|
Thermo Fisher
assay id rn00561037 taqman gene expression assay fam actb thermo fisher Assay Id Rn00561037 Taqman Gene Expression Assay Fam Actb Thermo Fisher, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene/pm41903547-236-176-185?v=Thermo+Fisher Average 94 stars, based on 1 article reviews
assay id rn00561037 taqman gene expression assay fam actb thermo fisher - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
10X Genomics
single cell Single Cell, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene/pmc10966806-331-19-17?v=10X+Genomics Average 86 stars, based on 1 article reviews
single cell - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Astellas
astellas gene therapies Astellas Gene Therapies, supplied by Astellas, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene/10__1016_slash_s1474___4422_ascii40_23_ascii41_00313___7-281-102-102?v=Astellas Average 86 stars, based on 1 article reviews
astellas gene therapies - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Eurofins
gene desert region fw tttcctgcctctgcctttta eurofins gene desert region rv Gene Desert Region Fw Tttcctgcctctgcctttta Eurofins Gene Desert Region Rv, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene/pm40460200-785-203-202?v=Eurofins Average 86 stars, based on 1 article reviews
gene desert region fw tttcctgcctctgcctttta eurofins gene desert region rv - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Galectin Therapeutics
gene Gene, supplied by Galectin Therapeutics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene/us12516348-46-267-270?v=Galectin+Therapeutics Average 86 stars, based on 1 article reviews
gene - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp loc538751 bt03271012 m1 Gene Exp Loc538751 Bt03271012 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene/pmc13062881-15-6--1?v=Thermo+Fisher Average 94 stars, based on 1 article reviews
gene exp loc538751 bt03271012 m1 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp tbl1x hs00959540 m1 Gene Exp Tbl1x Hs00959540 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene/pm42020373-354-52--1?v=Thermo+Fisher Average 94 stars, based on 1 article reviews
gene exp tbl1x hs00959540 m1 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp pdp1 rn01437077 m1 ![]() Gene Exp Pdp1 Rn01437077 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene/bio_rxiv__64898__2026__03__16__710895-79-63-15?v=Thermo+Fisher Average 94 stars, based on 1 article reviews
gene exp pdp1 rn01437077 m1 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp hla f hs01587837 g1 ![]() Gene Exp Hla F Hs01587837 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene/pmc13083945-26-6-2?v=Thermo+Fisher Average 94 stars, based on 1 article reviews
gene exp hla f hs01587837 g1 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp kcnt1 rn00573091 m1 ![]() Gene Exp Kcnt1 Rn00573091 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene/pmc13099374-289-37-23?v=Thermo+Fisher Average 94 stars, based on 1 article reviews
gene exp kcnt1 rn00573091 m1 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp gm13629 mm01277751 m1 ![]() Gene Exp Gm13629 Mm01277751 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene/pm41991614-96-23-15?v=Thermo+Fisher Average 94 stars, based on 1 article reviews
gene exp gm13629 mm01277751 m1 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp krt18p59 hs05026845 m1 ![]() Gene Exp Krt18p59 Hs05026845 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gene/pm39282818-446-17--1?v=Thermo+Fisher Average 93 stars, based on 1 article reviews
gene exp krt18p59 hs05026845 m1 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: bioRxiv
Article Title: Cardiac REDD1 alters glucose and fatty acid metabolic gene expression via an mTORC1-independent, PPARα-dependent mechanism and drives hypertrophic growth
doi: 10.64898/2026.03.16.710895
Figure Lengend Snippet: A-D. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested and subjected to total RNA extraction and qPCR for the indicated genes. (A-B) n=9,11 ( Redd1) , n=12,12 ( Pdk1, Pdk2, Pdp1 ), n=10,12 ( Pdk3 ), and n=11,12 ( Pdk4, Pdp2 ), unpaired t test, 2-way ANOVA. (C-D) n=3,3,3,4 ( Redd1, Pdk1, Pdk2, Pdk3, Pdp1, Pdp2 ) and n=3,3,3,3 ( Pdk4 ), 1-way ANOVA, 2-way ANOVA. E-J. Hearts of adult (8-14-week-old) male and female mice of the indicated genotypes were harvested, lysed, and subjected to western blotting with the indicated antibodies. Signals were quantified with densitometry, normalized to total PDH, and plotted. (E-G) n=10,19 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. (H-J) n=5,6 (pPDH (Ser293), pPDH (Ser300)), unpaired t test. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. M = marker.
Article Snippet: 2 μg RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (
Techniques: RNA Extraction, Western Blot, Marker
Journal: Nature Medicine
Article Title: Antisense oligonucleotide-mediated knockdown therapy in two infants with severe KCNT1 epileptic encephalopathy
doi: 10.1038/s41591-026-04314-9
Figure Lengend Snippet: a , ASO development process and candidate leads mapped on a KCNT1 mRNA transcript. Iterative screening, concentration-response curve studies and in vivo evaluations yielded the final clinical lead ASO. KT717/KT717ps, KT718/KT718ps and KT777/KT777ps are non-allele-specific ASOs targeting sequences in exon 11, exon 11 and the exon 7–8 junction, respectively. KT707 was an allele-specific ASO designed to overlap and preferentially bind the mutant c.1421G>A allele. ASO sequences and control ASOs are shown in Extended Data Table . Tested sequences included versions with full phosphorothioate backbones (for example, KT707ps, KT717ps, KT718ps, KT777ps) and versions with mixed phosphorothioate and phosphodiester backbones (for example, KT707, KT717, KT718, KT777). b , Initial ASO screens in human neuroblastoma cells (BE(2)-M17 cells) via lipofection at 100 nM. Treatment groups (KT707ps, n = 3; KT717ps, n = 3; KT718ps, n = 3; KT777ps n = 2) significantly reduced KCNT1 mRNA levels compared with untreated samples (untreated versus KT707ps, P = 0.0005; untreated versus KT717ps, P < 0.0001; untreated versus KT718ps, P = 0.0002; untreated versus KT777ps, P = 0.0081). No significant differences were observed among the four treatment groups (untreated, n = 7; control ASO1, n = 4). c , Initial ASO screens in patient iPSC-derived neurons via lipofection ( n = 2 for control, KT718ps, KT777ps; n = 4 for KT717ps; n = 1 for KT707). d , Dose–response curves in patient iPSC neurons via lipofection for KT777 (mixed phosphodiester and phosphorothioate backbone; purple) and KT777ps (full phosphorothioate backbone; red) ( n = 2 except n = 1 for KT777 at 10–300-nM doses). e , f , Characterization of effects of lead ASO (KT777) administration to patient iPSC-derived neurons via 2 weeks of treatment at 10 µM by gymnotic delivery, showing significant decreases in KCNT1 mRNA levels (untreated, n = 3; control ASO 2, n = 4; KT777, n = 2; untreated versus KT777, P = 0.0006; KT777 versus control ASO 2, P = 0.0347) ( e ) and KCNT1 protein levels (control ASO 2, n = 5; KT777, n = 4; control ASO 2 versus KT777, P = 0.0337) ( f ). g , Volcano plot of differential gene expression in naive versus KT777-treated human neurons treated via gymnosis at DIV 22 and collected at DIV 29. Dashed lines indicate significance thresholds ( P adj ≤ 0.05, log 2 (FC) > |0.25|); significantly upregulated and downregulated genes are indicated;the top five significantly upregulated and downregulated genes are labeled (Wald test P value, Benjamini–Hochberg adjusted). In b – f , results represent the mean with s.d., two to six biological replicates per experiment and one or two technical replicates per biological replicate. In all panels, * P < 0.05, ** P < 0.01 and *** P < 0.001 (one-way ANOVA with Dunnett’s multiple comparisons test in b and e ; two-tailed unpaired t -test in f ).
Article Snippet: KCNT1 mRNA expression analysis was performed via quantitative real-time PCR (qPCR) using the QuantStudio 3 Real-Time PCR System and TaqMan probes purchased from
Techniques: Concentration Assay, In Vivo, Mutagenesis, Control, Derivative Assay, Gene Expression, Labeling, Two Tailed Test
Journal: Nature Medicine
Article Title: Antisense oligonucleotide-mediated knockdown therapy in two infants with severe KCNT1 epileptic encephalopathy
doi: 10.1038/s41591-026-04314-9
Figure Lengend Snippet: a , b , Treatment of BE(2)-M17 cells with KT717ps results in significant reduction of KCNT1 transcripts ( a ) and proteins ( b ) after 4 days incubation of 100 nM ASO via lipofection. Untreated n = 4, others n = 2, Untreated vs. KT717ps p < 0.0001, KT717ps vs. Control ASO 1 p < 0.0001 in ( a ), n = 3, p = 0.0285 in ( b ). c , Treatment of wild-type iPSC-derived neurons with KCNT1 -targeting ASOs via lipofection (100 nM) results in significant KCNT1 knockdown. KT707ps n = 1, KT717ps n = 4, KT718ps n = 2, others n = 4. p < 0.0001. d , Treatment of patient iPSC-derived neurons with ASOs employing mixed phosphorothioate/phosphodiester backbones via lipofection (100 nM). Untreated, Control ASO 2, KT707 n = 4, KT717 n = 3, KT718, KT777ps, KT777 n = 2. p < 0.0001. e , Treating BE(2)-M17 cells with ASOs via gymnotic delivery at 10 µM results in significant reduction of KCNT1 mRNA levels in lead ASOs (KT777ps and KT777). Untreated n = 11, Control ASO 2 n = 7, KT777ps, KT777 n = 5, KT717ps n = 2, KT718 n = 5. Untreated vs. KT777ps p = 0.0418, Untreated vs. KT777 p = 0.0054. f , Treating patient iPSC-derived neurons with KT777 for one week by gymnosis at 10 µM reduces KCNT1 mRNA levels. Control ASO 2 ps n = 5, others n = 6. Untreated vs. KT777 p < 0.0001, Control ASO 2 vs. KT777 p = 0.0436. In ( a )-( f ), results represent mean with SD, average of 2-3 biological replicates per experiment, 1-2 technical replicates per biological replicate. In all panels, *p < 0.05, **p < 0.01, and ***p < 0.001 (one-way ANOVA with Dunnett’s multiple comparisons test).
Article Snippet: KCNT1 mRNA expression analysis was performed via quantitative real-time PCR (qPCR) using the QuantStudio 3 Real-Time PCR System and TaqMan probes purchased from
Techniques: Incubation, Control, Derivative Assay, Knockdown
Journal: Nature Medicine
Article Title: Antisense oligonucleotide-mediated knockdown therapy in two infants with severe KCNT1 epileptic encephalopathy
doi: 10.1038/s41591-026-04314-9
Figure Lengend Snippet: a , Dose-response curve of KT777ps in mouse Neuro2a cells. KT777ps was introduced at different doses via lipofection and analyzed in 2 days after treatment. n = 12 for 3 and 300 nM, n = 6 for 10 and 30 nM. b , Measurement of mouse Kcnt1 levels in the cortex, hippocampus and spinal code in mice 14 days (black symbols) or 28 days (green symbols) after ICV injection with KT777ps. (n = 3, respectively). c , d , Measurement of mouse Kcnt1 levels ( c ) or human KCNT1 levels ( d ) in the cortex of human KCNT1 (h KCNT1 )-expressing transgenic mice, 10-11 days after injection with vehicle, control ASO, and KT777ps. Untreated n = 7, control ASO 100 µg n = 2, KT777ps 100 µg n = 3, 500 µg n = 3, respectively. p < 0.0001 in ( c ), p = 0.0321 in ( d ). e-g , Single administration of KT777 at 200 µg ( e ) 1,000 µg ( f ), and 2,000 µg ( g ) demonstrated the broad distribution of KT777 in rat brains (temporal lobe and SC cervical n = 4, SC lumber n = 2, others n = 5 in ( e ), basal ganglia n = 3, SC cervical n = 4, others n = 5 in ( f ), n = 5 in ( g ). h , Plasma concentration of KT777 after dosing in wild-type rats (200 µg dose 2 h and 6 h n = 5, 24 h n = 4, 15 days n = 2, 1000 µg dose n = 5, 2000 µg dose 2 h n = 4, others n = 5). i-k , Tissue levels of KT777 in different brain and spinal cord regions of wild-type rats receiving repeat (IT) doses of KT777 at 200 µg x5 (sacrificed on Day 115) ( i ), 200 µg x5 (sacrificed on Day 155) ( j ), or 800 µg x5 (sacrificed on Day 115) ( k ). Doses were delivered on Days 1, 15, 29, 43, and 99 ( i - k ). ( i ) n = 18, ( j ) Basal ganglia n = 3, others n = 8, ( k ) n = 14. l , Kcnt1 knockdown in wild-type rat brain after repeat (50, 200, or 800 µg x5) IT administration of KT777. KT777 200 μg Female n = 2, others n = 3. Untreated Female vs. KT777 50 μg Female p = 0.0253, Untreated Female vs. KT777 800 μg Female p = 0.0016, Untreated Male vs. KT777 800 μg Male p = 0.0378. In all panels, Data are presented as mean values ± SEM, *p < 0.05, **p < 0.01, and ***p < 0.001, comparing treatment groups from samples tested by control ASOs (one-way ANOVA with Dunnett’s multiple comparisons test). Injection protocols are shown at the top with dosing days (red bars) and analysis points (blue arrows).
Article Snippet: KCNT1 mRNA expression analysis was performed via quantitative real-time PCR (qPCR) using the QuantStudio 3 Real-Time PCR System and TaqMan probes purchased from
Techniques: Injection, Expressing, Transgenic Assay, Control, Clinical Proteomics, Concentration Assay, Knockdown
Journal: Nature Medicine
Article Title: Antisense oligonucleotide-mediated knockdown therapy in two infants with severe KCNT1 epileptic encephalopathy
doi: 10.1038/s41591-026-04314-9
Figure Lengend Snippet: a , b , Measurement of levels of mouse Kcnt1 ( a ) or human KCNT1 ( b ) in the cortex of human KCNT1 (h KCNT1 )-expressing mice, 10–11 days after injection with vehicle (untreated), control ASO and KT777. Asterisks denote significant changes from the ASO control (control ASO 4 100 μg versus KT777 500 μg, P = 0.0003, and control ASO 4 100 μg versus KT777 1,000 μg, P ≤ 0.0001, in a ; control ASO 4 100 μg versus KT777 500 μg, P = 0.0077, and control ASO 4 100 μg versus KT777 1,000 μg, P = 0.0031, in b ). Untreated n = 7; control ASO 100 µg n = 2; KT777 100 µg n = 3, 500 µg n = 4 and 1,000 µg n = 2. c , d , IT administration of KT777 in WT rats. Injection protocols are shown at the top with dosing days (red bars) and analysis points (blue arrows). Single administration of KT777 at 200 µg and 2,000 µg ( c ) elicits reduction of Kcnt1 levels in the rat frontal cortex at 14 days postinjection (untreated versus 200 μg P = 0.0184). KT777 was robustly detected in CSF 14 days after dose. n = 4 except for n = 3 for KT777 CSF concentration at 200 µg. Repeat dosing of KT777 at 800 µg ( d ) leads to a significant decrease of Kcnt1 in the rat frontal cortex at 115 days (untreated versus 800 μg, P < 0.0001). Untreated n = 6, 50 µg n = 6, 200 µg n = 5 and 800 µg n = 6. KT777 was detected in a dose-dependent manner in CSF. 50 µg n = 3, 200 µg n = 13 and 800 µg n = 12. e , Treatment with KT777ps improves life expectancy in Kcnt1 P905L (L/L ) mice. P905L (L/L ) mice were dosed with KT777ps at 100 µg once (1× KT777ps, n = 5) or twice (2× KT777ps, n = 11). Times of dosing were P31–35 for the first dose and P149–164 for the second dose. Four mice not recovering from the first administration surgery were excluded. Five mice that received a single dose of KT777ps died at 1 day, 75 days, 75 days, 86 days and 169 days postinjection, respectively. The survival curve of untreated mice was obtained from previous data . f , Nest building scores of Kcnt1 P905L (L/L ) mice improved after treatment with KT777ps (100 μg ICV, ‘Post’, n = 4) compared with the untreated condition (‘Pre’, n = 4). Symbols are 48-h values after the initiation of the nest-building experiment for each mouse. Four mice that survived until 2 weeks after administration of KT777ps were reassessed for nest building. The mean nest building score after treatment was significantly improved from the untreated condition ( P < 0.01). Horizontal lines represent the mean for each group ( n = 4). For panels a – d , data are presented as mean values ± s.e.m. * P < 0.05, ** P < 0.01 and *** P < 0.001, comparing treatment groups from samples tested by control ASOs or untreated samples (one-way ANOVA with Dunnett’s multiple comparisons test). For panel f , data are presented as mean values. ** P < 0.01, from the pretreatment baseline (two-tailed Mann–Whitney U test). tg, transgenic; conc., concentration; D, day.
Article Snippet: KCNT1 mRNA expression analysis was performed via quantitative real-time PCR (qPCR) using the QuantStudio 3 Real-Time PCR System and TaqMan probes purchased from
Techniques: Expressing, Injection, Control, Concentration Assay, Two Tailed Test, MANN-WHITNEY, Transgenic Assay