forward Search Results


86
Merck & Co hgf forward
Hgf Forward, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hgf forward/product/Merck & Co
Average 86 stars, based on 1 article reviews
hgf forward - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

93
Addgene inc nir fb lag16
(a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb <t>LAG16</t> without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.
Nir Fb Lag16, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nir fb lag16/product/Addgene inc
Average 93 stars, based on 1 article reviews
nir fb lag16 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

94
Danaher Inc m13
(a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb <t>LAG16</t> without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.
M13, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13/product/Danaher Inc
Average 94 stars, based on 1 article reviews
m13 - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

91
Addgene inc pcsii ef mirfp709 hcdt
(a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb <t>LAG16</t> without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.
Pcsii Ef Mirfp709 Hcdt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcsii ef mirfp709 hcdt/product/Addgene inc
Average 91 stars, based on 1 article reviews
pcsii ef mirfp709 hcdt - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

86
Sangon Biotech human d loop forward
(a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb <t>LAG16</t> without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.
Human D Loop Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human d loop forward/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
human d loop forward - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Jackson Laboratory dcx dsred forward
(a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb <t>LAG16</t> without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.
Dcx Dsred Forward, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dcx dsred forward/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
dcx dsred forward - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

94
Thermo Fisher ttcttgggcgtctgctccacag bax rn01480161 forward sequence
(a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb <t>LAG16</t> without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.
Ttcttgggcgtctgctccacag Bax Rn01480161 Forward Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ttcttgggcgtctgctccacag bax rn01480161 forward sequence/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
ttcttgggcgtctgctccacag bax rn01480161 forward sequence - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

94
Thermo Fisher tgtgtccacggcggcaatcatc bcl2 rn07313625 m1 forward sequence
(a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb <t>LAG16</t> without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.
Tgtgtccacggcggcaatcatc Bcl2 Rn07313625 M1 Forward Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tgtgtccacggcggcaatcatc bcl2 rn07313625 m1 forward sequence/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
tgtgtccacggcggcaatcatc bcl2 rn07313625 m1 forward sequence - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

86
Thermo Fisher forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag
(a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb <t>LAG16</t> without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.
Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Merck & Co gapdh forward
(a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb <t>LAG16</t> without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.
Gapdh Forward, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gapdh forward/product/Merck & Co
Average 86 stars, based on 1 article reviews
gapdh forward - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
DBI Bioscience specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix
(a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb <t>LAG16</t> without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.
Specific Forward Primer And Reverse Primer Using Bestar Sybrgreen Qpcr Mastermix, supplied by DBI Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix/product/DBI Bioscience
Average 90 stars, based on 1 article reviews
specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Sigma-Genosys forward primer 5′-tac cgg gcg gtg acg gag tg-3′
(a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb <t>LAG16</t> without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.
Forward Primer 5′ Tac Cgg Gcg Gtg Acg Gag Tg 3′, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 5′-tac cgg gcg gtg acg gag tg-3′/product/Sigma-Genosys
Average 90 stars, based on 1 article reviews
forward primer 5′-tac cgg gcg gtg acg gag tg-3′ - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


(a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb LAG16 without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.

Journal: bioRxiv

Article Title: Synthetic multicolor antigen-stabilizable nanobody platform for intersectional labelling and functional imaging

doi: 10.1101/2025.10.27.684934

Figure Lengend Snippet: (a) Red fluorescence intensity of cells transfected with mCherry-Fb GFP , dTomato-Fb LAG16 without linkers, or dTomato-Fb LAG16 with –GGS-linkers and co-expressed with mEGFP (right column (+)) or mTagBFP2 (left column (−)). (b) Fluorescence images of HeLa cells co-expressing dTomato-Fb LAG16 with mTagBFP2 (negative control) or mEGFP (positive control). (c) Scheme of a VIS-Fb with a red FP (PDB ID: 1ZGO) inserted into LAG16 anti-GFP nanobody (PDB ID: 6LR7) bound to GFP-based biosensor GCaMP6m (PDB ID: 3WLD). Complementarity-determining regions (CDRs) are highlighted in violet. The position of dTomato insertion to the anti-GFP nanobody is indicated with a red arrow. (d) Upper, representative image of HeLa cells co-expressing GCaMP6s and dTomato-Fb LAG16 . Three regions of interest (ROIs) are indicated with white squares. Lower, changes in fluorescence intensity of the same cell co-expressing GCaMP6s (green) and dTomato-Fb LAG16 (red) in response to 5 μM ionomycin. Fluorescence changes for three ROIs are shown. (e) Upper, contrast of GCaMP6s only ( n=10 ) and GCaMP6s co-expressed with dTomato-Fb LAG16 ( n=11 ) after addition of 5 μM ionomycin. Lower, contrast of dTomato-Fb LAG16 ( n=11 ) for the data presented in the left graph. (f) Co-expression of dTomato-Fb LAG16 fused to RiboL1 tag and mEGFP in the soma of hippocampal neurons. In (a) fluorescence intensity was analyzed by flow cytometry using a 405 nm excitation laser and 450/50 nm emission filter for mTagBFP2; a 488 nm excitation laser and 525/50 nm emission filter for mEGFP; a 561 nm excitation laser and 610/20 nm emission filter for mCherry-Fb GFP and dTomato-Fb LAG16 . The maximal fluorescence of antigen-bound form for dTomato(GGS)-Fb LAG16 was assumed to be 100%. Data are presented as mean values ± s.d. for n = 3 transfection experiments. In (b, d, and f), the following filters were used: for imaging mEGFP and GCaMP6s 480/40 nm excitation and 535/40 nm emission; for imaging dTomato-Fb LAG16 and dTomato-Fb LAG16 -RiboL1 575/25 nm excitation and 615/30 nm emission. (b, d) Scale bar, 40 μm. (f) Scale bar, 20 μm.

Article Snippet: To generate dTomato-Fb LAG16 , the dTomato gene was PCR amplified from the pCAG-Kir2.1-T2A-tdTomato (Addgene no.60598) plasmid with Gly 2 Ser linkers and inserted into the NIR-Fb LAG16 (Addgene no.220739) plasmid instead of miRFP670nano3.

Techniques: Fluorescence, Transfection, Expressing, Negative Control, Positive Control, Flow Cytometry, Imaging

(a) Schematic of the experimental approach. An AAV vector driving dTomato-Fb LAG16 expression under the control of the hSyn promoter and the soma-targeting peptide RiboL1 was stereotactically injected into the somatosensory cortex of Thy1-GCaMP6f mice with preferential calcium indicator expression in a subset of excitatory pyramidal neurons. (b) Immunostaining validation. Left, example confocal fluorescence images showing GCaMP6f-(gray) and dTomato-expressing cells (red) in a cortical tissue section from an injected Thy1 -GCaMP6f mouse. Center, zoom-in of the indicated region. Scale bars, 250 μm (left) and 50 μm (center). Right, population analysis ( n=12 tissue sections from four mice). Data are presented as mean values ± SD. (c) In vivo validation. Left, example two-photon fluorescence image from a dual-color time-lapse recording showing GCaMP6f-(gray) and dTomato-expressing cells (red) in the somatosensory cortex of a behaving Thy1-GCaMP6f mouse. Recording depth (z) from the pial surface and seven somatic regions of interest (ROIs) is indicated. Center, fluorescence transients in the indicated ROIs are shown as ΔR/R (blue) for the combined channels. The simultaneously recorded mouse’s locomotor activity on a spherical treadmill is shown above the fluorescence traces. Scale bars, 50 μm (left), 50 mm/s and 200% (center). Right, zoom-ins of the two periods indicated in (c, center). (d) Schematic of the experimental approach. An AAV vector driving dTomato-Fb LAG16 expression under the control of the astrocyte enhancer 3xCore2(390m) was stereotactically injected into the somatosensory cortex of GFAP-GCaMP6f mice with preferential calcium indicator expression in astrocytes. (e) Immunostaining validation. Left, example confocal fluorescence images showing GCaMP6f-(gray) and dTomato-expressing cells (red) in a cortical tissue section from an injected GFAP -GCaMP6f mouse. Center, zoom-in of the indicated region. Scale bars, 250 μm (left) and 50 μm (center). Right, population analysis ( n=6 tissue sections from two mice). Data are presented as mean values ± SD. (f) In vivo validation. Left, example two-photon fluorescence image from a dual-color time-lapse recording showing GCaMP6f-(gray) and dTomato-expressing cells (red) in the somatosensory cortex of a behaving GFAP-GCaMP6f mouse. Recording depth (z) from the pial surface and seven somatic regions of interest (ROIs) is indicated. Center, fluorescence transients in the indicated ROIs are shown as ΔR/R (blue) for the combined channels. The simultaneously recorded mouse’s locomotor activity on a spherical treadmill is shown above the fluorescence traces. Scale bars, 50 μm (left), 50 mm/s and 200% (center). Right, zoom-ins of the two periods indicated in (f, center). (g) Schematic of the experimental approach. An AAV vector driving dTomato-Fb LAG16 expression under the control of the DLX2.0 enhancer was stereotactically injected into the somatosensory cortex of Viaat-GCaMP6f mice with calcium indicator expression in inhibitory interneurons. (h) Immunostaining validation. Left, example confocal fluorescence images showing GCaMP6f-(gray) and dTomato-expressing cells (red) in a cortical tissue section from an injected Viaat -GCaMP6f mouse. Center, zoom-in of the indicated region. Scale bars, 250 μm (left) and 50 μm (center). Right, population analysis ( n=6 tissue sections from two mice). Data are presented as mean values ± SD. (i) In vivo validation. Left, example two-photon fluorescence image from a dual-color time-lapse recording showing GCaMP6f-(gray) and dTomato-expressing cells (red) in the somatosensory cortex of a behaving Viaat-GCaMP6f mouse. Recording depth (z) from the pial surface and seven somatic regions of interest (ROIs) is indicated. Center, fluorescence transients in the indicated ROIs are shown as ΔR/R (blue) for the combined channels. The simultaneously recorded mouse’s locomotor activity on a spherical treadmill is shown above the fluorescence traces. Scale bars, 50 μm (left), 50 mm/s and 200% (center). (i) Zoom-ins of the two periods indicated in (i, center).

Journal: bioRxiv

Article Title: Synthetic multicolor antigen-stabilizable nanobody platform for intersectional labelling and functional imaging

doi: 10.1101/2025.10.27.684934

Figure Lengend Snippet: (a) Schematic of the experimental approach. An AAV vector driving dTomato-Fb LAG16 expression under the control of the hSyn promoter and the soma-targeting peptide RiboL1 was stereotactically injected into the somatosensory cortex of Thy1-GCaMP6f mice with preferential calcium indicator expression in a subset of excitatory pyramidal neurons. (b) Immunostaining validation. Left, example confocal fluorescence images showing GCaMP6f-(gray) and dTomato-expressing cells (red) in a cortical tissue section from an injected Thy1 -GCaMP6f mouse. Center, zoom-in of the indicated region. Scale bars, 250 μm (left) and 50 μm (center). Right, population analysis ( n=12 tissue sections from four mice). Data are presented as mean values ± SD. (c) In vivo validation. Left, example two-photon fluorescence image from a dual-color time-lapse recording showing GCaMP6f-(gray) and dTomato-expressing cells (red) in the somatosensory cortex of a behaving Thy1-GCaMP6f mouse. Recording depth (z) from the pial surface and seven somatic regions of interest (ROIs) is indicated. Center, fluorescence transients in the indicated ROIs are shown as ΔR/R (blue) for the combined channels. The simultaneously recorded mouse’s locomotor activity on a spherical treadmill is shown above the fluorescence traces. Scale bars, 50 μm (left), 50 mm/s and 200% (center). Right, zoom-ins of the two periods indicated in (c, center). (d) Schematic of the experimental approach. An AAV vector driving dTomato-Fb LAG16 expression under the control of the astrocyte enhancer 3xCore2(390m) was stereotactically injected into the somatosensory cortex of GFAP-GCaMP6f mice with preferential calcium indicator expression in astrocytes. (e) Immunostaining validation. Left, example confocal fluorescence images showing GCaMP6f-(gray) and dTomato-expressing cells (red) in a cortical tissue section from an injected GFAP -GCaMP6f mouse. Center, zoom-in of the indicated region. Scale bars, 250 μm (left) and 50 μm (center). Right, population analysis ( n=6 tissue sections from two mice). Data are presented as mean values ± SD. (f) In vivo validation. Left, example two-photon fluorescence image from a dual-color time-lapse recording showing GCaMP6f-(gray) and dTomato-expressing cells (red) in the somatosensory cortex of a behaving GFAP-GCaMP6f mouse. Recording depth (z) from the pial surface and seven somatic regions of interest (ROIs) is indicated. Center, fluorescence transients in the indicated ROIs are shown as ΔR/R (blue) for the combined channels. The simultaneously recorded mouse’s locomotor activity on a spherical treadmill is shown above the fluorescence traces. Scale bars, 50 μm (left), 50 mm/s and 200% (center). Right, zoom-ins of the two periods indicated in (f, center). (g) Schematic of the experimental approach. An AAV vector driving dTomato-Fb LAG16 expression under the control of the DLX2.0 enhancer was stereotactically injected into the somatosensory cortex of Viaat-GCaMP6f mice with calcium indicator expression in inhibitory interneurons. (h) Immunostaining validation. Left, example confocal fluorescence images showing GCaMP6f-(gray) and dTomato-expressing cells (red) in a cortical tissue section from an injected Viaat -GCaMP6f mouse. Center, zoom-in of the indicated region. Scale bars, 250 μm (left) and 50 μm (center). Right, population analysis ( n=6 tissue sections from two mice). Data are presented as mean values ± SD. (i) In vivo validation. Left, example two-photon fluorescence image from a dual-color time-lapse recording showing GCaMP6f-(gray) and dTomato-expressing cells (red) in the somatosensory cortex of a behaving Viaat-GCaMP6f mouse. Recording depth (z) from the pial surface and seven somatic regions of interest (ROIs) is indicated. Center, fluorescence transients in the indicated ROIs are shown as ΔR/R (blue) for the combined channels. The simultaneously recorded mouse’s locomotor activity on a spherical treadmill is shown above the fluorescence traces. Scale bars, 50 μm (left), 50 mm/s and 200% (center). (i) Zoom-ins of the two periods indicated in (i, center).

Article Snippet: To generate dTomato-Fb LAG16 , the dTomato gene was PCR amplified from the pCAG-Kir2.1-T2A-tdTomato (Addgene no.60598) plasmid with Gly 2 Ser linkers and inserted into the NIR-Fb LAG16 (Addgene no.220739) plasmid instead of miRFP670nano3.

Techniques: Plasmid Preparation, Expressing, Control, Injection, Immunostaining, Biomarker Discovery, Fluorescence, In Vivo, Activity Assay