Journal: Annals of Neurology

Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

doi: 10.1002/ana.26061

Figure Lengend Snippet: Independent ( r 2 < 0.1) Genomewide Significant Associations With Relapse Hazard in the Discovery Cohort

Article Snippet: For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′).

Techniques:

Journal: Annals of Neurology

Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

doi: 10.1002/ana.26061

Figure Lengend Snippet: Forest plot of meta‐analysis of rs11871306*C association with relapse hazard. The Cox proportional hazards model was fitted with genotypes obtained by direct genotyping: genotypes obtained through TaqMan genotyping and Sanger sequencing for the discovery cohort, and through genotyping array for the replication cohort. CI, confidence interval; HR, hazard ratio.

Article Snippet: For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′).

Techniques: Sequencing

Journal: Annals of Neurology

Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

doi: 10.1002/ana.26061

Figure Lengend Snippet: Regional association plot of chromosome 17q21.32 with lead single nucleotide polymorphism (SNP) rs11871306 demonstrating an association with relapse hazard. Association results (primary y‐axis) are shown for genetic variants with a minor allele frequency (MAF) ≥2% and imputation INFO metric ≥0.9, along with recombination rates (secondary y‐axis), for a 500 kb region (250 kb region flanking the lead SNP rs11871306 (chr17:44954984 (hg19)). Each dot represents the ‐log 10 p value from the survival analysis using the Cox proportional hazards model including baseline relapses before any immunomodulatory treatment. Genetic variants are colored according their linkage disequilibrium (LD; r 2 ) with the lead SNP using the 1,000 Genomes Phase III EUR superpopulation.

Article Snippet: For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′).

Techniques:

Journal: Annals of Neurology

Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

doi: 10.1002/ana.26061

Figure Lengend Snippet: Survival curves for time to relapse by rs11871306 genotype. (A) In the discovery cohort, individuals carrying the rs11871306*C allele have a shorter time to relapse compared with noncarriers, with a median relapse‐free interval of 0.95 versus 2.22 years. (B) In the replication cohort, individuals carrying the rs11871306*C allele have a shorter time to relapse compared with noncarriers with a median relapse‐free interval of 0.59 versus 2.00 years. Dotted lines represent 95% confidence intervals.

Article Snippet: For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′).

Techniques: