generacer kit Thermo Fisher Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher invitrogen generacer kit
    Invitrogen Generacer Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 185 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/invitrogen generacer kit/product/Thermo Fisher
    Average 93 stars, based on 185 article reviews
    Price from $9.99 to $1999.99
    invitrogen generacer kit - by Bioz Stars, 2020-01
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher generacer kit
    Generacer Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 5532 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/generacer kit/product/Thermo Fisher
    Average 99 stars, based on 5532 article reviews
    Price from $9.99 to $1999.99
    generacer kit - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    78
    Thermo Fisher generacker kit
    Generacker Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/generacker kit/product/Thermo Fisher
    Average 78 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    generacker kit - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    79
    Thermo Fisher 5 cgacuggagcacgaggacacugacauggacugaagg aguagaaa3 gene racer kit
    5 Cgacuggagcacgaggacacugacauggacugaagg Aguagaaa3 Gene Racer Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 cgacuggagcacgaggacacugacauggacugaagg aguagaaa3 gene racer kit/product/Thermo Fisher
    Average 79 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    5 cgacuggagcacgaggacacugacauggacugaagg aguagaaa3 gene racer kit - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    80
    Thermo Fisher rlm race generace kit
    Rlm Race Generace Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rlm race generace kit/product/Thermo Fisher
    Average 80 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    rlm race generace kit - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    70
    Thermo Fisher rlm race technique generacer kit
    Rlm Race Technique Generacer Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 70/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rlm race technique generacer kit/product/Thermo Fisher
    Average 70 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rlm race technique generacer kit - by Bioz Stars, 2020-01
    70/100 stars
      Buy from Supplier

    99
    Thermo Fisher oligo dt primer
    Oligo Dt Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 12988 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primer/product/Thermo Fisher
    Average 99 stars, based on 12988 article reviews
    Price from $9.99 to $1999.99
    oligo dt primer - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher cdna ends
    Cdna Ends, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 6862 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna ends/product/Thermo Fisher
    Average 99 stars, based on 6862 article reviews
    Price from $9.99 to $1999.99
    cdna ends - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher sybr green pcr master mix
    Sybr Green Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 74456 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr green pcr master mix/product/Thermo Fisher
    Average 99 stars, based on 74456 article reviews
    Price from $9.99 to $1999.99
    sybr green pcr master mix - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    N/A
    Run your ion chromatography IC gradient separations as easily as isocratic applications with stable electrolytic generation of high purity eluent to your Thermo Scientific Dionex ICS 6000 Reagent Free HPIC
      Buy from Supplier

    N/A
    Run gradient separations as easily as isocratic applications Add stable electrolytic generation of high purity eluent to your Thermo Scientific Dionex ICS 5000 Reagent Free HPIC System with the Dionex
      Buy from Supplier

    N/A
    Run gradient separations as easily as isocratic applications Add stable electrolytic generation of high purity eluent to your Thermo Scientific Dionex ICS 5000 Reagent Free HPIC System with the Dionex
      Buy from Supplier

    N/A
    Run your ion chromatography IC gradient separations as easily as isocratic applications with stable electrolytic generation of high purity eluent to your Thermo Scientific Dionex ICS 6000 Reagent Free HPIC
      Buy from Supplier

    Image Search Results