|
Becton Dickinson
influenza b virus detection kit capilia flub Influenza B Virus Detection Kit Capilia Flub, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/influenza b virus detection kit capilia flub/product/Becton Dickinson Average 90 stars, based on 1 article reviews
influenza b virus detection kit capilia flub - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
SPSS Inc
sars-cov-2 rt-qpcr assay Sars Cov 2 Rt Qpcr Assay, supplied by SPSS Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sars-cov-2 rt-qpcr assay/product/SPSS Inc Average 90 stars, based on 1 article reviews
sars-cov-2 rt-qpcr assay - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Vircell S.L
amplirun total sarscov-2/flua/flub/rsv control (swab Amplirun Total Sarscov 2/Flua/Flub/Rsv Control (Swab, supplied by Vircell S.L, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/amplirun total sarscov-2/flua/flub/rsv control (swab/product/Vircell S.L Average 90 stars, based on 1 article reviews
amplirun total sarscov-2/flua/flub/rsv control (swab - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
ActivX Inc
flub probe* (cy5) ataaactttgaagcaggaat (bhq3 ![]() Flub Probe* (Cy5) Ataaactttgaagcaggaat (Bhq3, supplied by ActivX Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/flub probe* (cy5) ataaactttgaagcaggaat (bhq3/product/ActivX Inc Average 90 stars, based on 1 article reviews
flub probe* (cy5) ataaactttgaagcaggaat (bhq3 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Binax Inc
binaxnow flua and flub ![]() Binaxnow Flua And Flub, supplied by Binax Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/binaxnow flua and flub/product/Binax Inc Average 90 stars, based on 1 article reviews
binaxnow flua and flub - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Binax Inc
now flua and flub ![]() Now Flua And Flub, supplied by Binax Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/now flua and flub/product/Binax Inc Average 90 stars, based on 1 article reviews
now flua and flub - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
pdp2018-flub-igip-ha ![]() Pdp2018 Flub Igip Ha, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pdp2018-flub-igip-ha/product/GenScript corporation Average 90 stars, based on 1 article reviews
pdp2018-flub-igip-ha - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Harlan Laboratories
flub dmab ![]() Flub Dmab, supplied by Harlan Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/flub dmab/product/Harlan Laboratories Average 90 stars, based on 1 article reviews
flub dmab - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
flub-ht variants ![]() Flub Ht Variants, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/flub-ht variants/product/GenScript corporation Average 90 stars, based on 1 article reviews
flub-ht variants - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
eEnzyme Inc
hemagglutinin (ha; flub/florida/4/2006; eenzyme) ![]() Hemagglutinin (Ha; Flub/Florida/4/2006; Eenzyme), supplied by eEnzyme Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hemagglutinin (ha; flub/florida/4/2006; eenzyme)/product/eEnzyme Inc Average 90 stars, based on 1 article reviews
hemagglutinin (ha; flub/florida/4/2006; eenzyme) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Clinomics Inc
1copytm covid-19/flua/flub/rsv qpcr kit ![]() 1copytm Covid 19/Flua/Flub/Rsv Qpcr Kit, supplied by Clinomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/1copytm covid-19/flua/flub/rsv qpcr kit/product/Clinomics Inc Average 90 stars, based on 1 article reviews
1copytm covid-19/flua/flub/rsv qpcr kit - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Genentech inc
antibodies against the anti-flub cdr ![]() Antibodies Against The Anti Flub Cdr, supplied by Genentech inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antibodies against the anti-flub cdr/product/Genentech inc Average 90 stars, based on 1 article reviews
antibodies against the anti-flub cdr - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Yonago Acta Medica
Article Title: Rapid Multiplex RT-PCR for Influenza A and B by Genesoc ® , a Microfluidic PCR System
doi: 10.33160/yam.2023.05.007
Figure Lengend Snippet: The primers and probes used in this study
Article Snippet: Primers & Probes Sequence (5’-3’) Product size (bp) Primers for Endpoint RT-PCR, Real-time RT-PCR and GeneSoC ® RT-PCR FluA F CCMAGGTCGAAACGTAYGTTCTCTCTATC 146 FluA R TGACAGRATYGGTCTTGTCTTTAGCCAYTCCA FluB F GGAGCAACCAATGCCAC 105 FluB R GTKTAGGCGGTCTTGACCAG Probes for GeneSoC ® RT-PCR FluA probe* (FAM) ATYTCGGCTTTGAGGGGGCCTG (BHQ1) FluB probe* (
Techniques: Quantitative RT-PCR
Journal: NPJ Vaccines
Article Title: DMAb inoculation of synthetic cross reactive antibodies protects against lethal influenza A and B infections
doi: 10.1038/s41541-017-0020-x
Figure Lengend Snippet: In vitro and in vivo expression of DNA-encoded monoclonal antibody (DMAb) constructs. a 293 T cells were transfected with FluA or FluB DMAb plasmid constructs, or empty plasmid (pVax1). Human IgG expression in cell supernatants ( left ) and lysates ( right ) was quantified by ELISA. ( n = 3 biological replicates, mean ± SEM). b Western blot of human IgG heavy-chain and light-chain peptides in reduced DMAb-transfected 293 T cell supernatants (S) and lysates (L) ( left ), and purified protein monoclonal antibody FluA and FluB (IgG, right ). Samples derive from the same experiment and gels/blots were processed in parallel. c , d DMAb human IgG in CAnN.Cg- Foxn1 nu /Crl nude mouse sera after intramuscular electroporation (IM-EP) (Day 0) with 100–300 μg of FluA ( c ) or FluB ( d ) DMAb plasmid DNA. Sera were collected up to 35 days post electroporation in mice treated with 100 μg FluA DMAb, and up to 70 days in all other groups. ( n = 5 animals per group, mean ± SEM). e , f Levels of DMAb human IgG in BALB/c mouse sera 5 days post administration of 100–300 μg of FluA ( e ) or FluB ( f ) DMAb plasmid DNA. Dotted line indicates limit of detection (LOD). ( n = 5 animals per group, mean ± SEM)
Article Snippet: Six- to eight-week-old BALB/c mice (
Techniques: In Vitro, In Vivo, Expressing, Construct, Transfection, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Western Blot, Purification, Electroporation
Journal: NPJ Vaccines
Article Title: DMAb inoculation of synthetic cross reactive antibodies protects against lethal influenza A and B infections
doi: 10.1038/s41541-017-0020-x
Figure Lengend Snippet: Serum FluA DMAb and FluB DMAb are functional. Functional assays performed with sera from BALB/c mice collected 5 days after treatment with 100–300 μg of FluA DMAb plasmid DNA ( a ) or FluB DMAb plasmid DNA ( b ) and ( c ). a ELISA binding EC 50 values (reciprocal dilution) for individual mouse serum samples to influenza A HA proteins from Group 1 (H1, A/California/07/2009 H1N1; H2, A/Missouri/2006 H2N3; H5, A/Vietnam/1203/2004 H5N1; H6, A/teal/Hong Kong/W312/97 H6N1; H9, A/chicken/Hong Kong/G9/1997 H9N2) and Group 2 (H3, A/Perth/16/2009 H3N2; H7, A/Netherlands/219/2003 H7N7). b ELISA Binding EC 50 values (reciprocal dilution) for individual mouse serum samples to influenza B HA proteins from the Yamagata (Yam B/Florida/4/2006) and Victoria (Vic B/Brisbane/60/2008) lineages. c Neutralization IC 50 values (reciprocal dilution) for individual mouse serum samples against influenza B viruses from the Yamagata (Yam virus B/Florida/4/2006) and Victoria (Vic virus B/Malaysia/2506/2004) lineages. ( n = 5 animals per group, mean ± SD)
Article Snippet: Six- to eight-week-old BALB/c mice (
Techniques: Functional Assay, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Binding Assay, Neutralization
Journal: NPJ Vaccines
Article Title: DMAb inoculation of synthetic cross reactive antibodies protects against lethal influenza A and B infections
doi: 10.1038/s41541-017-0020-x
Figure Lengend Snippet: FluA DMAb protects mice from diverse lethal influenza A challenges. BALB/c mice were treated with FluA DMAb plasmid DNA ( closed symbols ) 4–5 days prior to intranasal infection with A/California/7/2009 H1N1 ( a–c ) or re-assorted rA/HongKong/8/68 × PR8 H3N1 ( d–f ). 1 day prior to infection, separate mice received 0.03–1 mg/kg FluA protein monoclonal antibody i.p. ( open symbols ). Mice treated with 300 μg irrelevant DMAb (DVSF-3) or 1 mg/kg non-specific protein monoclonal antibody (R347) served as controls. a , d Human IgG in mouse sera at the time of influenza infection. Dotted line indicates LOD. ( a n = 10 animals, d n = 5 animals per group, mean ± SD). b , e Kaplan–Meier survival curves of BALB/c mice challenged with influenza A ( n = 10 animals per group, * p ≤ 0.0001 FluA DMAb versus Control DMAb). c , f Weight of BALB/c mice following influenza A challenge. Dotted line indicates 25% maximum weight loss. ( n = 10 animals per group, mean ± SEM)
Article Snippet: Six- to eight-week-old BALB/c mice (
Techniques: Plasmid Preparation, Infection
Journal: NPJ Vaccines
Article Title: DMAb inoculation of synthetic cross reactive antibodies protects against lethal influenza A and B infections
doi: 10.1038/s41541-017-0020-x
Figure Lengend Snippet: Co-administration of FluA and FluB DMAb protects mice from lethal influenza A/B challenge and homologous re-challenge. BALB/c mice received both FluA and FluB DMAb. Separate mice were treated with both FluA plus FluB protein monoclonal antibody. Mice received initial infection with either influenza A/California/7/2009 or B/Florida/4/2006. a Total human IgG levels in mice sera at the time of infection ( n = 8 animals per group, mean ± SD). b Influenza A-specific and B-specific human IgG in mouse serum at the time of infection quantified by HA binding ELISA ( n = 8 animals per group, mean ± SD). c , d Kaplan–Meier survival curves following initial infection with A/California/07/2009 ( c ) or B/Florida/4/2006 ( d ) ( n = 10 animals per group, * p ≤ 0.0001 Flu DMAb versus control DMAb). e , f 28 days following initial infection, surviving mice received homologous influenza re-infection. Kaplan–Meier survival curves following re-infection, compared to mice receiving neither DMAb/IgG treatment nor initial infection (naïve). (Number of animals in each group are shown)
Article Snippet: Six- to eight-week-old BALB/c mice (
Techniques: Infection, Binding Assay, Enzyme-linked Immunosorbent Assay