genotype Search Results


99
Transnetyx routine genotyping
Routine Genotyping, supplied by Transnetyx, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotype/bio_rxiv__64898__2026__03__15__711832-205-0-8?v=Transnetyx
Average 99 stars, based on 1 article reviews
routine genotyping - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

96
Vazyme Biotech Co one step mouse genotyping kit
Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based <t>genotyping.</t> (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.
One Step Mouse Genotyping Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotype/pmc13075461-46-6-12?v=Vazyme+Biotech+Co
Average 96 stars, based on 1 article reviews
one step mouse genotyping kit - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

86
Eurofins lck cre fw tgcaacgagtgatgaggttc eurofins genotyping
Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based <t>genotyping.</t> (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.
Lck Cre Fw Tgcaacgagtgatgaggttc Eurofins Genotyping, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotype/pm40460200-785-123-126?v=Eurofins
Average 86 stars, based on 1 article reviews
lck cre fw tgcaacgagtgatgaggttc eurofins genotyping - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

99
tiangen biotech co tianexact genotyping qpcr premix probe
Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based <t>genotyping.</t> (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.
Tianexact Genotyping Qpcr Premix Probe, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotype/pmc08232870-83-4-11?v=tiangen+biotech+co
Average 99 stars, based on 1 article reviews
tianexact genotyping qpcr premix probe - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

92
MACHEREY NAGEL dna nucleotype mouse pcr direct kit for genotyping
Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based <t>genotyping.</t> (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.
Dna Nucleotype Mouse Pcr Direct Kit For Genotyping, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotype/pmc11083572-32-6-14?v=MACHEREY+NAGEL
Average 92 stars, based on 1 article reviews
dna nucleotype mouse pcr direct kit for genotyping - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

96
Roche kapa mouse genotyping kit
Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based <t>genotyping.</t> (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.
Kapa Mouse Genotyping Kit, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotype/10__1161_slash_atvbaha__120__314557-136-10-16?v=Roche
Average 96 stars, based on 1 article reviews
kapa mouse genotyping kit - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

92
myPOLS Biotec directblood genotyping pcr kit
Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based <t>genotyping.</t> (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.
Directblood Genotyping Pcr Kit, supplied by myPOLS Biotec, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotype/pm30439355-5-30-34?v=myPOLS+Biotec
Average 92 stars, based on 1 article reviews
directblood genotyping pcr kit - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

96
Roche kapa hotstart 388 mouse genotyping kit
Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based <t>genotyping.</t> (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.
Kapa Hotstart 388 Mouse Genotyping Kit, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotype/10__1128_slash_jvi__02167___20-209-8-14?v=Roche
Average 96 stars, based on 1 article reviews
kapa hotstart 388 mouse genotyping kit - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

93
MACHEREY NAGEL nucleotype plant pcr kit
Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based <t>genotyping.</t> (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.
Nucleotype Plant Pcr Kit, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotype/pmc10706395-90-2-6?v=MACHEREY+NAGEL
Average 93 stars, based on 1 article reviews
nucleotype plant pcr kit - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

94
fluidigm 96 96 dynamic arraytm ifc
Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based <t>genotyping.</t> (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.
96 96 Dynamic Arraytm Ifc, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotype/us10227624-224-11-10?v=fluidigm
Average 94 stars, based on 1 article reviews
96 96 dynamic arraytm ifc - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

96
Fujirebio Inc innolipa hla typing kit
Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based <t>genotyping.</t> (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.
Innolipa Hla Typing Kit, supplied by Fujirebio Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotype/10__1161_slash_circulationaha__116__022907-900-10-14?v=Fujirebio+Inc
Average 96 stars, based on 1 article reviews
innolipa hla typing kit - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

95
Roche kapa2g fast hotstart pcr kit
Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based <t>genotyping.</t> (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.
Kapa2g Fast Hotstart Pcr Kit, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotype/pm31331770-75-37-42?v=Roche
Average 95 stars, based on 1 article reviews
kapa2g fast hotstart pcr kit - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

Image Search Results


Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based genotyping. (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.

Journal: The FASEB Journal

Article Title: ChREBP ‐β Exacerbates Renal Tubular Disorders Caused by Fructose via ATF4

doi: 10.1096/fj.202600490R

Figure Lengend Snippet: Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based genotyping. (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.

Article Snippet: DNA extraction was performed using the One Step Mouse Genotyping Kit (PD101‐01, Vazyme) according to the manufacturer's instructions.

Techniques: Over Expression, Real-time Polymerase Chain Reaction, TUNEL Assay, Staining