected into the lateral ventricle from P2 to P8 and mice were perfused 3 hours later after last injection. Rabbit IgG served as control. Mouse brains then were stained with anti-Rabbit secondary coupled to Alexa594. The red fluorophore of Alexa594 indicated where the antibodies had distributed to. Scale bar: 500μm for all images. (B, B’) In control, the fluorescence signals were mostly detected in the cortex of the ipsilateral injection side, and few in the contralateral cortex. In the ipsilateral injection side, the signals were detected in all the cortical layers, but most strongly in the pia, layer I, layer V, layer VI, cingulum and corpus callosum (see arrows). The signals were also detected in the hippocampus and contralateral motor cortex (see arrows). (C, C’) The general antibody distribution pattern was similar as seen in control. Moreover, the anti-NR1 antibody can bind to NMDAR on the cell membranes, which thus showing beautiful cell membrane staining (see arrows in C’). Scale bar: 500 μm for Figure B, C; 200 μm for Figure B’, C’. CC: corpus callosum; cg: cingulum; Hip: hippocampus; M: motor cortex; S1: primary somatosensory cortex; S2: secondary somatosensory cortex.

Article Snippet: Antibodies for intraventricular injection : commercial anti-NMDAR antibody is against amino acid residues 385-399 in the N-terminus of NR1 and was made in Rabbit (AGC-001, Alomone labs).

Techniques: Injection, Control, Staining, Fluorescence, Membrane

(A-D) Anti-NR1 antibodies were injected into the lateral ventricle from P2 to P12 in ipsilateral cortex. RbIgG served as control. Compared with control (B), antibody injection in mice did not show increased callosal innervation in S1 at P14 (C). (D) Quantification of fluorescence density. P = 0.94. (E-H) Anti-NR1 antibodies were injected into the lateral ventricle from P2 to P12 in contralateral cortex. Compared with control (F), antibody injection in mice showed increased callosal innervation in S1 at P14 (see “*”, G). (H) Quantification of fluorescence density. P =0.0002. Scale bar: 500μm for all images.

Journal: bioRxiv

Article Title: NMDA receptors control cortical axonal projections via EPHRIN-B/EPHB signaling

doi: 10.1101/2020.06.03.130559

Figure Lengend Snippet: (A-D) Anti-NR1 antibodies were injected into the lateral ventricle from P2 to P12 in ipsilateral cortex. RbIgG served as control. Compared with control (B), antibody injection in mice did not show increased callosal innervation in S1 at P14 (C). (D) Quantification of fluorescence density. P = 0.94. (E-H) Anti-NR1 antibodies were injected into the lateral ventricle from P2 to P12 in contralateral cortex. Compared with control (F), antibody injection in mice showed increased callosal innervation in S1 at P14 (see “*”, G). (H) Quantification of fluorescence density. P =0.0002. Scale bar: 500μm for all images.

Article Snippet: Antibodies for intraventricular injection : commercial anti-NMDAR antibody is against amino acid residues 385-399 in the N-terminus of NR1 and was made in Rabbit (AGC-001, Alomone labs).

Techniques: Injection, Control, Fluorescence

(A-D) Anti-NR1 antibodies were injected into the lateral ventricle from P4 to P8 in contralateral cortex. RbIgG served as control. Compared with control (B), antibody injection in mice show increased callosal innervation in S1 at P14 (C). (D) Quantification of fluorescence density. P = 0.004. (E-H) Anti-NR1 antibodies were injected into the lateral ventricle from P8 to P14 in contralateral cortex. Compared with control (F), antibody injection in mice did not show increased callosal innervation in S1 at P14 (G). (H) Quantification of fluorescence density. P = 0.69. Scale bar: 500μm for all images.

Journal: bioRxiv

Article Title: NMDA receptors control cortical axonal projections via EPHRIN-B/EPHB signaling

doi: 10.1101/2020.06.03.130559

Figure Lengend Snippet: (A-D) Anti-NR1 antibodies were injected into the lateral ventricle from P4 to P8 in contralateral cortex. RbIgG served as control. Compared with control (B), antibody injection in mice show increased callosal innervation in S1 at P14 (C). (D) Quantification of fluorescence density. P = 0.004. (E-H) Anti-NR1 antibodies were injected into the lateral ventricle from P8 to P14 in contralateral cortex. Compared with control (F), antibody injection in mice did not show increased callosal innervation in S1 at P14 (G). (H) Quantification of fluorescence density. P = 0.69. Scale bar: 500μm for all images.

Article Snippet: Antibodies for intraventricular injection : commercial anti-NMDAR antibody is against amino acid residues 385-399 in the N-terminus of NR1 and was made in Rabbit (AGC-001, Alomone labs).

Techniques: Injection, Control, Fluorescence

(A) The callosal innervation pattern in S1 at P30 in control mice ( Emx1 cre/+ ; NR2A fl/wt ) is similar as the pattern in P14 WT control mice, with few axons in S1 but a dense innervation at S1/S2 border. (B) In the mutant mice ( Emx1 cre/+ ; NR2A fl/fl ), the general innervation pattern was as same as control. However, the increased callosal innervation at the border of M1 and S1 was persistent at P30 (see “*” in B’). (C) Quantification of fluorescence density. P = 0.63. (D) In control Emx1 cre/+ ; NR2B fl/wt mice, the callosal innervation pattern at P30 was as normal as WT control. (E) However, the increased callosal innervation in Emx1 cre/+ ; NR2B fl/fl mice lasted at least to P30 as we observed in Emx1 cre/+ ; NR1 fl/fl mice at P30. (F) Quantification of fluorescence density. P = 0.007. Scale bar: 500μm for all images.

Journal: bioRxiv

Article Title: NMDA receptors control cortical axonal projections via EPHRIN-B/EPHB signaling

doi: 10.1101/2020.06.03.130559

Figure Lengend Snippet: (A) The callosal innervation pattern in S1 at P30 in control mice ( Emx1 cre/+ ; NR2A fl/wt ) is similar as the pattern in P14 WT control mice, with few axons in S1 but a dense innervation at S1/S2 border. (B) In the mutant mice ( Emx1 cre/+ ; NR2A fl/fl ), the general innervation pattern was as same as control. However, the increased callosal innervation at the border of M1 and S1 was persistent at P30 (see “*” in B’). (C) Quantification of fluorescence density. P = 0.63. (D) In control Emx1 cre/+ ; NR2B fl/wt mice, the callosal innervation pattern at P30 was as normal as WT control. (E) However, the increased callosal innervation in Emx1 cre/+ ; NR2B fl/fl mice lasted at least to P30 as we observed in Emx1 cre/+ ; NR1 fl/fl mice at P30. (F) Quantification of fluorescence density. P = 0.007. Scale bar: 500μm for all images.

Article Snippet: Antibodies for intraventricular injection : commercial anti-NMDAR antibody is against amino acid residues 385-399 in the N-terminus of NR1 and was made in Rabbit (AGC-001, Alomone labs).

Techniques: Control, Mutagenesis, Fluorescence

(A, B) EPHB2 protein expression are decreased in Emx1 cre/+ ; NR1 fl/fl mice at P5. In control Emx1 cre/+ ; NR1 wt/wt mice, EPHB2 was expressed both in CC and cortex (A). EPHB2 in Emx1 cre/+ ; NR1 fl/fl mice was dramatically decreased in cortex (B). (C) Western blot analysis of cortical protein extracts from P8 S1 showed that, relative to the loading control beta-tubulin (β-Tub) and GAPDH, lower levels of EPHB2 were observed in the five samples of Emx1 cre/+ ; NR1 fl/fl mice compared to the five samples of controls. (D) Quantification of protein levels relative to β-Tub. P=0.001. (E) Quantification of protein levels relative to GAPDH. P< 0.0001. (F) The quantitative polymerase chain reaction (qPCR) analysis showed no expression difference of EPHB2 between Emx1 cre/+ ; NR1 fl/fl mice and controls. Scale bar: 500μm for A, B.

Journal: bioRxiv

Article Title: NMDA receptors control cortical axonal projections via EPHRIN-B/EPHB signaling

doi: 10.1101/2020.06.03.130559

Figure Lengend Snippet: (A, B) EPHB2 protein expression are decreased in Emx1 cre/+ ; NR1 fl/fl mice at P5. In control Emx1 cre/+ ; NR1 wt/wt mice, EPHB2 was expressed both in CC and cortex (A). EPHB2 in Emx1 cre/+ ; NR1 fl/fl mice was dramatically decreased in cortex (B). (C) Western blot analysis of cortical protein extracts from P8 S1 showed that, relative to the loading control beta-tubulin (β-Tub) and GAPDH, lower levels of EPHB2 were observed in the five samples of Emx1 cre/+ ; NR1 fl/fl mice compared to the five samples of controls. (D) Quantification of protein levels relative to β-Tub. P=0.001. (E) Quantification of protein levels relative to GAPDH. P< 0.0001. (F) The quantitative polymerase chain reaction (qPCR) analysis showed no expression difference of EPHB2 between Emx1 cre/+ ; NR1 fl/fl mice and controls. Scale bar: 500μm for A, B.

Article Snippet: Antibodies for intraventricular injection : commercial anti-NMDAR antibody is against amino acid residues 385-399 in the N-terminus of NR1 and was made in Rabbit (AGC-001, Alomone labs).

Techniques: Expressing, Control, Western Blot, Real-time Polymerase Chain Reaction

A , B Bar graphs showing mRNA levels of NMDAR subunits ( Grin1, Grin2a, Grin2b ) and AMPAR ( Gria1, Gria2 ) subunits ( A ) and synaptic proteins ( Shank3 , Homber1b , Arc ) ( B ) in PFC of adult saline-treated WT or Shank3 +/ΔC mice treated with saline or Rom/GSK (0.25/5 mg/kg, i.p., 3x) at 8 days post-treatment. n = 7–11 mice per group. C, D Bar graphs showing total ( C ) or synaptic ( D ) protein levels of NMDAR subunits in the 3 groups at 8 days post-treatment. C, n = 7–9 mice/group; D, n = 5–7 mice per group. Insets: representative immunoblots. In all figures, # p < 0.1, * p < 0.05, **p < 0.01, *** p < 0.001.

Journal: Translational Psychiatry

Article Title: Synergistic inhibition of histone modifiers produces therapeutic effects in adult Shank3 -deficient mice

doi: 10.1038/s41398-021-01233-w

Figure Lengend Snippet: A , B Bar graphs showing mRNA levels of NMDAR subunits ( Grin1, Grin2a, Grin2b ) and AMPAR ( Gria1, Gria2 ) subunits ( A ) and synaptic proteins ( Shank3 , Homber1b , Arc ) ( B ) in PFC of adult saline-treated WT or Shank3 +/ΔC mice treated with saline or Rom/GSK (0.25/5 mg/kg, i.p., 3x) at 8 days post-treatment. n = 7–11 mice per group. C, D Bar graphs showing total ( C ) or synaptic ( D ) protein levels of NMDAR subunits in the 3 groups at 8 days post-treatment. C, n = 7–9 mice/group; D, n = 5–7 mice per group. Insets: representative immunoblots. In all figures, # p < 0.1, * p < 0.05, **p < 0.01, *** p < 0.001.

Article Snippet: Western blots were performed using antibodies against NR1 (1:500, NeuroMab, 75‐ 272), NR2A (1:500, Millipore, 07‐632), NR2B (1:500, Millipore, 06‐600), PSD95 (1:1000, Cell Signaling, 36233 S) and tubulin (1:5000 Sigma, T9026).

Techniques: Saline, Western Blot

Fig. 4. Western blot analysis of NMDA receptors in the hippocampus of control and CsA-treated rats. (A) Representative images of the levels of total (pan) GluN2, GluN2A, GluN2B, p-GluN1 (Ser897) and total GluN1. (B-F) Respective quantifications of immunodetections normalized to β-actin and presented as a percentage of the control mean. Data represent the mean ± SEM. Statistics: ** *p ≤0.001 as determined by Student’s t-test; n = 6.

Journal: Journal of Affective Disorders Reports

Article Title: Long-term cyclosporine A treatment promotes anxiety-like behavior: Possible relation with glutamate signaling in rat hippocampus

doi: 10.1016/j.jadr.2022.100394

Figure Lengend Snippet: Fig. 4. Western blot analysis of NMDA receptors in the hippocampus of control and CsA-treated rats. (A) Representative images of the levels of total (pan) GluN2, GluN2A, GluN2B, p-GluN1 (Ser897) and total GluN1. (B-F) Respective quantifications of immunodetections normalized to β-actin and presented as a percentage of the control mean. Data represent the mean ± SEM. Statistics: ** *p ≤0.001 as determined by Student’s t-test; n = 6.

Article Snippet: The utilized primary antibodies and respective dilutions were as follows: anti-AMPAR (1:500, #13185 Cell Signaling Technology), phosphorylated AMPAR (pAMPAR-S831) (1:1000, A4352-Sigma–Aldrich), pAMPAR (S845) (1:1000, #8084 – Cell Signaling Technology), GluN1 (1:750, #G8913 – Sigma–Aldrich), pan-GluN2 (1:750, 244-0P – SYSY Synaptic Systems), GluN2A (1:1000, #4205 - Cell Signaling Technology), GluN2B (1:1000, #4207 - Cell Signaling Technology), pGluN1 (Ser897) (1:500, 3385S – Cell Signaling Technology), nNOS (1:500, SC648 – Santa Cruz Biotechnology), and iNOS (1:750, SC7271 – Santa Cruz Biotechnology). β-actin antibody (1:5000, A5441 – Sigma-Aldrich) was used as a loading control in the experiments.

Techniques: Western Blot, Control

mRNA and protein levels of GluN1 subunits of NMDARs in hippocampal cells. ( A ) Relative expression of Grin1 gene in the hippocampus of rats consumed different F - doses normalized to that of a pair of reference genes ( Eef1a+Ppia ). Average values ± SEM (n = 10). ( B , C ) Protein expression of native and phosphorylated (Ser890) forms of GluN1 subunit in cytosolic and membrane fractions, respectively. Shown are typical immunoblots and average values ± SEM (n = 8).

Journal: International Journal of Molecular Sciences

Article Title: AMPA and NMDA Receptors in Hippocampus of Rats with Fluoride-Induced Cognitive Decline

doi: 10.3390/ijms252111796

Figure Lengend Snippet: mRNA and protein levels of GluN1 subunits of NMDARs in hippocampal cells. ( A ) Relative expression of Grin1 gene in the hippocampus of rats consumed different F - doses normalized to that of a pair of reference genes ( Eef1a+Ppia ). Average values ± SEM (n = 10). ( B , C ) Protein expression of native and phosphorylated (Ser890) forms of GluN1 subunit in cytosolic and membrane fractions, respectively. Shown are typical immunoblots and average values ± SEM (n = 8).

Article Snippet: Rabbit antibodies to GluA1 (#13185), phospho-GluA1 (#8084), GluA2 (#5306), phospho-GluA2 (#3921), GluA3 (#4676), GluN1 (#5704), phospho-GluN1 (#3381), GluN2A (#4205), phospho-GluN2A (#4206), GluN2B (#4207) and phospho-GluN2B (#4208) were purchased from Cell Signaling Technology (Danvers, MA, USA).

Techniques: Expressing, Membrane, Western Blot

DISC1 interacts with GluN1, TRAK1 associates with GluN2B. ( a ) HA-GluN1 co-immunoprecipitates FLAG-DISC1 from transfected COS7 cells. ( b ) Upper, GluN1 cytoplasmic tail (C0-C1-C2) peptide array hybridised with Flag-DISC1. Each spot represents a single peptide. red, black and green text marks the C0, C1 and C2 cassettes respectively. ER retention signals are in bold. ( c ) FLAG-DISC1 co-immunoprecipitates GST-tagged C0-C1-C2. ( d ) DISC1 peptide array probed with FLAG-C0-C1-C2. ( e ) DISC1 361-385 GluN1 binding region alanine scan probed with FLAG-C0-C1-C2. C, unmutated peptide. ( f ) HA-GluN1 co-immunoprecipitates GST-DISC1 amino acids 358-499 from transfected COS7 cells. ( g ) Co-localisation of FLAG-DISC1 and endogenous GluN1 in cultured DIV8 and DIV14 hippocampal neurons. Arrowheads and arrows indicate example sites of colocalisation. ( h ) COS7 cells transfected with GluN1 or HA-GluN2B expression constructs were labelled with antibodies specific for GluN1 or HA, plus the ER marker Calreticulin. ( i ) COS7 cells co-transfected with FLAG-TRAK1 plus GluN1 (left) or HA-GluN2B (right) expression constructs were labelled using antibodies specific for GluN1 or HA, plus antiFLAG and the mitochondrial dye Mitotracker CMXRos. ( j ) COS7 cells triple-transfected with FLAG-TRAK1, GluN1 plus HA-GluN2B expression constructs were labelled using antibodies specific for GluN1, HA and FLAG, plus Mitotracker CMXRos. COS7 cells were used because they are ideal for exogenous protein expression due to their high transfection efficiency, large size and low profile, which facilitate co-immunoprecipitation and colocalisation studies to complement endogenous protein studies in neurons. ( k ) Trak1 immunoprecipitates GluN2B from adult mouse brain synaptosome and light membrane fractions. Scale bars, 50μm in G, otherwise 20μm; white boxes indicate enlarged areas

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: DISC1 interacts with GluN1, TRAK1 associates with GluN2B. ( a ) HA-GluN1 co-immunoprecipitates FLAG-DISC1 from transfected COS7 cells. ( b ) Upper, GluN1 cytoplasmic tail (C0-C1-C2) peptide array hybridised with Flag-DISC1. Each spot represents a single peptide. red, black and green text marks the C0, C1 and C2 cassettes respectively. ER retention signals are in bold. ( c ) FLAG-DISC1 co-immunoprecipitates GST-tagged C0-C1-C2. ( d ) DISC1 peptide array probed with FLAG-C0-C1-C2. ( e ) DISC1 361-385 GluN1 binding region alanine scan probed with FLAG-C0-C1-C2. C, unmutated peptide. ( f ) HA-GluN1 co-immunoprecipitates GST-DISC1 amino acids 358-499 from transfected COS7 cells. ( g ) Co-localisation of FLAG-DISC1 and endogenous GluN1 in cultured DIV8 and DIV14 hippocampal neurons. Arrowheads and arrows indicate example sites of colocalisation. ( h ) COS7 cells transfected with GluN1 or HA-GluN2B expression constructs were labelled with antibodies specific for GluN1 or HA, plus the ER marker Calreticulin. ( i ) COS7 cells co-transfected with FLAG-TRAK1 plus GluN1 (left) or HA-GluN2B (right) expression constructs were labelled using antibodies specific for GluN1 or HA, plus antiFLAG and the mitochondrial dye Mitotracker CMXRos. ( j ) COS7 cells triple-transfected with FLAG-TRAK1, GluN1 plus HA-GluN2B expression constructs were labelled using antibodies specific for GluN1, HA and FLAG, plus Mitotracker CMXRos. COS7 cells were used because they are ideal for exogenous protein expression due to their high transfection efficiency, large size and low profile, which facilitate co-immunoprecipitation and colocalisation studies to complement endogenous protein studies in neurons. ( k ) Trak1 immunoprecipitates GluN2B from adult mouse brain synaptosome and light membrane fractions. Scale bars, 50μm in G, otherwise 20μm; white boxes indicate enlarged areas

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Transfection, Peptide Microarray, Binding Assay, Cell Culture, Expressing, Construct, Marker, Immunoprecipitation

Altered distal dendritic NMDAR trafficking in Disc1 Der1/Der1 hippocampal neurons. ( a ) Green Dendra2 fluorescence in dendrites of a DIV8 mouse hippocampal neuron transfected with GluN1-Dendra2 plus HA-GluN2B. Scale bar, 5μm ( b )( c ) Mean red fluorescence intensity, b, or ROI dendritic length, c, in the central bin in Disc1 wt/wt and Disc1 Der1/Der1 DIV8 neurons was equal at time zero following photoconversion. ( d ) Quantification of fluorescence intensity over time in successive 5μm dendritic bins distal to the centre of the photoconversion ROI. Data analysed by timepoint-paired two tailed t-test. ( e ) Model of dendritic GluN1-Dendra2 motility. Photoconverted GluN1-Dendra2 progresses in a wave-like fashion, with the fastest and slowest moving GluN1-Dendra2 at the leading and trailing edges, respectively, and the bulk travelling as the ‘crest’. ( f ) Fluorescence peak velocity estimates for the 10μm and 15μm bins. Average time to peak fluorescence was converted to velocity, indicated above each bar. Average velocities were determined from the two bins. ( g ) Fast-moving GluN1-Dendra2 maximum velocity estimates for the 25μm-40μm bins. Average time to fluorescence appearance was converted to velocity, indicated above each bar. Average velocities were determined from the four bins. WT, Disc1 wt/wt ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; **** p<0.0001; *** p<0.001; ** p<0.01; *p<0.05; n indicated on graphs

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Altered distal dendritic NMDAR trafficking in Disc1 Der1/Der1 hippocampal neurons. ( a ) Green Dendra2 fluorescence in dendrites of a DIV8 mouse hippocampal neuron transfected with GluN1-Dendra2 plus HA-GluN2B. Scale bar, 5μm ( b )( c ) Mean red fluorescence intensity, b, or ROI dendritic length, c, in the central bin in Disc1 wt/wt and Disc1 Der1/Der1 DIV8 neurons was equal at time zero following photoconversion. ( d ) Quantification of fluorescence intensity over time in successive 5μm dendritic bins distal to the centre of the photoconversion ROI. Data analysed by timepoint-paired two tailed t-test. ( e ) Model of dendritic GluN1-Dendra2 motility. Photoconverted GluN1-Dendra2 progresses in a wave-like fashion, with the fastest and slowest moving GluN1-Dendra2 at the leading and trailing edges, respectively, and the bulk travelling as the ‘crest’. ( f ) Fluorescence peak velocity estimates for the 10μm and 15μm bins. Average time to peak fluorescence was converted to velocity, indicated above each bar. Average velocities were determined from the two bins. ( g ) Fast-moving GluN1-Dendra2 maximum velocity estimates for the 25μm-40μm bins. Average time to fluorescence appearance was converted to velocity, indicated above each bar. Average velocities were determined from the four bins. WT, Disc1 wt/wt ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; **** p<0.0001; *** p<0.001; ** p<0.01; *p<0.05; n indicated on graphs

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Fluorescence, Transfection, Two Tailed Test

NMDAR trafficking assay controls and analysis of photoconverted GluN1-Dendra2 movement along a dendrite. ( a ) Endogenous GluN1 detected in wild-type DIV8 hippocampal neurons by immunofluorescence exhibits a fine granular appearance. scale bar, 15μm ( b ) GluN1-Dendra2 (native green Dendra2 fluorescence) co-localises withendogenous PSD95 in DIV14 hippocampal neurons within dendritic spines. scale bar, 20μm, arrowheads point to synapses ( c )( d ) Green fluorescent (non photoconverted) and red fluorescent (photoconverted) GluN1-Dendra2 in the first image frame captured after photoconversion. scale bars in c-j, 50μm ( e ) The dendrite area to be analysed is defined by a segmentation mask (green) applied on the green channel. ( f ) The area delimited by the segmentation mask is shown as a green line in the corresponding red channel image. Only the intensity of the red pixels located within the segmentation mask is measured. ( g ) A ‘skeleton’ (white line) corresponding to the longitudinal axis of the primary dendrite and all its branches is superimposed on the red image, providing a guide along which the algorithm will quantify the intensity of the red pixels. ( h ) At the start of the analysis, the analysis circle (white circle, 10μm in diameter) is placed on the geometric centre of the photoconversion ROI. Red pixels delimited by the intersection of the measuring circle with the dendrite outline (green) are measured through the time series. ( i ) The analysis circle moves one step along the dendrite in the distal direction. The new position of the centre of the analysis circle is defined by the intersection point between its previous position (dotted circle) and the dendrite skeleton (white line). The previous position of the circle (dotted circle) has been measured, and the corresponding data have been deleted. ( j ) Once the measuring circle has covered the entire dendritic area included in the image, an image showing all generated segments and their distance (in pixels) from the geometric centre of the photoconversion ROI is displayed. Mean intensity measured in all subsequent segments is normalised to the mean intensity measured in this first segment. ( k ) Example fluorescence intensity plot from a 5μm bin where fluorescence peaked within the 10 seconds prior to imaging onset. ( l ) 15μm bin where fluorescence peaked within the imaging period. ( m ) 25μm bin where fluorescence increased steadily because the peak was not reached during the imaging period. ( n ) 25μm bin where fluorescence appearance above background was delayed for 90s. This plot illustrates the use of sigmoidal curves to identify when fluorescence appears, as indicated by the arrow. Yellow rectangles represent the photoconversion ROI (14μm wide on average); red dots indicate the geometric centre of the photoconversion ROI; white rectangles indicate enlarged areas

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: NMDAR trafficking assay controls and analysis of photoconverted GluN1-Dendra2 movement along a dendrite. ( a ) Endogenous GluN1 detected in wild-type DIV8 hippocampal neurons by immunofluorescence exhibits a fine granular appearance. scale bar, 15μm ( b ) GluN1-Dendra2 (native green Dendra2 fluorescence) co-localises withendogenous PSD95 in DIV14 hippocampal neurons within dendritic spines. scale bar, 20μm, arrowheads point to synapses ( c )( d ) Green fluorescent (non photoconverted) and red fluorescent (photoconverted) GluN1-Dendra2 in the first image frame captured after photoconversion. scale bars in c-j, 50μm ( e ) The dendrite area to be analysed is defined by a segmentation mask (green) applied on the green channel. ( f ) The area delimited by the segmentation mask is shown as a green line in the corresponding red channel image. Only the intensity of the red pixels located within the segmentation mask is measured. ( g ) A ‘skeleton’ (white line) corresponding to the longitudinal axis of the primary dendrite and all its branches is superimposed on the red image, providing a guide along which the algorithm will quantify the intensity of the red pixels. ( h ) At the start of the analysis, the analysis circle (white circle, 10μm in diameter) is placed on the geometric centre of the photoconversion ROI. Red pixels delimited by the intersection of the measuring circle with the dendrite outline (green) are measured through the time series. ( i ) The analysis circle moves one step along the dendrite in the distal direction. The new position of the centre of the analysis circle is defined by the intersection point between its previous position (dotted circle) and the dendrite skeleton (white line). The previous position of the circle (dotted circle) has been measured, and the corresponding data have been deleted. ( j ) Once the measuring circle has covered the entire dendritic area included in the image, an image showing all generated segments and their distance (in pixels) from the geometric centre of the photoconversion ROI is displayed. Mean intensity measured in all subsequent segments is normalised to the mean intensity measured in this first segment. ( k ) Example fluorescence intensity plot from a 5μm bin where fluorescence peaked within the 10 seconds prior to imaging onset. ( l ) 15μm bin where fluorescence peaked within the imaging period. ( m ) 25μm bin where fluorescence increased steadily because the peak was not reached during the imaging period. ( n ) 25μm bin where fluorescence appearance above background was delayed for 90s. This plot illustrates the use of sigmoidal curves to identify when fluorescence appears, as indicated by the arrow. Yellow rectangles represent the photoconversion ROI (14μm wide on average); red dots indicate the geometric centre of the photoconversion ROI; white rectangles indicate enlarged areas

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Immunofluorescence, Fluorescence, Generated, Imaging

Altered distal dendritic NMDAR trafficking in mouse hippocampal neurons overexpressing DISC1 or DISC1-37W. ( a )( b ) Mean red fluorescence intensity, b, or ROIdendritic length, c, in the central bin in Disc1 wt/wt and Disc1 Der1/Der1 DIV8 neurons was equal at time zero following photoconversion. ( c ) Quantification of fluorescence intensity over time in successive 5μm dendritic bins distal to the centre of the photoconversion ROI. Data analysed by timepoint-paired two tailed t-test. ( d ) Model of dendritic GluN1-Dendra2 motility. Photoconverted GluN1-Dendra2 progresses in a wave-like fashion, with the fastest and slowest moving GluN1-Dendra2 at the leading and trailing edges, respectively, and the bulk travelling as the ‘crest’. ( e ) Fluorescence peak velocity estimates for the 10μm and 15μm bins. Average time to peak fluorescence was converted to velocity, indicated above each bar. Average velocities were determined from the two bins. ( f ) Fast-moving GluN1-Dendra2 maximum velocity estimates for the 25μm-40μm bins. Average time to fluorescence appearance was converted to velocity, indicated above each bar. Average velocities were determined from the four bins. error bars represent SEM; **** p<0.0001; *** p<0.001; ** p<0.01; *p<0.05; n indicated on graphs

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Altered distal dendritic NMDAR trafficking in mouse hippocampal neurons overexpressing DISC1 or DISC1-37W. ( a )( b ) Mean red fluorescence intensity, b, or ROIdendritic length, c, in the central bin in Disc1 wt/wt and Disc1 Der1/Der1 DIV8 neurons was equal at time zero following photoconversion. ( c ) Quantification of fluorescence intensity over time in successive 5μm dendritic bins distal to the centre of the photoconversion ROI. Data analysed by timepoint-paired two tailed t-test. ( d ) Model of dendritic GluN1-Dendra2 motility. Photoconverted GluN1-Dendra2 progresses in a wave-like fashion, with the fastest and slowest moving GluN1-Dendra2 at the leading and trailing edges, respectively, and the bulk travelling as the ‘crest’. ( e ) Fluorescence peak velocity estimates for the 10μm and 15μm bins. Average time to peak fluorescence was converted to velocity, indicated above each bar. Average velocities were determined from the two bins. ( f ) Fast-moving GluN1-Dendra2 maximum velocity estimates for the 25μm-40μm bins. Average time to fluorescence appearance was converted to velocity, indicated above each bar. Average velocities were determined from the four bins. error bars represent SEM; **** p<0.0001; *** p<0.001; ** p<0.01; *p<0.05; n indicated on graphs

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Fluorescence, Two Tailed Test

Altered proximal dendritic GluN1-Dendra2 motility due to DISC1 overexpression or the Der1 mutation. ( a ) Effect of DISC1 overexpression. Quantification of fluorescence intensity over time in successive 5μm dendritic bins proximal to the centre of the photoconversion ROI. Mean fluorescence intensity at each time point within each bin is normalised to mean fluorescence intensity in the central bin at time zero per neuron. Total neuron numbers from three independent cultures are indicated. To determine whether fluorescence intensity differed between the expression constructs within each bin, data were analysed by Friedman repeated measures test (p<0.0001, p<0.0001, p<0.0001, p=0.0008, p<0.0001, p=0.02, p<0.0001, for the 5μm to 35μm bins, respectively) with Dunn’s post-hoc testing. ( b ) Model of dendritic GluN1-Dendra2 motility as described in . Total neuron numbers from three independent cultures are indicated. EV, empty vector; DISC1, wild-type DISC1; 37W, DISC1-37W; error bars represent SEM; *** p<0.001; ** p<0.01; *p<0.05 ( c ) Effect of the Der1 mutation. Quantification of fluorescence intensity over time in successive 5μm bins proximal to the centre of the photoconversion ROI. Mean fluorescence intensity at each time point within each bin is normalised to mean fluorescence intensity in the central bin at time zero per neuron. Total neuron numbers from three independent cultures are indicated. To determine whether fluorescence intensity differed between the genotypes within each bin, data were analysed by paired two tailed t-test to make comparisons at each timepoint. ( d ) Model of dendritic GluN1-Dendra2 motility as described in . WT, Disc1 wt/wt ; HOM, Disc1 Der1/Der1 ; error bars represent SEM, **** p<0.0001, ** p<0.01, * p<0.05, ns not significant

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Altered proximal dendritic GluN1-Dendra2 motility due to DISC1 overexpression or the Der1 mutation. ( a ) Effect of DISC1 overexpression. Quantification of fluorescence intensity over time in successive 5μm dendritic bins proximal to the centre of the photoconversion ROI. Mean fluorescence intensity at each time point within each bin is normalised to mean fluorescence intensity in the central bin at time zero per neuron. Total neuron numbers from three independent cultures are indicated. To determine whether fluorescence intensity differed between the expression constructs within each bin, data were analysed by Friedman repeated measures test (p<0.0001, p<0.0001, p<0.0001, p=0.0008, p<0.0001, p=0.02, p<0.0001, for the 5μm to 35μm bins, respectively) with Dunn’s post-hoc testing. ( b ) Model of dendritic GluN1-Dendra2 motility as described in . Total neuron numbers from three independent cultures are indicated. EV, empty vector; DISC1, wild-type DISC1; 37W, DISC1-37W; error bars represent SEM; *** p<0.001; ** p<0.01; *p<0.05 ( c ) Effect of the Der1 mutation. Quantification of fluorescence intensity over time in successive 5μm bins proximal to the centre of the photoconversion ROI. Mean fluorescence intensity at each time point within each bin is normalised to mean fluorescence intensity in the central bin at time zero per neuron. Total neuron numbers from three independent cultures are indicated. To determine whether fluorescence intensity differed between the genotypes within each bin, data were analysed by paired two tailed t-test to make comparisons at each timepoint. ( d ) Model of dendritic GluN1-Dendra2 motility as described in . WT, Disc1 wt/wt ; HOM, Disc1 Der1/Der1 ; error bars represent SEM, **** p<0.0001, ** p<0.01, * p<0.05, ns not significant

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Over Expression, Mutagenesis, Fluorescence, Expressing, Construct, Plasmid Preparation, Two Tailed Test

Dendritic NMDAR and PSD95 expression in hippocampal neurons. ( a ) 3D-SIM images of surface GluN1, GluN2A or Glun2B, and total PSD95 and βIII-tubulin (Tuj1). WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der1 ; HOM, Disc1 Der1/Der1 ; scale bars, 2μm in main images, 0.6μm in enlarged insets indicated by white boxes ( b ) 3D-SIM image of a dendrite segment showing PSD95 (green) and βIII-tubulin (Tuj1, magenta). Scale bar B-F, 1μm ( c ) Identification of Imaris surfaces for PSD95. These three-dimensional surfaces are counted and their volume is quantified by the software. ( d ) PSD95 surfaces split into individual nanodomains. ( e ) Identification of the centre of each individual nanodomain, and conversion to Imaris spots using a bespoke MATLAB (MathWorks) XTension script. ( f ) Individual nanodomains are assigned to clusters, and the number per cluster is counted using the Imaris spots MATLAB XTension ‘Split into Surface Objects’.

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Dendritic NMDAR and PSD95 expression in hippocampal neurons. ( a ) 3D-SIM images of surface GluN1, GluN2A or Glun2B, and total PSD95 and βIII-tubulin (Tuj1). WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der1 ; HOM, Disc1 Der1/Der1 ; scale bars, 2μm in main images, 0.6μm in enlarged insets indicated by white boxes ( b ) 3D-SIM image of a dendrite segment showing PSD95 (green) and βIII-tubulin (Tuj1, magenta). Scale bar B-F, 1μm ( c ) Identification of Imaris surfaces for PSD95. These three-dimensional surfaces are counted and their volume is quantified by the software. ( d ) PSD95 surfaces split into individual nanodomains. ( e ) Identification of the centre of each individual nanodomain, and conversion to Imaris spots using a bespoke MATLAB (MathWorks) XTension script. ( f ) Individual nanodomains are assigned to clusters, and the number per cluster is counted using the Imaris spots MATLAB XTension ‘Split into Surface Objects’.

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Expressing, Software

Altered dendritic NMDAR surface expression and GluN1 localisation to the post-synaptic density in Disc1 wt/Der1 and Disc1 Der1/Der1 hippocampal neurons. ( a ) Objects in 3D-SIM images visualised using the Imaris Isosurface tool. Touching objects are separated, with boundary lines between touching objects visible in the enlarged images. scale bars, 2μm in the full-size images, 0.6μm in enlarged insets indicated by white boxes ( b ) GluN1, GluN2A or GluN2B surface puncta density, total surface volume and individual surface puncta volume (all normalised to dendritic segment volume) from 3D reconstructions of primary dendrite segments of cultured DIV21 hippocampal neurons. Data analysed by Kruskal-Wallis (puncta density p=0.02, p=0.03, p=0.0004, total volume p=0.0025, p=0.4, p=0.003, puncta volume p=0.003, p<0.0001, p<0.0001 for GluN1, GluN2A and GluN2B respectively) followed by Dunn’s multiple comparison test. ( c ) Reconstructed 3D-SIM images of dendrites. Colocalised voxels, which contain signal from both PSD95 and surface-expressed GluN1 are shown in white. Scale bars, 3μm ( d ) GluN1 co-localisation with the PSD95 was evaluated on three measures. Pearson’s and Mander’s coefficients respectively indicate overall correlation of each signal or amount of GluN1 signal co-localised with PSD95 signal, and vice versa. Data analysed by Kruskal-Wallis (p=0.004, p=0.08, p=0.001 for Pearson’s, Mander’s M1 and Mander’s M2) followed by Dunn’s multiple comparison test. WT, Disc1 wt/wt ; HET, Disc1 wt/Der1 ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; *** p<0.001; ** p<0.01; * p<0.05; n indicated on graphs

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: Altered dendritic NMDAR surface expression and GluN1 localisation to the post-synaptic density in Disc1 wt/Der1 and Disc1 Der1/Der1 hippocampal neurons. ( a ) Objects in 3D-SIM images visualised using the Imaris Isosurface tool. Touching objects are separated, with boundary lines between touching objects visible in the enlarged images. scale bars, 2μm in the full-size images, 0.6μm in enlarged insets indicated by white boxes ( b ) GluN1, GluN2A or GluN2B surface puncta density, total surface volume and individual surface puncta volume (all normalised to dendritic segment volume) from 3D reconstructions of primary dendrite segments of cultured DIV21 hippocampal neurons. Data analysed by Kruskal-Wallis (puncta density p=0.02, p=0.03, p=0.0004, total volume p=0.0025, p=0.4, p=0.003, puncta volume p=0.003, p<0.0001, p<0.0001 for GluN1, GluN2A and GluN2B respectively) followed by Dunn’s multiple comparison test. ( c ) Reconstructed 3D-SIM images of dendrites. Colocalised voxels, which contain signal from both PSD95 and surface-expressed GluN1 are shown in white. Scale bars, 3μm ( d ) GluN1 co-localisation with the PSD95 was evaluated on three measures. Pearson’s and Mander’s coefficients respectively indicate overall correlation of each signal or amount of GluN1 signal co-localised with PSD95 signal, and vice versa. Data analysed by Kruskal-Wallis (p=0.004, p=0.08, p=0.001 for Pearson’s, Mander’s M1 and Mander’s M2) followed by Dunn’s multiple comparison test. WT, Disc1 wt/wt ; HET, Disc1 wt/Der1 ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; *** p<0.001; ** p<0.01; * p<0.05; n indicated on graphs

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Expressing, Cell Culture

NMDAR subunit GluN2A and GluN2B co-localisation with the post-synaptic density marker PSD95. ( a ) Reconstructed 3D-SIM images of dendrites. Colocalised voxels, which contain signal from both PSD95 and surface-expressed GluN1 are shown in white. White boxes indicate enlarged regions. Scale bars, 3μm ( b ) Pearson’s coefficient indicates overall correlation of each signal. Mander’s coefficients measure the amount of subunit fluorescent signal co-localised with total PSD95 signal, and vice versa. Data were analysed by Kruskal-Wallis (p=0.02 for GluN2A Mander’s M1, p=0.06 for GluN2B Mander’s M1) followed by Dunn’s multiple comparison test. WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der1 ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; * p<0.05 ( c ) Immunoblots of hippocampus lysates were prepared from nine week mice, and probed with antibodies specific for GluN1. GluN2A and GluN2B NMDAR subunits, followed by loading controls Gapdh and Vcl. Subunit expression relative to the loading controls was quantified using densitometry. Data were analysed by Kruskal-Wallis test and no significant differences were found WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der(1) ; HOM, Disc1 Der(1)/Der(1) ; error bars represent SEM; n indicated on graphs

Journal: bioRxiv

Article Title: DISC1 regulates N-Methyl-D-Aspartate receptor dynamics: Abnormalities induced by a Disc1 mutation modelling a translocation linked to major mental illness

doi: 10.1101/349365

Figure Lengend Snippet: NMDAR subunit GluN2A and GluN2B co-localisation with the post-synaptic density marker PSD95. ( a ) Reconstructed 3D-SIM images of dendrites. Colocalised voxels, which contain signal from both PSD95 and surface-expressed GluN1 are shown in white. White boxes indicate enlarged regions. Scale bars, 3μm ( b ) Pearson’s coefficient indicates overall correlation of each signal. Mander’s coefficients measure the amount of subunit fluorescent signal co-localised with total PSD95 signal, and vice versa. Data were analysed by Kruskal-Wallis (p=0.02 for GluN2A Mander’s M1, p=0.06 for GluN2B Mander’s M1) followed by Dunn’s multiple comparison test. WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der1 ; HOM, Disc1 Der1/Der1 ; error bars represent SEM; * p<0.05 ( c ) Immunoblots of hippocampus lysates were prepared from nine week mice, and probed with antibodies specific for GluN1. GluN2A and GluN2B NMDAR subunits, followed by loading controls Gapdh and Vcl. Subunit expression relative to the loading controls was quantified using densitometry. Data were analysed by Kruskal-Wallis test and no significant differences were found WT, Disc1 wt/wt ; HET, Disc1 (wt)/Der(1) ; HOM, Disc1 Der(1)/Der(1) ; error bars represent SEM; n indicated on graphs

Article Snippet: Dendra2 coding sequence was amplified from pDendra2-N (Clontech) using primer pair gatcgcggccgctcgagatgaacaccccgggaattaacc and gatcggccggccttaccacacctggctggg and sub-cloned between the NotI and FseI sites of construct pCMV6-AC-NR1 (GluN1)-GFP (Origene RG216458).

Techniques: Marker, Western Blot, Expressing