Journal: Nanomaterials

Article Title: Probing Polymorphic Stacking Domains in Mechanically Exfoliated Two-Dimensional Nanosheets Using Atomic Force Microscopy and Ultralow-Frequency Raman Spectroscopy

doi: 10.3390/nano14040339

Figure Lengend Snippet: Optical images of the MoS 2 nanosheets consisting of 2H 6L and non-2H 7L layers ( a ) before and ( b ) after their transfer onto a PDMS film. ( c ) The ULF Raman spectra of regions P1, P2, and P3 in the 6L and 7L MoS 2 layers before and after the transfer. The red dashed lines are referred to the breathing-mode peak, the blue and green dashed lines are referred to the shear-mode peaks.

Article Snippet: High-frequency and ultralow-frequency Raman and photoluminescence spectra were obtained using a Raman microscope (LabRAM HR Evolution, Horiba, Kyoto, Japan).

Techniques: Shear

Journal: Nanomaterials

Article Title: Probing Polymorphic Stacking Domains in Mechanically Exfoliated Two-Dimensional Nanosheets Using Atomic Force Microscopy and Ultralow-Frequency Raman Spectroscopy

doi: 10.3390/nano14040339

Figure Lengend Snippet: ( a ) Optical and ( c ) AFM topography images. ( b ) ULF Raman spectra of the MoS 2 nanosheet on the 300 nm SiO 2 /Si substrate. The red and blue dashed lines are referred to the shear- and breathing-mode peaks of 2H 2L MoS 2 , the orange and green dashed lines are referred to the shear- and breathing-mode peaks of 2H 5L MoS 2 . The purple arrows are referred to the new shear-mode peaks of non-2H 5L MoS 2 . ( d ) Simulated atomic lattice images of regions P2 and P3 shown in ( c ) and according to the measured twist angle.

Article Snippet: High-frequency and ultralow-frequency Raman and photoluminescence spectra were obtained using a Raman microscope (LabRAM HR Evolution, Horiba, Kyoto, Japan).

Techniques: Shear

Journal: Nanomaterials

Article Title: Probing Polymorphic Stacking Domains in Mechanically Exfoliated Two-Dimensional Nanosheets Using Atomic Force Microscopy and Ultralow-Frequency Raman Spectroscopy

doi: 10.3390/nano14040339

Figure Lengend Snippet: ( a ) Optical image, ( b ) AFM topography image, ( c ) ULF Raman spectra, the red and blue dashed lines are referred to the shear-mode peaks of non-2H 6L MoS 2 , ( d ) Raman mapping in the range of 25.5 to 35.5 cm −1 , ( e ) EFM amplitude image, and ( f ) EFM phase image of the 6L MoS 2 sample with different stacking orders.

Article Snippet: High-frequency and ultralow-frequency Raman and photoluminescence spectra were obtained using a Raman microscope (LabRAM HR Evolution, Horiba, Kyoto, Japan).

Techniques: Shear

Journal: Nanomaterials

Article Title: Probing Polymorphic Stacking Domains in Mechanically Exfoliated Two-Dimensional Nanosheets Using Atomic Force Microscopy and Ultralow-Frequency Raman Spectroscopy

doi: 10.3390/nano14040339

Figure Lengend Snippet: ( a ) Optical image, ( b ) AFM topography image, ( c ) ULF Raman spectra, the green and blue dashed lines are referred to the shear-mode peaks of non-2H 6L MoSe 2 , ( d ) Raman mapping in the range of 12.4 to 14.4 cm −1 and 17.1 to 20.7 cm −1 , ( e ) EFM amplitude image, and ( f ) EFM phase image of the 6L MoSe 2 sample with different stacking orders.

Article Snippet: High-frequency and ultralow-frequency Raman and photoluminescence spectra were obtained using a Raman microscope (LabRAM HR Evolution, Horiba, Kyoto, Japan).

Techniques: Shear

Journal: Annals of Neurology

Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

doi: 10.1002/ana.26061

Figure Lengend Snippet: Independent ( r 2 < 0.1) Genomewide Significant Associations With Relapse Hazard in the Discovery Cohort

Article Snippet: For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′).

Techniques:

Journal: Annals of Neurology

Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

doi: 10.1002/ana.26061

Figure Lengend Snippet: Forest plot of meta‐analysis of rs11871306*C association with relapse hazard. The Cox proportional hazards model was fitted with genotypes obtained by direct genotyping: genotypes obtained through TaqMan genotyping and Sanger sequencing for the discovery cohort, and through genotyping array for the replication cohort. CI, confidence interval; HR, hazard ratio.

Article Snippet: For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′).

Techniques: Sequencing

Journal: Annals of Neurology

Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

doi: 10.1002/ana.26061

Figure Lengend Snippet: Regional association plot of chromosome 17q21.32 with lead single nucleotide polymorphism (SNP) rs11871306 demonstrating an association with relapse hazard. Association results (primary y‐axis) are shown for genetic variants with a minor allele frequency (MAF) ≥2% and imputation INFO metric ≥0.9, along with recombination rates (secondary y‐axis), for a 500 kb region (250 kb region flanking the lead SNP rs11871306 (chr17:44954984 (hg19)). Each dot represents the ‐log 10 p value from the survival analysis using the Cox proportional hazards model including baseline relapses before any immunomodulatory treatment. Genetic variants are colored according their linkage disequilibrium (LD; r 2 ) with the lead SNP using the 1,000 Genomes Phase III EUR superpopulation.

Article Snippet: For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′).

Techniques:

Journal: Annals of Neurology

Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

doi: 10.1002/ana.26061

Figure Lengend Snippet: Survival curves for time to relapse by rs11871306 genotype. (A) In the discovery cohort, individuals carrying the rs11871306*C allele have a shorter time to relapse compared with noncarriers, with a median relapse‐free interval of 0.95 versus 2.22 years. (B) In the replication cohort, individuals carrying the rs11871306*C allele have a shorter time to relapse compared with noncarriers with a median relapse‐free interval of 0.59 versus 2.00 years. Dotted lines represent 95% confidence intervals.

Article Snippet: For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′).

Techniques: