|
Merck & Co
hgf forward Hgf Forward, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/forward+hgf/pmc12281364__mmc2-633-224-227 Average 86 stars, based on 1 article reviews
hgf forward - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Danaher Inc
m13 M13, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/M13+Forward/pm30326452-78-17-22 Average 94 stars, based on 1 article reviews
m13 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Addgene inc
nir fb lag16 ![]() Nir Fb Lag16, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/TV-hPITX3-forward+(Plasmid+%2322073)/bio_rxiv__2025__10__27__684934-265-26-28 Average 93 stars, based on 1 article reviews
nir fb lag16 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Sangon Biotech
gatccttgatcgtttcggctg sangon biotech n a actin forward ![]() Gatccttgatcgtttcggctg Sangon Biotech N A Actin Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pm40449480-254-199-200 Average 86 stars, based on 1 article reviews
gatccttgatcgtttcggctg sangon biotech n a actin forward - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
dcx dsred forward ![]() Dcx Dsred Forward, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/dcx+dsred+forward/pm35263591-221-3-6 Average 86 stars, based on 1 article reviews
dcx dsred forward - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
tgtgtccacggcggcaatcatc bcl2 rn07313625 m1 forward sequence ![]() Tgtgtccacggcggcaatcatc Bcl2 Rn07313625 M1 Forward Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/TGTGTCCACGGCGGCAATCATC+BCL2+Rn07313625_m1+Forward+sequence/10__7759_slash_cureus__95988-104-36-90 Average 94 stars, based on 1 article reviews
tgtgtccacggcggcaatcatc bcl2 rn07313625 m1 forward sequence - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag ![]() Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/Forward+primer+Reverse+primer+Probe+KCNQ1+rs12296050+GTGCTTAGACTGTGCCCG+GGGAGACCCTGTCTCGAA+CTCCTGGGCTCCTAACCTTTCACAG-3'P/10__1161_slash_circgenetics__113__000023-357-51-93 Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Addgene inc
xhoixbai fragment ![]() Xhoixbai Fragment, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/AAV-P(Cry1)-forward-intron336-Venus-NLS-D2+(Plasmid+%23110054)/pmc09574595__mmc2-252-7-17 Average 91 stars, based on 1 article reviews
xhoixbai fragment - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Thermo Fisher
ttcttgggcgtctgctccacag bax rn01480161 forward sequence ![]() Ttcttgggcgtctgctccacag Bax Rn01480161 Forward Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/TTCTTGGGCGTCTGCTCCACAG+BAX+Rn01480161+Forward+sequence/10__7759_slash_cureus__95988-104-28-90 Average 94 stars, based on 1 article reviews
ttcttgggcgtctgctccacag bax rn01480161 forward sequence - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Merck & Co
gapdh forward ![]() Gapdh Forward, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/forward+gapdh/pmc12281364__mmc2-633-236-239 Average 86 stars, based on 1 article reviews
gapdh forward - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Eurofins
paper n a oligonucleotides primer ![]() Paper N A Oligonucleotides Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/and+forward+oligonucleotides+reverse+sgrna/pm36736320-131-14-23 Average 86 stars, based on 1 article reviews
paper n a oligonucleotides primer - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Cresco Labs
horizontal and forward-facing vertical coils ![]() Horizontal And Forward Facing Vertical Coils, supplied by Cresco Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/horizontal+and+forward+facing+vertical+coils/10__1071_slash_pvv2000n84-3123-6-15 Average 90 stars, based on 1 article reviews
horizontal and forward-facing vertical coils - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: bioRxiv
Article Title: Synthetic multicolor antigen-stabilizable nanobody platform for intersectional labelling and functional imaging
doi: 10.1101/2025.10.27.684934
Figure Lengend Snippet: (a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb LAG16 without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.
Article Snippet: To generate dTomato-Fb LAG16 , the dTomato gene was PCR amplified from the pCAG-Kir2.1-T2A-tdTomato (Addgene no.60598) plasmid with Gly 2 Ser linkers and inserted into the
Techniques: Fluorescence, Transfection, Expressing, Negative Control, Positive Control, Flow Cytometry, Imaging
Journal: bioRxiv
Article Title: Synthetic multicolor antigen-stabilizable nanobody platform for intersectional labelling and functional imaging
doi: 10.1101/2025.10.27.684934
Figure Lengend Snippet: (a) Schematic of the experimental approach. An AAV vector driving dTomato-Fb LAG16 expression under the control of the hSyn promoter and the soma-targeting peptide RiboL1 was stereotactically injected into the somatosensory cortex of Thy1-GCaMP6f mice with preferential calcium indicator expression in a subset of excitatory pyramidal neurons. (b) Immunostaining validation. Left, example confocal fluorescence images showing GCaMP6f-(gray) and dTomato-expressing cells (red) in a cortical tissue section from an injected Thy1 -GCaMP6f mouse. Center, zoom-in of the indicated region. Scale bars, 250 μm (left) and 50 μm (center). Right, population analysis ( n=12 tissue sections from four mice). Data are presented as mean values ± SD. (c) In vivo validation. Left, example two-photon fluorescence image from a dual-color time-lapse recording showing GCaMP6f-(gray) and dTomato-expressing cells (red) in the somatosensory cortex of a behaving Thy1-GCaMP6f mouse. Recording depth (z) from the pial surface and seven somatic regions of interest (ROIs) is indicated. Center, fluorescence transients in the indicated ROIs are shown as ΔR/R (blue) for the combined channels. The simultaneously recorded mouse’s locomotor activity on a spherical treadmill is shown above the fluorescence traces. Scale bars, 50 μm (left), 50 mm/s and 200% (center). Right, zoom-ins of the two periods indicated in (c, center). (d) Schematic of the experimental approach. An AAV vector driving dTomato-Fb LAG16 expression under the control of the astrocyte enhancer 3xCore2(390m) was stereotactically injected into the somatosensory cortex of GFAP-GCaMP6f mice with preferential calcium indicator expression in astrocytes. (e) Immunostaining validation. Left, example confocal fluorescence images showing GCaMP6f-(gray) and dTomato-expressing cells (red) in a cortical tissue section from an injected GFAP -GCaMP6f mouse. Center, zoom-in of the indicated region. Scale bars, 250 μm (left) and 50 μm (center). Right, population analysis ( n=6 tissue sections from two mice). Data are presented as mean values ± SD. (f) In vivo validation. Left, example two-photon fluorescence image from a dual-color time-lapse recording showing GCaMP6f-(gray) and dTomato-expressing cells (red) in the somatosensory cortex of a behaving GFAP-GCaMP6f mouse. Recording depth (z) from the pial surface and seven somatic regions of interest (ROIs) is indicated. Center, fluorescence transients in the indicated ROIs are shown as ΔR/R (blue) for the combined channels. The simultaneously recorded mouse’s locomotor activity on a spherical treadmill is shown above the fluorescence traces. Scale bars, 50 μm (left), 50 mm/s and 200% (center). Right, zoom-ins of the two periods indicated in (f, center). (g) Schematic of the experimental approach. An AAV vector driving dTomato-Fb LAG16 expression under the control of the DLX2.0 enhancer was stereotactically injected into the somatosensory cortex of Viaat-GCaMP6f mice with calcium indicator expression in inhibitory interneurons. (h) Immunostaining validation. Left, example confocal fluorescence images showing GCaMP6f-(gray) and dTomato-expressing cells (red) in a cortical tissue section from an injected Viaat -GCaMP6f mouse. Center, zoom-in of the indicated region. Scale bars, 250 μm (left) and 50 μm (center). Right, population analysis ( n=6 tissue sections from two mice). Data are presented as mean values ± SD. (i) In vivo validation. Left, example two-photon fluorescence image from a dual-color time-lapse recording showing GCaMP6f-(gray) and dTomato-expressing cells (red) in the somatosensory cortex of a behaving Viaat-GCaMP6f mouse. Recording depth (z) from the pial surface and seven somatic regions of interest (ROIs) is indicated. Center, fluorescence transients in the indicated ROIs are shown as ΔR/R (blue) for the combined channels. The simultaneously recorded mouse’s locomotor activity on a spherical treadmill is shown above the fluorescence traces. Scale bars, 50 μm (left), 50 mm/s and 200% (center). (i) Zoom-ins of the two periods indicated in (i, center).
Article Snippet: To generate dTomato-Fb LAG16 , the dTomato gene was PCR amplified from the pCAG-Kir2.1-T2A-tdTomato (Addgene no.60598) plasmid with Gly 2 Ser linkers and inserted into the
Techniques: Plasmid Preparation, Expressing, Control, Injection, Immunostaining, Biomarker Discovery, Fluorescence, In Vivo, Activity Assay