Journal: iScience

Article Title: CDK7 is a novel therapeutic target in fibrolamellar carcinoma

doi: 10.1016/j.isci.2025.113925

Figure Lengend Snippet: Generation of a model to understand pathogenic mechanisms of DNAJB1-PRKACA in FLC (A) Parent hepatoblastoma cells (HepG2) were transfected with a dual-guide RNA-CAS9 plasmid containing an eGFP tag, to allow for cell sorting of HepG2 cells that took up the plasmid. Each cell was deposited in a single well of a 96-well plate and clonally expanded. The guide RNAs (gRNA1: CAGGAGCCGACCCCGTTCGT, gRNA2: GTAGACGCGGTTGCGCTAAG) directed CAS9 to induce a double-strand break at intron 1 of DNAJB1 and intron 1 of PRKACA , resulting in 400 kb deletion and chromosomal rearrangement to generate the DNAJB1-PRKACA oncogene fusion. (B) After expansion, genomic DNA from each clone was assessed via PCR for presence of DNAJB1-PRKACA gene fusion and six clones manifested appropriately sized PCR products (DNA bands) pertaining to the forward and reverse primers across the breakpoint. (C) The PCR product from each clone and DNAJB1-PRKACA mRNA transcript (across the breakpoint) was sequenced to determine the precise sequence by CRISPR gene editing. (D) Assessment of expression levels of native genes DNAJB1 and PRKACA (light bars), as well as FLC-specific genes including DNAJB1-PRKACA fusion, SLC16A14 , and LINC00473 (dark bars) was performed. Shown is relative fold-change (error bars represent standard deviation) compared to parent HepG2 cells, with four biological replicates per clone. (E) Clone samples and parent HepG2 cells were also evaluated for generation of fusion oncoprotein (DNAJ-PKAc) and native PKA (β-Actin control). Clone selection for subsequent assays was based on these rigorous validation metrics (A–E) yielding H33 (red arrow) and H12 (purple arrow) as the selected clones.

Article Snippet: qPCR Assays (Assay ID: DNAJB1: Hs00356730_g1, DNAJB1-PRKACA fusion: Hs05061318_ft, SLC16A14: Hs00541300_m1, LINC00473: Hs00293257_m1, VCAN: Hs00171642_m1, OAT: Hs00236852_m1, GAPDH: Hs02786624_g1, β-Actin: Hs01060665_g1) , Applied Biosystems , https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays.html.

Techniques: Transfection, Plasmid Preparation, FACS, Clone Assay, Sequencing, CRISPR, Expressing, Standard Deviation, Control, Selection, Biomarker Discovery

Journal: iScience

Article Title: CDK7 is a novel therapeutic target in fibrolamellar carcinoma

doi: 10.1016/j.isci.2025.113925

Figure Lengend Snippet: CDK7 regulation of RNA Polymerase II phosphorylation and super-enhancer gene expression (A) Protein analysis for phosphorylated RNA polymerase II (serine-2, serine-5, and serine-7), CDK2 and CDK7 was performed and phosphorylation levels were quantified using ImageJ. Shown are two separate biological replicates for each line. Statistically significant differences between HepG2 and H33 are shown ( t test, ∗ p < 0.05). (B) RNA sequencing of HepG2 cells and H33 cells treated at varying doses of SY-5609 for 24 h ( n = 6 biological replicates per group) were evaluated for prominent super-enhancer-associated genes, including SLC16A14 and LINC00473 . Findings from the H33 clone were confirmed in a separate DNAJB1-PRKACA -expressing clone (H12) ( t test, ∗∗ p < 0.01). (C) DNAJB1-PRKACA -expressing H33 cells were treated with a selective CDK7 inhibitor, SY5609 (100 nM, 1 μM, and 10 μM), or DMSO control (0) for 24 h ( n = 3 biological replicates per group, two representative images shown per group for western blot). Known substrate targets of CDK7 were assessed including RNA Pol II CTD (Ser 2, 5, and 7), Thr160 phosphorylated CDK2 (pCDK2) and Thr170 phosphorylated CDK7 (pCDK7) ( t test, ∗ p < 0.05). (D and E) To assess for CDK7-dependent expression of FLC-specific genes, H33 cells were treated with SY-5609 (1–300 nM) for 24 h and levels of mRNA expression (RT-qPCR) versus DMSO control were evaluated, including SLC16A14 and LINC00473 . This was repeated with a separate covalent-binding selective and specific CDK7 inhibitor (YKL-5-124). Shown are three biological replicates per drug dose per mRNA with statistical significance denoted as compared to DMSO control ( t test, ∗ p < 0.05, ∗∗ p < 0.01).

Article Snippet: qPCR Assays (Assay ID: DNAJB1: Hs00356730_g1, DNAJB1-PRKACA fusion: Hs05061318_ft, SLC16A14: Hs00541300_m1, LINC00473: Hs00293257_m1, VCAN: Hs00171642_m1, OAT: Hs00236852_m1, GAPDH: Hs02786624_g1, β-Actin: Hs01060665_g1) , Applied Biosystems , https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays.html.

Techniques: Phospho-proteomics, Gene Expression, RNA Sequencing, Expressing, Control, Western Blot, Quantitative RT-PCR, Binding Assay

Journal: iScience

Article Title: CDK7 is a novel therapeutic target in fibrolamellar carcinoma

doi: 10.1016/j.isci.2025.113925

Figure Lengend Snippet: CDK7 is a novel therapeutic target in DNAJB1-PRKACA-expressing cells (A) To assess for CDK7 effect on cell viability, HepG2 cells and H33 cells underwent 48-h drug treatment with either SY5609 (1 pM–5 μM) or YKL-5-124 (100 pM–10 μM). Percent viability was determined by normalizing to control (DMSO treated). To confirm the findings in the DNAJB1-PRKACA -expressing H33 cells, a separate clone (H12) was tested with the same drugs over the same dose range. In each figure, the LC 50 (IC 50 ) is represented by the straight line. (B) HepG2 cells and H33 cells were synchronized and treated with either DMSO or SY5609 (1 μm) for 24 h. Percent of cells in G0/G1, S, and G2/M were determined by flow cytometry. Shown are four biological replicates per cell line per treatment ( t test, ∗ p = 0.001, ∗∗ p < 0.0001). (C) HepG2 cells and H33 cells were treated with DMSO (control) or increasing doses of SY5609 for 24 h and caspase 3/7 activity measured. To confirm the increased apoptotic activity in the H33 cells, a separate clone (H12) was utilized. ( t test ∗ p < 0.0001, for H33 vs. HepG2 and H12 vs. HepG2). (D) To validate the results, PARP and cleaved-PARP (marker for apoptosis) protein were evaluated in HepG2 and H33 cells, using two separate antibodies that either recognize both PARP and cleaved-PARP (top bands) or only cleaved-PARP alone (bottom band). (E) Primary human hepatocytes (PHHs) isolated fresh from human donor liver transplant specimens and H33 cells were treated with DMSO, SY5609 100 nM, or SY5609 1 μM for 24 and 48 h. The percent of viable cells was determined by normalizing to DMSO control. There were four biological replicates per group per time/treatment dose ( t test ∗ p = 0.02, ∗∗ p = 0.01, ∗∗∗ p < 0.0001). (F) PHHs and H33 cells were treated with SY5609 (100 pM–5 μM) for 48, 72, or 120 h and percent viability assessed, normalized to DMSO control. The LC 50 (IC 50 ) is demarcated by the solid line. There were four biological replicates for each drug dose at each time point for each line (PHH and H33).

Article Snippet: qPCR Assays (Assay ID: DNAJB1: Hs00356730_g1, DNAJB1-PRKACA fusion: Hs05061318_ft, SLC16A14: Hs00541300_m1, LINC00473: Hs00293257_m1, VCAN: Hs00171642_m1, OAT: Hs00236852_m1, GAPDH: Hs02786624_g1, β-Actin: Hs01060665_g1) , Applied Biosystems , https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays.html.

Techniques: Expressing, Control, Flow Cytometry, Activity Assay, Marker, Isolation

Journal: iScience

Article Title: CDK7 is a novel therapeutic target in fibrolamellar carcinoma

doi: 10.1016/j.isci.2025.113925

Figure Lengend Snippet: Synergistic combination between CDK7 and CDK9 inhibition in vitro (A) DNAJB1-PRKACA expressing H33 cells were treated with SY-5609 alone, VIP-152 alone, or in combination for 24 h. Protein was isolated and western blot performed for measurement and quantification of phosphorylated RPB-1 (Ser 2, 5, and 7) ( n = 3 biological replicates per group, two representative western blots are shown, t test, ∗ p < 0.05). (B) Expression of SLC16A14 and LINC00473 was determined in H33 cells treated with SY-5609 alone (blue), VIP-152 alone (purple), or in combination (green). Statistical significance is denoted as compared to control ( t test, ∗∗ p < 0.01, ∗ p < 0.05). (C and D) Synergistic response to combination therapy of SY-5609 and VIP-152 in H33 cells was determined with potent reduction in percent survival (normalized to DMSO control). Depicted is a dose-response curve which demonstrates shift of the curve to the left for SY-5609 with increasing concentration of VIP-152 up to a dose of 30 nM VIP-152. The drug combination showed strong synergy using all metrics including HSA (mean 18.73, p = 6.31e-5), Bliss (mean 14.55, p = 3.46e-4), Loewe (mean 15.48, p = 1.98e-4), and ZIP (mean 13.54, p = 6.04e-4). The strongest synergistic doses occurred at 30 nM SY-5609 + 30 nM VIP152 (synergy score ∼38) and 10 nM SY-5609 + 30 nM VIP152 (synergy score ∼37).

Article Snippet: qPCR Assays (Assay ID: DNAJB1: Hs00356730_g1, DNAJB1-PRKACA fusion: Hs05061318_ft, SLC16A14: Hs00541300_m1, LINC00473: Hs00293257_m1, VCAN: Hs00171642_m1, OAT: Hs00236852_m1, GAPDH: Hs02786624_g1, β-Actin: Hs01060665_g1) , Applied Biosystems , https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays.html.

Techniques: Inhibition, In Vitro, Expressing, Isolation, Western Blot, Control, Concentration Assay

Journal: Molecular and Cellular Biology

Article Title: Tumor Necrosis Factor Alpha Regulates Skeletal Myogenesis by Inhibiting SP1 Interaction with cis -Acting Regulatory Elements within the Fbxl2 Gene Promoter

doi: 10.1128/MCB.00040-20

Figure Lengend Snippet: FBXL2 is a marker of myogenic differentiation. (A and B) C2C12 myoblasts were imaged by confocal microscopy in the presence or absence of TNF-α treatment (A), and the parameters of cellular proliferation and morphology were quantitated and shown graphically (B). Total nuclei, myotube morphology, and the nuclear fusion index were objectively quantified using the thresholding function in Fiji. A minimum of 5 random fields in each treatment group were acquired for analysis. Scale bars = 100 μm. (C and D) Cell lysates from C2C12 cells were obtained at day 5 of differentiation in the presence or absence of TNF-α stimulation and immunoblotted for protein expression (C), and band intensity was quantitated and graphed (D). (E) Changes in levels of Fbxl2, Fbxo3, and Traf6 mRNA expression were quantified by real-time qPCR during myogenic differentiation of C2C12 myoblasts under control conditions and with TNF-α treatment at 0, 24, 72, and 120 h. (F and G) Dose response effects of TNF-α stimulation on FBXO3, FBXL2, TRAF6, and MyoG protein levels (F), with band intensities quantitated by densitometry shown graphically (G). The data from each quantitated bar graph are representative of the results of at least three independent experiments. The P values shown represent the significance of trend analysis over time or concentrations as analyzed by ANOVA. Densitometry data are shown as mean and standard error of the mean (SEM). The box plot extends from the 25th to the 75th centile, and the whiskers extend from the minimum value to the maximum.

Article Snippet: A 4-kb DNA sequence spanning 3 kb upstream and 1 kb downstream from the transcriptional start site of the Fbxl2 gene was amplified from mouse C57BL/6J genomic DNA (Zyagen, San Diego, CA) by a PCR-based approach using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA).

Techniques: Marker, Confocal Microscopy, Expressing

Journal: Molecular and Cellular Biology

Article Title: Tumor Necrosis Factor Alpha Regulates Skeletal Myogenesis by Inhibiting SP1 Interaction with cis -Acting Regulatory Elements within the Fbxl2 Gene Promoter

doi: 10.1128/MCB.00040-20

Figure Lengend Snippet: JNK-mediated phosphorylation of SP1 inhibits Fbxl2 transcriptional activity in response to TNF-α. (A) Expression of total and phosphorylated JNK, ERK1/2, p38, and AKT with and without TNF-α treatment in C2C12 cells. (B) Protein densitometry was quantitated and graphed. The P values shown represent significance as indicated by the brackets between bars or that of trend analysis over time as analyzed by ANOVA. (C) Fbxl2 promoter-reporter activity in C2C12 cells treated with chemical inhibitors of JNK, ERK1/2, and p38 (1 to 10 μM) for 24 h. (D) Fbxl2 promoter-reporter activity in C2C12 cells after knockdown of JNK with siRNA for 48 h. (E) Fbxl2 promoter-reporter activity in C2C12 cells pretreated with the JNK inhibitor SP600125 (1 μM) 30 min prior to TNF-α treatment. Cells were harvested at 48 h posttreatment. (F) Fbxl2 promoter-reporter activity in HEK cells transfected with SP1 plasmids encoding phosphorylation-deficient mutants (T278A and T739A) or phosphorylation mimics (T278D and T739D) for 48 h. (G) C2C12 cells were transfected with plasmids expressing V5-tagged SP1. The cells were fixed and sonicated, and DNA was immunoprecipitated with isotype control (IgG), V5, or STAT-1 antibodies. (Left) Relative enrichment of the Fbxl2 promoter was quantified by qPCR. (Right) Agarose gel of a 193-bp region of the Fbxl2 core promoter amplified by PCR. (H) C2C12 cells were transfected with plasmids expressing V5-tagged SP1 wild type (Wt), SP1-T739A, and SP1-T739D for 48 h. The cells were fixed and sonicated, and DNA was immunoprecipitated (IP) with V5 antibody. (Left) Relative enrichment of the Fbxl2 promoter was quantified by qPCR. (Right) Agarose gel of the 193-bp region of the Fbxl2 core promoter amplified by PCR. ns, not significant (P > 0.05); *, P < 0.05; **, P < 0.01; ***, P < 0.001 by ANOVA. The data are shown as means and SEM.

Article Snippet: A 4-kb DNA sequence spanning 3 kb upstream and 1 kb downstream from the transcriptional start site of the Fbxl2 gene was amplified from mouse C57BL/6J genomic DNA (Zyagen, San Diego, CA) by a PCR-based approach using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA).

Techniques: Activity Assay, Expressing, Transfection, Sonication, Immunoprecipitation, Agarose Gel Electrophoresis, Amplification

Journal: Molecular and Cellular Biology

Article Title: Tumor Necrosis Factor Alpha Regulates Skeletal Myogenesis by Inhibiting SP1 Interaction with cis -Acting Regulatory Elements within the Fbxl2 Gene Promoter

doi: 10.1128/MCB.00040-20

Figure Lengend Snippet: Fbxl2 expression is upregulated during primary human myofibroblast differentiation. (A) Primary human myoblasts were isolated from the vastus lateralis muscles of heathy volunteers and differentiated for up to 5 days under control conditions or in the presence of TNF-α, and the morphological characteristics were evaluated by confocal microscopy (scale bars = 100 μm). (B) TNF-α stimulation (10 ng/ml) resulted in increased cellular proliferation as assessed by numbers of nuclei per field and complete abrogation of myogenic differentiation as evident from absence of MyH expression and myotube formation. The data were quantitated, and the results are shown graphically. (C and D) Cell lysates were obtained at the indicated time points and immunoblotted for FBXO3, FBXL2, TRAF6, and MyoG protein expression (C), with band intensities quantitated and graphed (D). (E and F) The dose response effect of TNF-α stimulation on MyH, FBXO3, FBXL2, TRAF6, and MyoG protein expression was evaluated (E), with band intensities quantitated and graphed (F). (G) Primary human myotubes differentiated for 3 days demonstrating upregulation of FBXL2 expression and colocalization restricted to MyoG-expressing cells (scale bars = 100 μm). The data from each quantitated bar graph are representative of the results of at least three independent experiments. ns, not significant (P > 0.05); *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001 by ANOVA. The data are shown as means and SEM. The box plot extends from the 25th to the 75th centile, and the whiskers extend from the minimum value to the maximum.

Article Snippet: A 4-kb DNA sequence spanning 3 kb upstream and 1 kb downstream from the transcriptional start site of the Fbxl2 gene was amplified from mouse C57BL/6J genomic DNA (Zyagen, San Diego, CA) by a PCR-based approach using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA).

Techniques: Expressing, Isolation, Confocal Microscopy

Journal: Molecular and Cellular Biology

Article Title: Tumor Necrosis Factor Alpha Regulates Skeletal Myogenesis by Inhibiting SP1 Interaction with cis -Acting Regulatory Elements within the Fbxl2 Gene Promoter

doi: 10.1128/MCB.00040-20

Figure Lengend Snippet: Depletion of endogenous Fbxl2 promotes myoblast proliferation. C2C12 cells were seeded at a density of 5 × 104/ml and transfected at 60% confluence with 40 pM negative-control RNA or Fbxl2 siRNA in 6-well plates. The cells were induced to differentiate in control medium or treated with 10 μM TNF-α. Cellular lysates were prepared at confluence (proliferation) and at 48 h postinduction of differentiation (control). (A) Heat map visualization of the top 500 DEGs between control and Fbxl2 siRNA stimulation and TNF-α. (B) Panther pathway analysis following gene set enrichment demonstrating common enrichment of genes involved in growth factor and inflammatory signaling following Fbxl2 knockdown and TNF-α stimulation. Significantly differentially expressed genes were determined by filtering at a threshold defined by a minimum absolute change of 1.5-fold and a false-discovery rate P value of <0.05. (C) To assess the effect of Fbxl2 gene silencing on cellular proliferation, live cells were counted 48 h after differentiation using trypan blue exclusion staining or pulsed with BrdU for 2 h, fixed, and permeabilized after DNA hydrolysis. Images were captured on a confocal microscope after nuclear staining with BrdU antibody and counterstaining with DAPI (scale bar = 100 μm). (D) Total nuclei and BrdU-stained nuclei were objectively quantified using the thresholding function in Fiji from a minimum of 5 random fields. (E and G) Lysates were prepared from control RNA (Con) or Fbxl2 siRNA 48 h after differentiation and immunoblotted for FBXL2, FBXO3, TRAF6, cyclin D1, cyclin D2, calmodulin (CaM), and cyclin E protein expression (E), with band intensities quantitated and graphed (G). NC, nontargeting control RNA. (F and H) Fbxl2 gene silencing increased total and phosphorylated forms of p38-MAPK, NF-κB, JNK, and ERK1/2 protein expression (F), with band intensities quantitated and graphed (H). (G and H) Data from each quantitated bar graph are representative of the results of at least three independent experiments. ns, not significant (P > 0.05); *, P < 0.05; **, P < 0.01; ****, P < 0.0001 by ANOVA. The data are shown as means and SEM. The box plot extends from the 25th to the 75th centile, and the whiskers extend from the minimum value to the maximum.

Article Snippet: A 4-kb DNA sequence spanning 3 kb upstream and 1 kb downstream from the transcriptional start site of the Fbxl2 gene was amplified from mouse C57BL/6J genomic DNA (Zyagen, San Diego, CA) by a PCR-based approach using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA).

Techniques: Transfection, Negative Control, Staining, Microscopy, Expressing

Journal: Molecular and Cellular Biology

Article Title: Tumor Necrosis Factor Alpha Regulates Skeletal Myogenesis by Inhibiting SP1 Interaction with cis -Acting Regulatory Elements within the Fbxl2 Gene Promoter

doi: 10.1128/MCB.00040-20

Figure Lengend Snippet: Fbxl2 expression is required for myogenic differentiation. (A) Gene silencing of Fbxl2 was performed in C2C12 cells, and the morphological characteristics of myocyte formation were evaluated at 120 h by immunocytochemistry using confocal microscopy. Scale bars = 100 μm. (B) Total nuclei, the number of myosin-expressing cells, and the average myotube area were objectively quantified using the thresholding function in Fiji; the nuclear fusion index was determined as the percentage of nuclei located within ≥50 myotubes. A minimum of 5 random fields in each treatment group were acquired for analysis. (C) Fbxl2 gene silencing and TNF-α stimulation demonstrating dysregulation of a transcriptomic subset of key myogenic regulator factors that regulate myogenesis in C2C12 cells. (D) Fbxl2 gene silencing decreased protein expression of the transcriptional activators Pax3 and Pax7 and the myogenic regulatory factors MyoD and MyoG. Protein levels of Myf5 and Myf6 were increased as measured at 48 h post-Fbxl2 siRNA transfection. (E) Protein expression with band intensities quantitated and graphed. NC, nontargeting control RNA. (F) Cells were ectopically expressed with wild-type Fbxl2 or an Fbxl2 double point mutant lacking the ability to mediate substrate ubiquitylation (Fbxl2 LP-AA), and effects on myocyte differentiation were assessed by immunoblotting. (G) Protein expression and band intensities were quantitated and graphed. (E and G) Data from each quantitated bar graph shown are representative of the results of at least three independent experiments. ns, not significant (P > 0.05); *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001 by ANOVA. The data are shown as means and SEM. The box plot extends from the 25th to the 75th centile, and the whiskers extend from the minimum value to the maximum.

Article Snippet: A 4-kb DNA sequence spanning 3 kb upstream and 1 kb downstream from the transcriptional start site of the Fbxl2 gene was amplified from mouse C57BL/6J genomic DNA (Zyagen, San Diego, CA) by a PCR-based approach using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA).

Techniques: Expressing, Immunocytochemistry, Confocal Microscopy, Transfection, Mutagenesis, Western Blot

Journal: Molecular and Cellular Biology

Article Title: Tumor Necrosis Factor Alpha Regulates Skeletal Myogenesis by Inhibiting SP1 Interaction with cis -Acting Regulatory Elements within the Fbxl2 Gene Promoter

doi: 10.1128/MCB.00040-20

Figure Lengend Snippet: Identification and characterization of the proximal Fbxl2 promoter. (A) There was no significant difference in Fbxl2 mRNA degradation measured by qPCR at 3, 6, 9, and 12 h under control and TNF-α treatment conditions in an actinomycin D assay. (B) The half-life of Fbxl2 mRNA was estimated as 10.4 h (95% confidence interval [gray lines], 7.6 to 16.3) by linear regression analysis. (C) A 3,000-nucleotide (nt) region was cloned into the PGL3 basic firefly luciferase (Luc) reporter plasmid and then cotransfected into C2C12 cells with a nanoluciferase reporter as a transfection control. The cells were allowed to differentiate for 24 h prior to harvesting and lysis, and luminescence was measured using the NanoLuc dual-reporter assay (Promega). Sequential deletion of the reporter plasmid identified peak activity in the Fbxl2 promoter at nt −200 to +42 proximal to the TSS. (D) Additional deletion analysis of the reporter plasmid in the Fbxl2 promoter at nt −200 to +42 proximal to the TSS. Loss of constitutive reporter activity was identified between nt +160 and +120, with further loss of activity occurring with progressive deletion of the core promoter. Loss of TNF-α responsiveness also occurred between nt +160 and +120 of the TSS. (E) Schematic of a nt +240 to −42 insert within the PGL3 basic reporter construct showing three SP1 motifs proximal to the TSS. (F) Site-directed mutagenesis was performed to evaluate the impact of individual SP1 mutations on Fbxl2 core promoter activity; mutation in each SP1 site (X) resulted in a similar 25-fold loss of reporter activity, yet there was no additional loss of activity when all three SP1 sites were mutated. In the presence of TNF-α, each SP1 mutant plasmid did not show any additional loss of reporter activity, suggesting that SP1 is a TNF-α-responsive cis-acting element within the Fbxl2 promoter. The data are representative of the results of three independent experiments. ns, not significant (P > 0.05); *, P < 0.05. The data are shown as means and SEM.

Article Snippet: A 4-kb DNA sequence spanning 3 kb upstream and 1 kb downstream from the transcriptional start site of the Fbxl2 gene was amplified from mouse C57BL/6J genomic DNA (Zyagen, San Diego, CA) by a PCR-based approach using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA).

Techniques: Clone Assay, Luciferase, Plasmid Preparation, Transfection, Lysis, Reporter Assay, Activity Assay, Construct, Mutagenesis

Journal: Molecular and Cellular Biology

Article Title: Tumor Necrosis Factor Alpha Regulates Skeletal Myogenesis by Inhibiting SP1 Interaction with cis -Acting Regulatory Elements within the Fbxl2 Gene Promoter

doi: 10.1128/MCB.00040-20

Figure Lengend Snippet: SP1 binds to the Fbxl2 promoter region to regulate its gene expression during myogenic differentiation. (A) Sp1 mRNA abundance following knockdown of SP1 in C2C12 cells. (B) Fbxl2 mRNA abundance by qPCR after SP1 silencing at 48 h postdifferentiation. (C) Relative luminescence after SP1 depletion in C2C12 cells overexpressing the +240 to −42 Fbxl2 promoter reporter construct. (D and E) SP1 and FBXL2 protein levels following depletion (D) and overexpression (E) of SP1 in C2C12 cells. The data are representative of the results of three independent experiments. (F) C2C12 lysates were immunoprecipitated with SP1 antibody. The precipitated DNA was amplified using specific primers to the proximal Fbxl2 promoter region and measured by qPCR; values are expressed as percentages of DNA in the SP1 fractions compared to input. Shown is a quantification graph for ChIP assays using qPCR data demonstrating significant SP1 binding to a region including the Fbxl2 promoter under differentiation conditions (**, P = 0.002) but not following TNF-α stimulation. The data are representative of the results of two independent experiments. (G) The 371-bp region of the Fbxl2 core promoter was amplified by PCR from SP1 and input lysates and visualized on an agarose gel. (H) Nuclear extracts were isolated from C2C12 myoblasts during proliferation and differentiation at the indicated time points in the presence or absence of TNF-α stimulation and then incubated with a biotin-labeled 25-nucleotide segment that corresponds to the proximal putative SP1 binding element of the human Fbxl2 and mouse Fbxl2 core promoters. An EMSA demonstrated the formation of two DNA-protein complexes during myogenic differentiation, which was decreased in the presence of TNF-α-stimulated cells. The data are representative of the results of two independent experiments. (I) Nuclear SP1 expression in C2C12 cells after differentiation with and without TNF-α. (Bottom) Protein levels and band intensities were quantitated and graphed as shown. (A to C, F, and I) **, P < 0.01; ***, P < 0.001 by ANOVA. The data are shown as means and SEM.

Article Snippet: A 4-kb DNA sequence spanning 3 kb upstream and 1 kb downstream from the transcriptional start site of the Fbxl2 gene was amplified from mouse C57BL/6J genomic DNA (Zyagen, San Diego, CA) by a PCR-based approach using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA).

Techniques: Expressing, Construct, Over Expression, Immunoprecipitation, Amplification, Binding Assay, Agarose Gel Electrophoresis, Isolation, Incubation, Labeling

Journal: iScience

Article Title: Jchain -diphtheria toxin receptor mice allow for depletion of antibody-secreting cells and analysis of differentiation kinetics

doi: 10.1016/j.isci.2025.113946

Figure Lengend Snippet: Validation of DTR gene expression by ASCs from J-DTR mice (A) Representative flow cytometry pseudocolor plots showing gating of CD19 + CD138 -/LO B cells and CD138 HI CD267(TACI) + ASCs in total spleen or cells purified with STEMCELL Technologies Pan-B and CD138 (ASC) isolation kits. Numbers in plots indicate percentages of gated populations within total live singlets. (B) Quantification of ASC percentages in total spleen or purified cells using Pan-B and ASC isolation kits. (C–E) Relative gene expression of (C) Prdm1 , (D) Jchain , and (E) DTR ( HBEGF ) in cells purified using Pan-B and ASC isolation kits. All values are relative to the expression of Actb . (F) DTR expression normalized to Prdm1 expression in WT and J-DTR ASCs. (G) Jchain expression normalized to Prdm1 expression in WT and J-DTR ASCs. (B–G) Symbols represent individual 3–7 months old female (orange) and male (blue) mice. Data pooled from 3 independent experiments. Horizontal lines represent mean ± standard error of the mean (SEM). WT spleen, Pan-B and ASC: female n = 2, male n = 3; J-DTR spleen, Pan-B and ASC: female n = 3, male n = 3. (B) Statistics: One-way ANOVA with Dunnett’s multiple comparisons test with ASCs for each genotype set as the control column. (C–G) Statistics: Unpaired Student’s t test between genotypes or cell types (related to and ).

Article Snippet: TaqMan Human HBEGF (DTR) (Hs00961129_m1) , Thermo Fisher Scientific , Cat# 4331182.

Techniques: Biomarker Discovery, Gene Expression, Flow Cytometry, Purification, Isolation, Expressing, Control