|
Novus Biologicals
fkbp51 ![]() Fkbp51, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/fkbp51/FKBP51%2FFKBP5+Antibody/pm40180895-177-15-17 Average 94 stars, based on 1 article reviews
fkbp51 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Proteintech
fkbp5 ![]() Fkbp5, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/fkbp51/FKBP5+Antibody/10__1158_slash_1535___7163__mct___12___0342-61-22-24 Average 94 stars, based on 1 article reviews
fkbp5 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
OriGene
human fkbp51 ![]() Human Fkbp51, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/fkbp51/FKBP51+(FKBP5)+(NM_004117)+Human+Tagged+ORF+Clone/pmc13018298-29-9-20 Average 94 stars, based on 1 article reviews
human fkbp51 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
OriGene
human fkbp5 ![]() Human Fkbp5, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/fkbp51/FKBP51+(FKBP5)+(NM_001145775)+Human+Recombinant+Protein/pmc06366448-116-12-17 Average 90 stars, based on 1 article reviews
human fkbp5 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Proteintech
fkbp4 ![]() Fkbp4, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/fkbp51/FKBP52+Antibody/pmc06287594-251-49-51 Average 93 stars, based on 1 article reviews
fkbp4 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
R&D Systems
fkbp51 ![]() Fkbp51, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/fkbp51/Human%2FMouse%2FRat+FKBP51+Antibody/pm32369692-69-79-88 Average 90 stars, based on 1 article reviews
fkbp51 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
length myc ddk ![]() Length Myc Ddk, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/fkbp51/FKBP52+(FKBP4)+(NM_002014)+Human+Tagged+ORF+Clone/pmc08881485-216-4-15 Average 90 stars, based on 1 article reviews
length myc ddk - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Bethyl
fkbp5 fkbp51 ![]() Fkbp5 Fkbp51, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/fkbp51/FKBP5%2FFKBP51+Antibody/bio_rxiv__484709-318-10-12 Average 93 stars, based on 1 article reviews
fkbp5 fkbp51 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
R&D Systems
11bhsd1 ![]() 11bhsd1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/fkbp51/Human%2FMouse%2FRat+FKBP51+Antibody/10__1530_slash_joe___18___0503-63-8-18 Average 94 stars, based on 1 article reviews
11bhsd1 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
R&D Systems
fkbp51 goat polyclonal antibody ![]() Fkbp51 Goat Polyclonal Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/fkbp51/Human%2FMouse%2FRat+FKBP51+Antibody/us12409182-330-73-77 Average 93 stars, based on 1 article reviews
fkbp51 goat polyclonal antibody - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
novus biologicals
nbp2-33944 ![]() Nbp2 33944, supplied by novus biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/fkbp51/FKBP51%2FFKBP5+Antibody/pmc12979786-12-0-5 Average 94 stars, based on 1 article reviews
nbp2-33944 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
OriGene
human fkbp5 fp gcgaaggagaagaccacgacat origene cat ![]() Human Fkbp5 Fp Gcgaaggagaagaccacgacat Origene Cat, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/fkbp51/FKBP51+(FKBP5)+Human+qPCR+Primer+Pair/pmc11224269__41467_2024_49978_MOESM1_ESM-130-222-225 Average 92 stars, based on 1 article reviews
human fkbp5 fp gcgaaggagaagaccacgacat origene cat - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell death discovery
Article Title: Exploring the potential of selective FKBP51 inhibitors on melanoma: an investigation of their in vitro and in vivo effects.
doi: 10.1038/s41420-025-02430-y
Figure Lengend Snippet: Fig. 1 SAFit enhances melanoma cell death. a Dose response assay of SAFit 1 and 2 on Doxo-induced cell death. A375 melanoma cells were cultured in the presence or absence of 3 μM Doxo and/or SAFit 1 (4, 20 and 40 nM) and SAFit 2 (6, 30 and 60 nM). After a 48 h incubation, cell death was assessed by measuring the proportion of hypodiploid cells by flow cytometry. b (Left) Western blot assay showing exogenous levels of FKBP51, β-Actin was used as loading control. Full length western blots are shown as Supplemental Material. (Right) Graphical representation of cell death values (N = 4) from cultures of Flag-FKBP51 and EV incubated with 3 μM Doxo and/or 20 nM SAFit 1. After a 48 h incubation, cells were harvested and analysed by PI incorporation and flow cytometry. Representative flow cytometry histograms of PI incorporation are shown below. c SAFit improves dacarbazine (DTIC)-induced cell death. SAN melanoma cells were cultured in the presence or absence of 27 μM DTIC and with or without 100 nM SAFit 1 or 100 nM rapamycin. After 48 h incubation cells were harvested and analysed by flow cytometry. The graph shows cell death values obtained from independent experiments (N = 3). Representative flow cytometry histograms of PI incorporation are shown below.
Article Snippet: Bcl-2 (N-19, rabbit polyclonal, Santa Cruz Biotechnology), XIAP (2F1, mouse monoclonal, Stressgen Biotechnologies, BC, Canada),
Techniques: Cell Culture, Incubation, Cytometry, Western Blot, Control
Journal: Cell death discovery
Article Title: Exploring the potential of selective FKBP51 inhibitors on melanoma: an investigation of their in vitro and in vivo effects.
doi: 10.1038/s41420-025-02430-y
Figure Lengend Snippet: Fig. 2 SAFits counteract NF-κB/Rel activation. a Electrophoretic mobility shift assay (EMSA) of nuclear extracts obtained from SAN melanoma cells cultured with 3 μM Doxo and/or SAFit1 20 nM or SAFit2 30 nM, for 3 and 5 h. A competition assay with the same cold oligo or an unrelated (NF-AT) oligo suggests the specificity of NF-κB bands. Full gels are shown as Supplemental Material. b Relative normalized expression values of BCL-2 and XIAP mRNA levels in SAN melanoma cells incubated for 24 h in the presence or absence of 20 nM SAFit1 or 30 nM SAFit2. Relative quantitation of the transcript was performed using co-amplified β-Actin as an internal control for normalization. (Lower), Western blot of protein extracted from the same cells for Bcl-2 and XIAP assay. Full gels are shown as Supplemental Material. c BCL-2 and FKBP51 mRNA levels in FKBP51-knocked down A375 melanoma cells (Sh FKBP51 RNA), transfected or not with Flag-FKBP51. (Lower), Western blot of protein extracted from the same cells for Bcl-2, FKBP51 and FLAG-FKBP51 assay. Full gels are shown as Supplemental Material.
Article Snippet: Bcl-2 (N-19, rabbit polyclonal, Santa Cruz Biotechnology), XIAP (2F1, mouse monoclonal, Stressgen Biotechnologies, BC, Canada),
Techniques: Activation Assay, Electrophoretic Mobility Shift Assay, Cell Culture, Competitive Binding Assay, Expressing, Incubation, Quantitation Assay, Control, Western Blot, Transfection
Journal: Molecular Cancer Therapeutics
Article Title: Cell Intrinsic Role of COX-2 in Pancreatic Cancer Development
doi: 10.1158/1535-7163.mct-12-0342
Figure Lengend Snippet: Figure 7. Decreased FKBP5 negative feedback leads to enhanced AKT activation in Pdx1-Creþ;K-rasG12D/þ;Ptenlox/þ; Cox-2lox/lox mice. A, FKBP5 mRNA expression in PDACs of Pdx1-Creþ; K-rasG12D/þ;Ptenlox/þ;Cox-2lox/lox
Article Snippet: The following primary antibodies were used: phospho-AKT(Ser473) (Cell Signaling; 1:50), Cytokeratin 19 (ab15463, Abcam; 1:100), COX-2 (SP21; Thermo Scientific, ready-to-use),GRP78(11587-1AP,ProteinTechGroup; 1:50), and
Techniques: Activation Assay, Expressing
Journal: Scientific Reports
Article Title: FKBP51 disrupts the insulin signaling pathway and impairs mitochondrial bioenergetics in HepG2 cells
doi: 10.1038/s41598-026-40414-9
Figure Lengend Snippet: FKBP51 overexpression dampens insulin signaling in HepG2 cells but does not hinder its effects on glucose metabolism. HepG2 cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 0.5 h with 100 nM insulin. ( A ) Representative blot ( n = 8), ( B ) FKBP51 protein levels, ( C ) Akt phosphorylation, ( D ) P70S6K phosphorylation, ( E ) FOXO1, ( F and G ) Glucose production assay ( n = 4), ( H ) mRNA levels (G6P, PCK1 y PDK4) ( n = 4), ( I ) Representative blot ( n = 3), GSK3β phosphorylation, ( J ) Representative imagens of glycogen synthesis assay and ( K ) Glycogen synthesis ( n = 4). One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control and square brackets with FKBP51 with insulin. Data are shown as means ± SEM.
Article Snippet: Cells were transfected with either a plasmid encoding Myc-DDK-tagged
Techniques: Over Expression, Transfection, Plasmid Preparation, Control, Phospho-proteomics
Journal: Scientific Reports
Article Title: FKBP51 disrupts the insulin signaling pathway and impairs mitochondrial bioenergetics in HepG2 cells
doi: 10.1038/s41598-026-40414-9
Figure Lengend Snippet: FKBP51 is partially localized in mitochondria in HepG2 cells, but does not alter mitochondrial morphology. HepG2 cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 3 h with 100 nM insulin and 200 nM CCCP for 2 h. ( A ) Representative image of immunofluorescence confocal microscopy, mtHSP70 (red) for mitochondria, FKBP51 (green). Segment lines represent the cellular contours. Scale bar: 24 μm, ( B ) Quantification of mitochondria (mtHSP70)-FKBP51 colocalization using Mander’s coefficient for cell imagens, ( C ) Quantification of FKBP51-mitochondria (mtHSP70) colocalization using Mander’s coefficient for cell imagens ( n = 6), ( D ) Representative blot mitochondria-cytosol subcellular fractionation ( n = 4), ( E ) Representative image of immunofluorescence confocal microscopy MitoTracker Green FM (200 nM for 0.2 h) in live-cells, ( F ) Quantification of average mitochondrial area, ( G ) Quantification of the of mitochondria number per cell in images cells and ( H ) Mean individual mitochondrial volume of HepG2 cells ( n = 5), ( I ) Representative image of Transmission Electron Microscopy, ( J ) Quantification of mitochondrial area, ( K ) Quantification of mitochondrial perimeter, ( L ) Quantification of mitochondrial aspect ratio. One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control. Data are shown as means ± SEM.
Article Snippet: Cells were transfected with either a plasmid encoding Myc-DDK-tagged
Techniques: Transfection, Plasmid Preparation, Control, Immunofluorescence, Confocal Microscopy, Fractionation, Transmission Assay, Electron Microscopy
Journal: Scientific Reports
Article Title: FKBP51 disrupts the insulin signaling pathway and impairs mitochondrial bioenergetics in HepG2 cells
doi: 10.1038/s41598-026-40414-9
Figure Lengend Snippet: FKBP51 overexpression decreases Mitofusin 2 protein levels in HepG2 cells. Cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 3 h with 100 nM insulin, mtHSP70 was used as loading control. ( A ) Representative blot of proteins of mitochondrial dynamics ( n = 10), ( B ) Mitofusin 1 protein levels (MFN1), ( C ) Mitofusin 2 protein levels (MFN2), ( E ) Ratio LOPA/SOPA1, ( D ) Dynamin-related protein 1 (Drp1) phosphorylation, ( F ) Mitochondrial fission protein 1 (Fis1 protein levels), ( G ) Dynamin-related protein 1 (Drp1), protein levels, ( H ) Representative blot of mitochondrial oxidative phosphorylation chain (OXPHOS), ( I ) NADH: ubiquinone oxidoreductase subunit B8 (NDUFB8, complex I) protein level, J Succinate dehydrogenase iron-sulfur subunit (SDHB, complex II), ( K ) Ubiquinol-cytochome c reductase core protein 2 (UQCRC2, complex III), ( L ) Cytochrome c oxidase subuni1 (MTCO1, complex IV) and ( M ) ATP synthase subunit alpha (ATP5A, complex V) ( n = 8). One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control. Data are shown as means ± SEM.
Article Snippet: Cells were transfected with either a plasmid encoding Myc-DDK-tagged
Techniques: Over Expression, Transfection, Plasmid Preparation, Control, Phospho-proteomics
Journal: Scientific Reports
Article Title: FKBP51 disrupts the insulin signaling pathway and impairs mitochondrial bioenergetics in HepG2 cells
doi: 10.1038/s41598-026-40414-9
Figure Lengend Snippet: FKBP51 overexpression impairs mitochondrial bioenergetics. HepG2 cells were transfected with either a plasmid coding Myc-DDK-tagged human FKBP51 (FKBP51) or an empty pCMV6 plasmid (Control) and were stimulated for 3 h with 100 nM insulin. ( A ) Oxygen consumption rate (OCR) of cell, measured sequentially for 5 min, (CCCP 100 nM) ( n = 5), ( B ) Representative image of confocal microscopy of HepG2 cells loaded with TMRM then treated with CCCP 100 nM to dissipate the mitochondrial transmembrane potential. ΔB-C (ΔBasal-CCCP) was calculated as the mean fluorescence at 60 s before CCCP addition minus mean fluorescence during the last of the last 60 s of the recording, ( C ) Quantification of Δbasal-CCCP fluorescence ( n = 8), ( D ) Representative image of confocal microscopy MitoSOX 5 µM for 0.2 h with CCCP 200 nM for 1 h positive control, ( E ) Quantification of MitoSOX fluorescence ( n = 6), ( F ) Intracellular ATP levels of cells, ( G ) Graphical representation of the movement of calcium into the mitochondria by the Rhod-2 AM (4 µM for 0.2 h) probe in response to histamine 100 mM, ( H ) Area under the curve (AUC) of Ca 2+ movement to the mitochondria by the Rhod-2 AM probe in response to histamine and Slope the first 10 s in response to histamine by the Rhod-2 probe ( n = 4), ( I ) Graphical representation of the cytosolic Ca 2+ by the Fluo-4 AM (4.4 µM for 0.2 h) probe in response to histamine 100 mM, ( J ) Area under the curve (AUC) of Ca 2+ movement to the mitochondria by the Fluo-4 AM probe in response to histamine and Slope the first 10 s in response to histamine by the Fluo-4 AM probe ( n = 5). ( K ) proposed model. One-way analysis of variance (ANOVA) followed by Tukey post hoc test. * p < 0.05 compared with control and square brackets compared with FKBP51 with insulin. Data are shown as means + SEM.
Article Snippet: Cells were transfected with either a plasmid encoding Myc-DDK-tagged
Techniques: Over Expression, Transfection, Plasmid Preparation, Control, Confocal Microscopy, Fluorescence, Positive Control
Journal: Psychoneuroendocrinology
Article Title: DNA methylation and sex-specific expression of FKBP5 as correlates of one-month bedtime cortisol levels in healthy individuals
doi: 10.1016/j.psyneuen.2018.07.003
Figure Lengend Snippet: Demographics, cortisol metrics, FKBP5 expression and psychosocial measures by sex
Article Snippet: PCR Efficiency/Analytical Sensitivity A plasmid DNA containing the full coding sequence for
Techniques: Expressing, Methylation
Journal: Psychoneuroendocrinology
Article Title: DNA methylation and sex-specific expression of FKBP5 as correlates of one-month bedtime cortisol levels in healthy individuals
doi: 10.1016/j.psyneuen.2018.07.003
Figure Lengend Snippet: Shown are: A) CpG-3 methylation vs. awakening cortisol for all subjects, B) CpG-1 methylation vs. bedtime cortisol for all subjects, C) FKBP5 expression vs. bedtime cortisol for all subjects, and D) FKBP5 expression vs. bedtime cortisol for females.
Article Snippet: PCR Efficiency/Analytical Sensitivity A plasmid DNA containing the full coding sequence for
Techniques: Methylation, Expressing
Journal: Psychoneuroendocrinology
Article Title: DNA methylation and sex-specific expression of FKBP5 as correlates of one-month bedtime cortisol levels in healthy individuals
doi: 10.1016/j.psyneuen.2018.07.003
Figure Lengend Snippet: Correlation between FKBP5 methylation (males and females) and expression (females only) vs. mean weekly awakening and bedtime cortisol.
Article Snippet: PCR Efficiency/Analytical Sensitivity A plasmid DNA containing the full coding sequence for
Techniques: Methylation, Expressing
Journal: Psychoneuroendocrinology
Article Title: DNA methylation and sex-specific expression of FKBP5 as correlates of one-month bedtime cortisol levels in healthy individuals
doi: 10.1016/j.psyneuen.2018.07.003
Figure Lengend Snippet: Correlation between FKBP5 expression and mean cortisol metrics, by sex
Article Snippet: PCR Efficiency/Analytical Sensitivity A plasmid DNA containing the full coding sequence for
Techniques: Expressing
Journal: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology
Article Title: Molecular Pathways Leading to Induction of Cell Death and Anti-Proliferative Properties by Tacrolimus and mTOR Inhibitors in Liver Cancer Cells.
doi: 10.33594/000000230
Figure Lengend Snippet: Fig. 7. FKBP12 and FKBP51 protein expressions in Tacrolimus-, Sirolimus- and Everolimus-treated HepG2 (A and B, respectively) and Huh7 (C and D, respectively) cells. Treatments were administered at different concentrations (0, 10 nM, 10 µM, and 100 µM). The protein expression of FKBP12 and FKBP51 was evaluated by Western‐blot analysis as described in Material and Methods. Results are expressed as mean ± SEM, and blots are representative of four to six independent experiments. *p ≤ 0.05 between control and immunosuppressant‐treated cells. The groups with different letters (a, b, c or d) were significantly different (p ≤ 0.05).
Article Snippet: KG Navarro-Villarán et al.: Role of Immunosuppressant and FK506-Binding Protein Complex in Liver Cancer and Ser15P-p53 (#9284) obtained from Cell Signaling Technology (Danvers, Massachusetts, USA); LC3 (PM036) purchased from MBL International (Woburn, Massachusetts, USA); GADD153 (C/EBP homologous protein or CHOP) (sc-575), Beclin (sc-48341), p21 (sc-397) and p53 (sc-6243) obtained from Santa Cruz Biotechnology (Dallas, Texas, USA); Thr172P-Cdk4 (PA5-64482) obtained from ThermoFisher (Waltham, Massachusetts, USA); FKBP12 (Ref NB300-508) and FKBP38 (Ref NBP1-77909) obtained from Novus Biologicals (Centennial, Colorado, USA); and
Techniques: Expressing, Western Blot, Control
Journal: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology
Article Title: Molecular Pathways Leading to Induction of Cell Death and Anti-Proliferative Properties by Tacrolimus and mTOR Inhibitors in Liver Cancer Cells.
doi: 10.33594/000000230
Figure Lengend Snippet: Fig. 9. Impact of FKBP51 downregulation on BrdU incorporation (A) and caspase-3 activity (B) in Tacrolimus-, Sirolimus- and Everolimus-treated HepG2 cells. The downregulation of FKBP51 was carried using siRNA technologies. Cell proliferation and apoptosis were determined using commercial BrdU incorporation and caspase‐3 activity assays respectively as described in Material and Methods. Results are expressed as mean ± SEM of six independent experiments. *p ≤ 0.05 and **p ≤ 0.01 between control and immunosuppressant‐ treated cells. The groups with different letters (a, b, c, d, e or f) were significantly different (p ≤ 0.05).
Article Snippet: KG Navarro-Villarán et al.: Role of Immunosuppressant and FK506-Binding Protein Complex in Liver Cancer and Ser15P-p53 (#9284) obtained from Cell Signaling Technology (Danvers, Massachusetts, USA); LC3 (PM036) purchased from MBL International (Woburn, Massachusetts, USA); GADD153 (C/EBP homologous protein or CHOP) (sc-575), Beclin (sc-48341), p21 (sc-397) and p53 (sc-6243) obtained from Santa Cruz Biotechnology (Dallas, Texas, USA); Thr172P-Cdk4 (PA5-64482) obtained from ThermoFisher (Waltham, Massachusetts, USA); FKBP12 (Ref NB300-508) and FKBP38 (Ref NBP1-77909) obtained from Novus Biologicals (Centennial, Colorado, USA); and
Techniques: BrdU Incorporation Assay, Activity Assay, Control
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: (A) Methylation decreases at selected FKBP5 CpGs along the human lifespan (GTP: β age = -0.0045, SE = 0.0008, p = 8 x 10 -8 ; KORA: β age = -0.0055, SE = 0.0005, p < 2 x 10 -16 ; MPIP: β age = -0.0064, SE = 0.0012, p = 7 x 10 -8 ; total n = 2,523). (B) Depressive phenotypes are associated with accelerated age-related FKBP5 demethylation (total n = 2,249, meta-analysis interaction p = 2.6 x 10 -2 , heterogeneity p = 2.7 x 10 -1 ). Statistics per cohort: GTP: interaction p = 1.9 x 10 -2 , β age for moderate/severe depression = -0.0075 (SE = 0.0014) vs. β age for no/mild depression = -0.0032 (SE = 0.0011); KORA: interaction p = 6.3 x 10 -1 , β age for higher levels of depression = -0.0063 (SE = 0.0011) vs. β age for lower levels of depression = -0.0047 (SE = 0.0007); MPIP: interaction p = 1.9 x 10 -1 , β age for depressed = -0.0077 (SE = 0.0015) vs. β age for non-depressed = -0.0044 (SE = 0.0019). (C) Early life separation is associated with demethylation of the age-related FKBP5 CpGs in the HBCS (βseparation = - 0.0932, SE = 0.0343, p = 7.4 x 10 -3 , mean DNA methylation difference = 1.4%). All coefficients and p values are derived from linear regression models using M-values for DNA methylation and after correcting for potential confounders (see Methods). (D) In vitro aging and exposure to the stress hormone (glucocorticoid) receptor agonist dexamethasone (DEX) additively decrease methylation at the age-related FKBP5 CpGs in the IMR-90 fibroblast model of replicative senescence (F 1,6 = 6.3, interaction p = 4.6 x 10 -2 , n = 4 replicates per age group). Statistical comparisons were performed with two-way mixed-design ANOVA (according to experimental design), using replicative age as the between-subject and DEX treatment as the within-subject factor. Statistically significant effects were followed with Bonferroni-corrected pairwise comparisons, shown as follows: * p < 5 x 10 -2 , statistically significant pairwise comparisons for young vs. old replicative age; # p < 5 x 10 -2 , statistically significant pairwise comparison for vehicle vs. DEX-treated old cells. Error bars depict the standard error around the group mean. The y axes in panels (A), (B), and (C) depict the average DNA methylation levels of the two age-related FKBP5 CpGs (cg20813374 and cg00130530), after adjustment for the respective covariates for each cohort; for a more intuitive visualization, selected panels are also depicted as % DNA methylation (Beta-values in Supplementary Fig. 1). The y axis in panel (D) depicts the average % DNA methylation (Beta-values) of the two FKBP5 CpGs. GTP, Grady Trauma Project; HBCS, Helsinki Birth Cohort Study; KORA, Cooperative Health Research in the Region of Augsburg F4 community study; MPIP, Max Planck Institute of Psychiatry depression case/control study.
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: Methylation, DNA Methylation Assay, Derivative Assay, In Vitro
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: Complementary figure demonstrating how % FKBP5 DNA methylation levels are associated with aging, early life separation, and history of myocardial infarction. The y axis in all panels depicts the average % DNA methylation (Beta-values) of the two age- and stress-related FKBP5 CpGs (cg20813374 and cg00130530). Further details and statistics are provided in main and . GTP, Grady Trauma Project; HBCS, Helsinki Birth Cohort Study; KORA, Cooperative Health Research in the Region of Augsburg F4 community study; MI, myocardial infarction; MPIP, Max Planck Institute of Psychiatry depression case/control study.
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: DNA Methylation Assay
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: Validation of the 450K-identified age-regulated FKBP5 CpGs (cg20813374 and cg00130530) using targeted bisulfite sequencing with the Illumina MiSeq in a sample of female subjects (n = 77, β age = -0.0074, SE = 0.0031, p = 1.9 x 10 -2 ). The y axis depicts the average % DNA methylation (Beta-values) of the two FKBP5 CpGs. Reported statistics are after correcting for potential confounders (see Methods).
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: Methylation Sequencing, DNA Methylation Assay
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: Visual depiction of integrative analysis of chromatin states using ChromHMM (ref 52) within immune cell types, as well as in the IMR-90 fibroblasts that were used as a model of human replicative senescence. Across these cell types, the age- and stress-related FKBP5 CpGs are commonly mapped to an enhancer or flanking active TSS (further details in Supplementary Table 3).
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques:
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: Functional annotation of the FKBP5 locus at and around the age-related FKBP5 CpGs, using the Roadmap Epigenome Browser and the “Mobilized CD34 Primary cells” track as a proxy for peripheral immune cells. The two CpGs (cg20813374 and cg00130530) are respectively located at positions 35657180 and 35657202 of chromosome 6 (exact location indicated by dotted line) and, as shown, exhibit intermediate methylation levels and colocalize with H3K4me1 and H3K27me3 signatures. This landscape is most consistent with a poised enhancer (ref 53).
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: Functional Assay, Methylation
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: (A) FKBP5 expression levels are negatively associated with average methylation of the age-related sites (β = -0.3835, SE = 0.1585, p = 1.6 x 10 -2 ). (B and C) The cortisol- FKBP5 relationship is stronger at lower methylation levels of the age-related FKBP5 CpGs: interaction p = 1.4 x 10 -3 , β cortisol for lower methylation = 0.0299 (SE = 0.0044) vs. β cortisol for higher methylation = 0.0069 (SE = 0.0039). The cortisol- FKBP5 relationship is stronger in older ages: interaction p = 2.4 x 10 -5 , β cortisol for older subjects = 0.0376 (SE = 0.0050) vs. β cortisol for younger subjects = 0.0075 (SE = 0.0035). (D) Higher levels of depressive symptoms are associated with stronger cortisol- FKBP5 relationship in subjects with higher levels of childhood trauma (cortisol-depression interaction p = 7.3 x 10 -5 ) but not in subjects with lower levels of childhood trauma (cortisol-depression interaction p = 1.4 x 10 -1 ) as defined with the Childhood Trauma Questionnaire (CTQ). Panel (A) depicts the average % methylation levels (Beta-values) of the two age-related FKBP5 CpGs (cg20813374 and cg00130530).
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: Expressing, Methylation
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: Methylation levels at the age- and stress-related FKBP5 CpGs (cg20813374 and cg001305030) inversely correlate with FKBP5 mRNA levels in breast tissue samples of control female subjects (n = 84). Publicly available data were analyzed from the Cancer Genome Atlas Wanderer ( http://maplab.imppc.org/wanderer/ ; ref 54). The x axis depicts the average % DNA methylation (Beta-values) of the CpGs. The y axis depicts log2-transformed normalized RSEM RNAseq-measured FKBP5 expression.
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: Methylation, DNA Methylation Assay, Transformation Assay, Expressing
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: (A) FKBP5 -related genes in peripheral blood show enrichment for inflammation-related genes and NF-κB gene targets. Disease association and transcription factor target analyses were performed using genome-wide gene expression data in the Grady Trauma Project cohort (GTP; n = 355). The number of genes for each analysis is shown in parentheses. Statistical details are provided in Supplementary Tables 5-9. (B) Western blotting confirming FKBP5 overexpression in Jurkat T cells transfected with FKBP51-FLAG vs. cells transfected with the control vector. (C) FKBP5 overexpression nearly doubles IL-8 secretion by Jurkat T cells stimulated overnight with 25 ng/ml of Phorbol-12-myristate-13-acetate and 375 ng/ml of ionomycin (PMA/I). The bar graph depicts IL-8 secretion in stimulated cell supernatants measured with ELISA from two independent experiments (t = 8.8, p = 4.4 x 10 -7 , n = 8 per condition). For each experiment, fold ratios of IL-8 secretion were calculated relative to stimulated cells expressing the control vector. IL-8 was not detectable in non-stimulated cells (not shown). (D) FKBP5 overexpression increases NF-κB activity in stimulated Jurkat T cells. The bar graph depicts NF-κB reporter activity in stimulated cells measured with dual-luciferase reporter assays from three independent experiments (t = 3.2, p = 5.5 x 10 -3 , n = 9 per condition). For each experiment, fold ratios of NF-κB activity were calculated relative to non-stimulated cells expressing the control vector. (E) FKBP5 expression changes are associated with extensive alterations in the NF-κB co-expression network in the GTP (n = 355). The circles depict genes encoding molecular partners of the NF-κB pathway. Continuous lines (edges) represent positive and dotted lines negative pairwise correlations corrected for expression levels of all other genes in the pathway (details in Methods). Edge widths are proportional to the absolute value of the respective correlation coefficient. The gene pair with the most robust difference in correlation between the two groups ( CHUK-MAP3K14 ) is highlighted in orange. Statistical details for all gene pairs are provided in Supplementary Table 10. Error bars depict the standard error around the group mean. ** p < 10 -2 ; *** p < 10 -3 .
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: Genome Wide, Expressing, Western Blot, Over Expression, Transfection, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Activity Assay, Luciferase
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: Association of FKBP5 expression levels with the granulocyte to lymphocyte ratio (n = 330), an inflammation marker linked with heightened cardiovascular risk and mortality. Reported statistics and depicted residuals (on the x axis) are after correcting for covariates (see Methods).
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: Expressing, Marker
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: (A) Immunoprecipitation (IP) for either FKBP5 or NIK followed by Western blotting in lysates from Jurkat cells or peripheral blood monocytes (PBMC) treated for 24 hours with the stress hormone (glucocorticoid) receptor agonist dexamethasone (DEX, 100nM), which robustly induces FKBP5 expression, and/or selective FKBP5 antagonists (SAFit1, 100nM). IgG: control IP without primary antibody. (B) Quantifications of respective IPs showing DEX-induced increase in FKBP5-NIK-IKKα binding that is prevented by concomitant treatment with SAFit1 (Jurkat: FKBP5 to NIK binding, DEX x SAFit1 F 1,8 = 9.3, interaction p = 1.6 x 10 -2 ; IKKα to FKBP5 binding, DEX x SAFit1 F 1,8 = 4.7, interaction p = 6.2 x 10 -2 ; IKKα to NIK binding, DEX x SAFit1 F 1,8 = 5.8, interaction p = 4.3 x 10 -2 . PBMC: FKBP5 to NIK binding, DEX x SAFit1 F 1,8 = 5.7, interaction p = 4.4 x 10 -2 ; IKKα to FKBP5 binding, DEX x SAFit1 F 1,8 = 11.2, interaction p = 1 x 10 -2 ; IKKα to NIK binding, DEX x SAFit1 F 1,8 = 3.9, interaction p = 8.4 x 10 -2 . n = 3 biological replicates per condition). (C) Western blotting of Jurkat cell and PBMC lysates (n = 3 replicates per condition) showing increase in the functional phosphorylation of IKKα at serine 176 (pIKKα) by 24-hour treatment with 100nM DEX, which is prevented by 24-hour treatment with 100nM SAFit1 (Jurkat: DEX x SAFit1 F 1,8 = 12.9, interaction p = 7 x 10 -3 ; PBMC: DEX x SAFit1 F 1,8 = 0.6, interaction p = 4.6 x 10 -1 ). (D) Similar effects are observed when Jurkat cells are transfected with an expression construct encoding FKBP5 and treated for 24 hours with 100nM SAFit1 (ect. FKBP5 x SAFit1 F 1,12 = 6.6, interaction p = 2.5 x 10 -2 , n = 4 replicates per condition). (E) FKBP5 overexpression increases NF-κB activity in Jurkat cells stimulated overnight with 25 ng/ml of Phorbol-12-myristate-13-acetate and 375 ng/ml of ionomycin, and this increase is prevented by concomitant treatment with 100nM SAFit1 for 24 hours (ect. FKBP5 x SAFit1 F 1,32 = 4.5, interaction p = 4.2 x 10 -2 , n = 9 replicates per condition). NF-κB reporter activity was measured with dual-luciferase reporter assays in three independent experiments. (F) Scheme summarizing the results from protein-protein binding and reporter gene experiments. All data are shown as fold changes compared to the control-vector vehicle-treated cells. All statistical comparisons were performed with two-way ANOVA, using either DEX treatment or FKBP5 overexpression as the first factor and SAFit1 treatment as the second factor. Statistically significant effects were followed with Bonferroni-corrected pairwise comparisons, shown as follows:* p < 5 x 10 -2 , ** p < 10 -2 , *** p < 10 -3 , statistically significant pairwise comparisons for control vs. DEX or ectopic FKBP5 ; # p < 5 x 10 -2 , ## p < 10 -2 , ### p < 10 -3 , significant pairwise comparisons for vehicle vs. SAFit1 treatment (shown only for significant interaction terms from two-way ANOVAs). Error bars depict the standard error around the group mean.
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: Immunoprecipitation, Western Blot, Expressing, Binding Assay, Functional Assay, Transfection, Construct, Over Expression, Activity Assay, Luciferase, Protein Binding, Plasmid Preparation
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: The effect of the stress hormone (glucocorticoid) receptor agonist dexamethasone (DEX) on functional phosphorylation of IKKα at serine 176 (pIKKα) is abolished in Jurkat cells lacking FKBP5 . FKBP5 knockout cells were generated using CRISPR/Cas9 technology. (A) Representative Western blots in lysates of Jurkat cells with or without the FKBP5 gene treated for 24 hours with DEX (100nM), which robustly induces FKBP5 expression, or vehicle (DMSO). ( B ) Western blots were quantified, and pIKKα levels were normalized to total IKKα levels and are shown as fold changes in comparison to wild-type (FKBP5 +) vehicle-treated cells. The treatment-genotype interaction was tested using two-way ANOVA (F 1,8 = 8.1, interaction p = 2.2 x 10 -2 , n = 3 replicates per condition) and significant effects were followed with -2 Bonferroni-corrected pairwise comparisons. ** p < 10 -2 , statistically significant pairwise comparisons for vehicle vs. DEX. ## p < 10 -2 , statistically significant pairwise comparisons for cells with (wild-type) vs. cells without FKBP5 (knockout).
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: Functional Assay, Knock-Out, Generated, CRISPR, Western Blot, Expressing
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: Annotation of the age- and stress-related FKBP5 CpGs and the constructs used to characterize their function. The figure shows in detail the 5’-3’ sequence upstream of the FKBP5 transcription start site of the DNA stretch (length 224 bp) that was inserted into the CpG-free luciferase reporter vector (ref 63). The black bold letters highlight the sequence of the biotinylated probe (length 70 bp) used for the biotinylated oligonucleotide-mediated chromatin immunoprecipitation. The pink letters highlight the age- and stress-related FKBP5 CpGs. The underlined sequence and label highlight the NF-κB response element (NF-κB RE). As shown, both constructs include the CpGs and response element of interest, while they also completely lack other CpG sites to avoid non-specific CpG methylation effects.
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: Construct, Sequencing, Luciferase, Plasmid Preparation, Chromatin Immunoprecipitation, CpG Methylation Assay
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: (A) Data from dual luciferase reporter gene assays using a CpG-free luciferase reporter vector to which the FKBP5 sequence that surrounds the NF-κB response element was inserted, and which includes the two CpGs of interest but completely lacks other CpG sites (insert sequence shown in Supplementary Fig. 9). This reporter construct was in vitro methylated and transfected into monocyte-derived human cell lines (THP-1). Cells were then stimulated overnight with 25ng/ml Phorbol-12-myristate-13-acetate and 375ng/ml ionomycin (PMA/I), a combination that robustly induces NF-κB signaling. Data are derived from two independent experiments (n = 12 replicates per condition). Comparison was performed using two-way ANOVA with methylation and treatment as factors (F 1,44 = 59.5, interaction p < 10 -3 ), and statistically significant effects were followed with Bonferroni-corrected pairwise comparisons. (B-D) The effect of in vitro DNA methylation on PMA/I-induced NF-κB binding to the NF-κB response element was examined using biotinylated oligonucleotide-mediated chromatin immunoprecipitation (ChIP) in THP-1 cells (oligonucleotide sequence shown in Supplementary Fig. 9). Schematic summary of the experimental setup is shown in B (the lower NF-κB color intensity indicates the expected lower NF-κB binding following in vitro DNA methylation). After ChIP, NF-κB/p65 binding was quantified by Western blotting using antibodies specific for NF-κB (C: example blots; D: quantifications). CTRL (Control) 1: magnetic beads lacking conjugated streptavidin; CTRL 2: cells transfected with non-biotinylated oligonucleotide. Bar graph shows data derived from four independent experiments (t = 2.5, p = 4.4 x 10 -2 , n = 4 per condition). Statistical t-test compared cells carrying the unmethylated probe that were treated overnight with vehicle or PMA/I. Binding was not quantifiable for cells carrying the methylated probe. Data are always shown as fold changes compared to the vehicle-unmethylated cells. Error bars depict the standard error around the group mean. P values for pairwise comparison are shown as follows: *** p < 10 -3 , statistically significant pairwise comparisons for methylated vs. unmethylated. # p < 5 x 10 -2 ; ### p < 10 -3 , statistically significant pairwise comparisons for vehicle vs. drug treatment.
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: Luciferase, Plasmid Preparation, Sequencing, Construct, In Vitro, Methylation, Transfection, Derivative Assay, DNA Methylation Assay, Binding Assay, Chromatin Immunoprecipitation, Western Blot, Magnetic Beads
Journal: bioRxiv
Article Title: Epigenetic derepression of FKBP5 by aging and stress contributes to NF-ĸB-driven inflammation and cardiovascular risk
doi: 10.1101/484709
Figure Lengend Snippet: ( A ) Age- and stress-related decrease in FKBP5 DNA methylation is associated with a history of myocardial infarction in two independent cohorts: the KORA, n = 1,648 subjects without vs. 62 with history of MI, β MI = -0.0470, SE = 0.0231, p = 4.1 x 10 -2 , mean DNA methylation difference = 1.8%; and the MPIP, n = 310 subjects without vs. 8 with history of MI, β MI = -0.2300, SE = 0.1177, p = 5.2 x 10 -2 , mean DNA methylation difference = 5.3%; total n = 2,028, meta-analysis p = 1.7 x 10 -2 , heterogeneity p = 1.3 x 10 -1 . The y axis depicts average DNA methylation levels of the two age-regulated FKBP5 CpGs (cg20813374 and cg00130530), after adjusting for confounders (see Methods). Error bars depict the standard error around the group mean. * p < 5 x 10 -2 . ( B ) Schematic summary of study’s findings showing how aging, childhood trauma, and depressive symptoms interact to demethylate FKBP5 at selected promoter CpGs (cg00130530 and cg20813374) located proximally (< 500 bp) upstream the transcription start site (TSS). These epigenetic changes can derepress FKBP5 responses in immune cells, an effect that in turn promotes NF-κB signaling, whereas this is prevented in immune cells concomitantly treated with selective FKBP5 antagonists. Notably, NF-κB signaling is not only activated by FKBP5, but it can also trigger FKBP5 transcription through an NF-κB response element that is flanked and moderated by the age/stress-related CpGs. This forms a positive feedback loop of FKBP5-NF-κB signaling that may be enhanced in individuals with lower methylation at this site. Derepressed FKBP5 responses and NF-κB activity may promote chemotaxis of proinflammatory cells and peripheral inflammation, potentially contributing to cardiovascular risk. KORA, Cooperative Health Research in the Region of Augsburg F4 community study; MPIP, Max Planck Institute of Psychiatry depression case/control study.
Article Snippet: The following primary antibodies were used: FLAG (1:7,000, Rockland, 600-401-383),
Techniques: DNA Methylation Assay, Methylation, Activity Assay, Chemotaxis Assay
Journal: Journal of Endocrinology
Article Title: Androgens modulate glucocorticoid receptor activity in adipose tissue and liver
doi: 10.1530/joe-18-0503
Figure Lengend Snippet: Figure 7 AR signaling modulates 11BHSD1 and contributes to GR-regulated transcriptional activity in WAT but not liver. (A, B, C and D) Hsd11b1 mRNA and 11BHSD1 protein expression in WAT and liver upon glucocorticoid and androgen interventions. (E and F) The relationship between CORT levels and the expression of GR-responsive genes Fkbp5, Gilz and Mt2a in WAT and liver. Data are mean ± s.e.m. and N = 6–7 per group. Statistical significance was calculated using a one-way ANOVA with the Tukey multiple-comparisons test. *P < 0.05 vs Vehicle, **P < 0.01 vs Vehicle, $P < 0.05 vs CORT, $$P < 0.01 vs CORT. Representative Western images are shown and quantification of protein expression is based on 6 per group. GAPDH loading controls in Fig. 7D are identical to the ones shown in Fig. 3K.
Article Snippet: The following primary and secondary antibodies were used:
Techniques: Activity Assay, Expressing, Western Blot