factorial design functionality Search Results


gene exp egfr mm00433023 m1  (Thermo Fisher)
93
Thermo Fisher gene exp egfr mm00433023 m1
<t>Egfr</t> activity contributes to RT2 tumor growth and angiogenic switching. ( A ) Relative expression quantified by real-time quantitative PCR of Erbb family members in cDNAs derived from total RNA extracts of successive stages of pancreatic neuroendocrine tumorigenesis from RIP1-Tag2 (RT2) transgenic mice (NI = normal islets; HI = hyperplastic islets; AI = angiogenic islets; IT = islet tumors). Levels of mRNAs are expressed as a percentage of the mGus control mRNA. ( B ) Western blot analysis of protein extracts from successive stages of RT2-derived lesions. ( C ) Western blot analysis of protein extracts from RT2-derived tumors 4 h after treatment with a vehicle solution or erlotinib (80 mg/kg). ( D-F ) Comparison of the average tumor burden of RT2 mice treated daily with a control solution (vehicle) or with ( D ) gefitinib (80 mg/kg), ( E ) CI-1033 (80 mg/kg), both from 11.5 to 14.5 weeks of age, or with ( F ) erlotinib (80 mg/kg), from 12 to 16 weeks of age with an additional vehicle-treated time point at 14 weeks. ( G ) Comparison of the average number of hemorrhagic angiogenic islets per pancreas of RT2 mice treated daily with a vehicle solution or with erlotinib (80 mg/kg) or CI-1033 (80 mg/kg) from 6 to 9 weeks of age. ( N = number of animals per treatment group). * P < 0.01.
Gene Exp Egfr Mm00433023 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/factorial+design+functionality/Gene+Exp%2E+Egfr%2C+Mm00433023_m1/pmc02958675-157-19-10
Average 93 stars, based on 1 article reviews
gene exp egfr mm00433023 m1 - by Bioz Stars, 2026-11
93/100 stars
  Buy from Supplier
c_26292282_10  (Thermo Fisher)
85
Thermo Fisher c_26292282_10
<t>Egfr</t> activity contributes to RT2 tumor growth and angiogenic switching. ( A ) Relative expression quantified by real-time quantitative PCR of Erbb family members in cDNAs derived from total RNA extracts of successive stages of pancreatic neuroendocrine tumorigenesis from RIP1-Tag2 (RT2) transgenic mice (NI = normal islets; HI = hyperplastic islets; AI = angiogenic islets; IT = islet tumors). Levels of mRNAs are expressed as a percentage of the mGus control mRNA. ( B ) Western blot analysis of protein extracts from successive stages of RT2-derived lesions. ( C ) Western blot analysis of protein extracts from RT2-derived tumors 4 h after treatment with a vehicle solution or erlotinib (80 mg/kg). ( D-F ) Comparison of the average tumor burden of RT2 mice treated daily with a control solution (vehicle) or with ( D ) gefitinib (80 mg/kg), ( E ) CI-1033 (80 mg/kg), both from 11.5 to 14.5 weeks of age, or with ( F ) erlotinib (80 mg/kg), from 12 to 16 weeks of age with an additional vehicle-treated time point at 14 weeks. ( G ) Comparison of the average number of hemorrhagic angiogenic islets per pancreas of RT2 mice treated daily with a vehicle solution or with erlotinib (80 mg/kg) or CI-1033 (80 mg/kg) from 6 to 9 weeks of age. ( N = number of animals per treatment group). * P < 0.01.
C 26292282 10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/factorial+design+functionality/C_26292282_10/pmc03869968-68-23-20
Average 85 stars, based on 1 article reviews
c_26292282_10 - by Bioz Stars, 2026-11
85/100 stars
  Buy from Supplier
event related fmri design  (Psychology Software Tools)
99
Psychology Software Tools event related fmri design
<t>Egfr</t> activity contributes to RT2 tumor growth and angiogenic switching. ( A ) Relative expression quantified by real-time quantitative PCR of Erbb family members in cDNAs derived from total RNA extracts of successive stages of pancreatic neuroendocrine tumorigenesis from RIP1-Tag2 (RT2) transgenic mice (NI = normal islets; HI = hyperplastic islets; AI = angiogenic islets; IT = islet tumors). Levels of mRNAs are expressed as a percentage of the mGus control mRNA. ( B ) Western blot analysis of protein extracts from successive stages of RT2-derived lesions. ( C ) Western blot analysis of protein extracts from RT2-derived tumors 4 h after treatment with a vehicle solution or erlotinib (80 mg/kg). ( D-F ) Comparison of the average tumor burden of RT2 mice treated daily with a control solution (vehicle) or with ( D ) gefitinib (80 mg/kg), ( E ) CI-1033 (80 mg/kg), both from 11.5 to 14.5 weeks of age, or with ( F ) erlotinib (80 mg/kg), from 12 to 16 weeks of age with an additional vehicle-treated time point at 14 weeks. ( G ) Comparison of the average number of hemorrhagic angiogenic islets per pancreas of RT2 mice treated daily with a vehicle solution or with erlotinib (80 mg/kg) or CI-1033 (80 mg/kg) from 6 to 9 weeks of age. ( N = number of animals per treatment group). * P < 0.01.
Event Related Fmri Design, supplied by Psychology Software Tools, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/factorial+design+functionality/E-Prime/10__1016_slash_j__jneuroling__2021__101041-179-8-15
Average 99 stars, based on 1 article reviews
event related fmri design - by Bioz Stars, 2026-11
99/100 stars
  Buy from Supplier
il 27  (Boster Bio)
90
Boster Bio il 27
PD-L1 expression positively correlates with proinflammatory markers in M1-polarized macrophages. (A-C) PD-L1-overexpressing (PD-L1 HI ) and control (PD-L1 NC ) THP-1-M cells were stimulated with LPS (100 ng/ml) + IFN-γ (20 ng/ml) for 12 h followed by RNA sequencing. A Heatmap of inflammatory gene expression in PD-L1 HI vs. PD-L1 NC cells. B MA plot showing differential gene expression between PD-L1 HI and PD-L1 NC cells. C TPM expression values of <t>IL-6,</t> <t>IL-27</t> and NOS2. D - E PD-L1 HI and PD-L1 NC cells were stimulated with LPS + IFN-γ for 24 h. ( n = 3 independent biological replicates) ( D ) qRT-PCR analysis of IL-6, IL-27 and NOS2 mRNA levels ( n = 3 independent biological replicates). E ELISA for IL-6/IL-27 and Griess reagent assay for NO in supernatants ( n = 3 independent biological replicates). (F-G) PD-L1-knockout THP-1-M (PD-L1 KO /THP-1-M) and PD-L1 NC /THP-1-M were stimulated with LPS + IFN-γ for 24 h. F qRT-PCR analysis of IL-6, IL-27 and NOS2 mRNA levels ( n = 3 independent biological replicates). G ELISA and Griess reagent detection of IL-6/IL-27 proteins and NO in supernatants ( n = 3 independent biological replicates). The data are presented as the mean ± SEM. Statistical analysis for C, D, E, F and G was performed by Student’s t-test. * p < 0.05
Il 27, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/factorial+design+functionality/Human+SF20%2FIL-25+Recombinant+Protein/pmc12817491-73-0-16
Average 90 stars, based on 1 article reviews
il 27 - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
elongation factor 1 gene  (PrimerDesign Inc)
90
PrimerDesign Inc elongation factor 1 gene
PD-L1 expression positively correlates with proinflammatory markers in M1-polarized macrophages. (A-C) PD-L1-overexpressing (PD-L1 HI ) and control (PD-L1 NC ) THP-1-M cells were stimulated with LPS (100 ng/ml) + IFN-γ (20 ng/ml) for 12 h followed by RNA sequencing. A Heatmap of inflammatory gene expression in PD-L1 HI vs. PD-L1 NC cells. B MA plot showing differential gene expression between PD-L1 HI and PD-L1 NC cells. C TPM expression values of <t>IL-6,</t> <t>IL-27</t> and NOS2. D - E PD-L1 HI and PD-L1 NC cells were stimulated with LPS + IFN-γ for 24 h. ( n = 3 independent biological replicates) ( D ) qRT-PCR analysis of IL-6, IL-27 and NOS2 mRNA levels ( n = 3 independent biological replicates). E ELISA for IL-6/IL-27 and Griess reagent assay for NO in supernatants ( n = 3 independent biological replicates). (F-G) PD-L1-knockout THP-1-M (PD-L1 KO /THP-1-M) and PD-L1 NC /THP-1-M were stimulated with LPS + IFN-γ for 24 h. F qRT-PCR analysis of IL-6, IL-27 and NOS2 mRNA levels ( n = 3 independent biological replicates). G ELISA and Griess reagent detection of IL-6/IL-27 proteins and NO in supernatants ( n = 3 independent biological replicates). The data are presented as the mean ± SEM. Statistical analysis for C, D, E, F and G was performed by Student’s t-test. * p < 0.05
Elongation Factor 1 Gene, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/factorial+design+functionality/elongation+factor+1+gene/pm19754635-138-4-8
Average 90 stars, based on 1 article reviews
elongation factor 1 gene - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
gdnf antibodies  (R&D Systems)
90
R&D Systems gdnf antibodies
PD-L1 expression positively correlates with proinflammatory markers in M1-polarized macrophages. (A-C) PD-L1-overexpressing (PD-L1 HI ) and control (PD-L1 NC ) THP-1-M cells were stimulated with LPS (100 ng/ml) + IFN-γ (20 ng/ml) for 12 h followed by RNA sequencing. A Heatmap of inflammatory gene expression in PD-L1 HI vs. PD-L1 NC cells. B MA plot showing differential gene expression between PD-L1 HI and PD-L1 NC cells. C TPM expression values of <t>IL-6,</t> <t>IL-27</t> and NOS2. D - E PD-L1 HI and PD-L1 NC cells were stimulated with LPS + IFN-γ for 24 h. ( n = 3 independent biological replicates) ( D ) qRT-PCR analysis of IL-6, IL-27 and NOS2 mRNA levels ( n = 3 independent biological replicates). E ELISA for IL-6/IL-27 and Griess reagent assay for NO in supernatants ( n = 3 independent biological replicates). (F-G) PD-L1-knockout THP-1-M (PD-L1 KO /THP-1-M) and PD-L1 NC /THP-1-M were stimulated with LPS + IFN-γ for 24 h. F qRT-PCR analysis of IL-6, IL-27 and NOS2 mRNA levels ( n = 3 independent biological replicates). G ELISA and Griess reagent detection of IL-6/IL-27 proteins and NO in supernatants ( n = 3 independent biological replicates). The data are presented as the mean ± SEM. Statistical analysis for C, D, E, F and G was performed by Student’s t-test. * p < 0.05
Gdnf Antibodies, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/factorial+design+functionality/Human%2FRat+GDNF+Antibody/pm21871541-51-11-13
Average 90 stars, based on 1 article reviews
gdnf antibodies - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
mouse neudesin  (Shanghai Korain Biotech Co Ltd)
N/A
Acts as a neurotrophic factor in postnatal mature neurons, enhancing neuronal survival (PubMed: 15605373, PubMed: 31536960). Promotes cell proliferation and neurogenesis in undifferentiated neural pro-genitor cells at the embryonic stage and inhibits differentiation of astrocytes
   Buy from Supplier
human neudesin elisa kit picokine  (Boster Bio)
N/A
Human Neudesin ELISA Kit PicoKine® (96 Tests). Quantitate Human NENF in cell culture supernatants, serum and plasma (heparin, EDTA). Sensitivity: 15pg/ml. The brand Picokine indicates this is a premium quality ELISA kit. Each Picokine kit
   Buy from Supplier
neudesin neurotrophic factor human recombinant  (Angio-Proteomie)
N/A
NENF Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (aa 32-172) containing 151 amino acids including a 10 a.a N-terminal His tag
   Buy from Supplier
neudesin antibody  (ProSci Incorporated)
N/A
Neudesin Antibody raised in Goat validated in E.
   Buy from Supplier
human neudesin  (Shanghai Korain Biotech Co Ltd)
N/A
Acts as a neurotrophic factor in postnatal mature neurons enhancing neuronal survival (PubMed: 31536960). Promotes cell proliferation and neurogenesis in undifferentiated neural progenitor cells at the embryonic stage and inhibits differentiation of astrocytes (By similarity).
   Buy from Supplier

Image Search Results


Egfr activity contributes to RT2 tumor growth and angiogenic switching. ( A ) Relative expression quantified by real-time quantitative PCR of Erbb family members in cDNAs derived from total RNA extracts of successive stages of pancreatic neuroendocrine tumorigenesis from RIP1-Tag2 (RT2) transgenic mice (NI = normal islets; HI = hyperplastic islets; AI = angiogenic islets; IT = islet tumors). Levels of mRNAs are expressed as a percentage of the mGus control mRNA. ( B ) Western blot analysis of protein extracts from successive stages of RT2-derived lesions. ( C ) Western blot analysis of protein extracts from RT2-derived tumors 4 h after treatment with a vehicle solution or erlotinib (80 mg/kg). ( D-F ) Comparison of the average tumor burden of RT2 mice treated daily with a control solution (vehicle) or with ( D ) gefitinib (80 mg/kg), ( E ) CI-1033 (80 mg/kg), both from 11.5 to 14.5 weeks of age, or with ( F ) erlotinib (80 mg/kg), from 12 to 16 weeks of age with an additional vehicle-treated time point at 14 weeks. ( G ) Comparison of the average number of hemorrhagic angiogenic islets per pancreas of RT2 mice treated daily with a vehicle solution or with erlotinib (80 mg/kg) or CI-1033 (80 mg/kg) from 6 to 9 weeks of age. ( N = number of animals per treatment group). * P < 0.01.

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Egfr activity contributes to RT2 tumor growth and angiogenic switching. ( A ) Relative expression quantified by real-time quantitative PCR of Erbb family members in cDNAs derived from total RNA extracts of successive stages of pancreatic neuroendocrine tumorigenesis from RIP1-Tag2 (RT2) transgenic mice (NI = normal islets; HI = hyperplastic islets; AI = angiogenic islets; IT = islet tumors). Levels of mRNAs are expressed as a percentage of the mGus control mRNA. ( B ) Western blot analysis of protein extracts from successive stages of RT2-derived lesions. ( C ) Western blot analysis of protein extracts from RT2-derived tumors 4 h after treatment with a vehicle solution or erlotinib (80 mg/kg). ( D-F ) Comparison of the average tumor burden of RT2 mice treated daily with a control solution (vehicle) or with ( D ) gefitinib (80 mg/kg), ( E ) CI-1033 (80 mg/kg), both from 11.5 to 14.5 weeks of age, or with ( F ) erlotinib (80 mg/kg), from 12 to 16 weeks of age with an additional vehicle-treated time point at 14 weeks. ( G ) Comparison of the average number of hemorrhagic angiogenic islets per pancreas of RT2 mice treated daily with a vehicle solution or with erlotinib (80 mg/kg) or CI-1033 (80 mg/kg) from 6 to 9 weeks of age. ( N = number of animals per treatment group). * P < 0.01.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Activity Assay, Expressing, Real-time Polymerase Chain Reaction, Derivative Assay, Transgenic Assay, Control, Western Blot, Comparison

Phenotype of epidermal growth factor receptor (EGFR) inhibitor-treated pancreatic neuroendocrine tumorigenesis (PNET) tumors from RT2 mice. ( A ) Average percentage of dividing tumor cells (BrdU-positive) in vehicle- or erlotinib-treated mice following 1 week of treatment. ( B-C ) Representative micrographs of tumors from ( B ) vehicle- or ( C ) erlotinib-treated RT2 mice stained with an anti-BrdU antibody (200x). ( D ) Average percentage of apoptotic tumor cells (TdT-mediated dUTP-biotin nick end-labeling [TUNEL] positive) in tumors from vehicle- or erlotinib-treated mice following 1 week of treatment. ( E-F ) Representative micrographs of ( E ) vehicle- or ( F ) erlotinib-treated tumors stained with an anti-digoxigenin antibody following Tunel procedure (200x). ( G ) Average number of blood vessels per field (FITC-positive continuous segments) in vehicle- or erlotinib-treated mice following 1 week of treatment. ( H-I ) Representative micrographs of ( H ) vehicle- or ( I ) erlotinib-treated tumors that were collected following systemic perfusion with FITC-lectin to visualize the functional tumor vasculature (green); counterstaining with DAPI reveals the cellularity (blue) (200x). The panels are representative of 2 fields of tissue sections obtained from tumors in at least 4 treated RT2 mice. ( N = number of independent tumors analyzed per treatment group). * P < 0.001. ** P < 0.02.

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Phenotype of epidermal growth factor receptor (EGFR) inhibitor-treated pancreatic neuroendocrine tumorigenesis (PNET) tumors from RT2 mice. ( A ) Average percentage of dividing tumor cells (BrdU-positive) in vehicle- or erlotinib-treated mice following 1 week of treatment. ( B-C ) Representative micrographs of tumors from ( B ) vehicle- or ( C ) erlotinib-treated RT2 mice stained with an anti-BrdU antibody (200x). ( D ) Average percentage of apoptotic tumor cells (TdT-mediated dUTP-biotin nick end-labeling [TUNEL] positive) in tumors from vehicle- or erlotinib-treated mice following 1 week of treatment. ( E-F ) Representative micrographs of ( E ) vehicle- or ( F ) erlotinib-treated tumors stained with an anti-digoxigenin antibody following Tunel procedure (200x). ( G ) Average number of blood vessels per field (FITC-positive continuous segments) in vehicle- or erlotinib-treated mice following 1 week of treatment. ( H-I ) Representative micrographs of ( H ) vehicle- or ( I ) erlotinib-treated tumors that were collected following systemic perfusion with FITC-lectin to visualize the functional tumor vasculature (green); counterstaining with DAPI reveals the cellularity (blue) (200x). The panels are representative of 2 fields of tissue sections obtained from tumors in at least 4 treated RT2 mice. ( N = number of independent tumors analyzed per treatment group). * P < 0.001. ** P < 0.02.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Staining, End Labeling, TUNEL Assay, Functional Assay

Distinct pools of Egfr activity in cancer cells and perivascular cells. ( A ) Expression of cell-type defining genes m-Insulin1 , Pecam1 , Pdgfr -β, Ptprt , and of Egfr , Hb-egf , and Tgf -α in sorted cells from RT2-derived PNET tumors (NS = nonsorted cells; EC = endothelial cells; PC = pericytes; IC = immune cells; TC = unlabeled tumor cells) relative to the expression detected in nonsorted cells (NS = 1). Gene expression in each cellular fraction was normalized to levels of Cyclophilin . ( B ) Comparison of the relative in vitro growth of 2 RT2 tumor-derived cancer cell lines (BTC3 and BTC4) following 3 days of treatment with DMSO or gefitinib 5 μM. ( C ) Anti-NG2 staining (red) reveals pericytes (200x). ( D ) Co-localization of NG2 (red) with phospho-EGFR Tyr1068 (pEgfr, green) (200x). ( E ) High magnification confocal localization reveals expression of phospho-Egfr (green) in pericytes expressing NG2 (red) (1600x). ( F ) High-magnification confocal localization of phospho-Egfr (green) and an endothelial specific marker (Meca-32, red) does not indicate Egfr activity in tumor endothelial cells (2,000x). ( C-H ) Micrographs are representative of multiple fields of more than 10 tumors from at least 3 independent RT2 mice.

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Distinct pools of Egfr activity in cancer cells and perivascular cells. ( A ) Expression of cell-type defining genes m-Insulin1 , Pecam1 , Pdgfr -β, Ptprt , and of Egfr , Hb-egf , and Tgf -α in sorted cells from RT2-derived PNET tumors (NS = nonsorted cells; EC = endothelial cells; PC = pericytes; IC = immune cells; TC = unlabeled tumor cells) relative to the expression detected in nonsorted cells (NS = 1). Gene expression in each cellular fraction was normalized to levels of Cyclophilin . ( B ) Comparison of the relative in vitro growth of 2 RT2 tumor-derived cancer cell lines (BTC3 and BTC4) following 3 days of treatment with DMSO or gefitinib 5 μM. ( C ) Anti-NG2 staining (red) reveals pericytes (200x). ( D ) Co-localization of NG2 (red) with phospho-EGFR Tyr1068 (pEgfr, green) (200x). ( E ) High magnification confocal localization reveals expression of phospho-Egfr (green) in pericytes expressing NG2 (red) (1600x). ( F ) High-magnification confocal localization of phospho-Egfr (green) and an endothelial specific marker (Meca-32, red) does not indicate Egfr activity in tumor endothelial cells (2,000x). ( C-H ) Micrographs are representative of multiple fields of more than 10 tumors from at least 3 independent RT2 mice.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Activity Assay, Expressing, Derivative Assay, Gene Expression, Comparison, In Vitro, Staining, Marker

Contributions of Hb-egf and Egfr to pericyte coverage of the tumor neovasculature. ( A-D, G ) Pericyte coverage of the endothelium as a percentage of total vessel area in different stages and genetic contexts. ( A ) Comparison of vehicle- and erlotinib-treated tumors from 14-week-old RT2 mice. ( B ) Comparison of angiogenic islets from 9-week-old wild-type versus Hb-egf mutant RT2 mice. ( C ) Comparison of wild-type versus Hb-egf mutant tumors from 14-week-old RT2 mice. ( D ) Comparison of small wild-type and Hb-egf mutant tumors (ø < 3 mm) from 14-week-old RT2 mice. ( G ) Comparison of wild-type and mutant exocrine pancreas. ( E-F ) Representative staining of angiogenic microvessels (with Meca-32; red) and pericytes (with Desmin; green) (400x) in small ( E ) wild-type and ( F ) Hb-egf mutant tumors. ( N = number of fields of tumors or angiogenic islet analyzed per genotype or treatment group; 1-2 fields per lesion analyzed.) ( H-I ) Representative staining of a pericyte marker (NG2; red) and activated phospho-Egfr (green) in tumors from ( H ) wild-type or ( I ) Hb-egf mutant RT2 mice. Micrographs are representative of several fields of more than 10 RT2 tumors from at least 3 independent mice of each genotype. * P < 0.05. ** P < 0.01. *** P < 0.001.

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Contributions of Hb-egf and Egfr to pericyte coverage of the tumor neovasculature. ( A-D, G ) Pericyte coverage of the endothelium as a percentage of total vessel area in different stages and genetic contexts. ( A ) Comparison of vehicle- and erlotinib-treated tumors from 14-week-old RT2 mice. ( B ) Comparison of angiogenic islets from 9-week-old wild-type versus Hb-egf mutant RT2 mice. ( C ) Comparison of wild-type versus Hb-egf mutant tumors from 14-week-old RT2 mice. ( D ) Comparison of small wild-type and Hb-egf mutant tumors (ø < 3 mm) from 14-week-old RT2 mice. ( G ) Comparison of wild-type and mutant exocrine pancreas. ( E-F ) Representative staining of angiogenic microvessels (with Meca-32; red) and pericytes (with Desmin; green) (400x) in small ( E ) wild-type and ( F ) Hb-egf mutant tumors. ( N = number of fields of tumors or angiogenic islet analyzed per genotype or treatment group; 1-2 fields per lesion analyzed.) ( H-I ) Representative staining of a pericyte marker (NG2; red) and activated phospho-Egfr (green) in tumors from ( H ) wild-type or ( I ) Hb-egf mutant RT2 mice. Micrographs are representative of several fields of more than 10 RT2 tumors from at least 3 independent mice of each genotype. * P < 0.05. ** P < 0.01. *** P < 0.001.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Comparison, Mutagenesis, Staining, Marker

Mesenchymal-derived Hb-egf activates Egfr inside tumor pericytes. ( A-B ) Co-staining of Hb-egf staining (red) and Meca-32 (endothelial cell marker; green) by confocal microscopy (2,520x) reveals both cancer cell expression (red) and endothelial cell co-localization (yellow) of Hb-egf. ( C ) Schematic description of the orthotopic transplant experiment aimed at assessing the contribution of mesenchymal-derived Hb-egf to the angiogenic phenotype of pancreatic neuroendocrine tumorigenesis (PNET) tumors. ( D ) Comparison of pericyte coverage of the tumor neovasculature in wild-type (wt) versus Hb-egf mutant (Hb−/−) hosts. ** P < 0.0005. (Number of tumors analyzed for each host genotype: N wt = 11, N Hb = 12.) ( E-F ) Representative staining of tumors for nuclei (DAPI; blue), NG2 (pericyte marker; red), and pEgfr (green) illustrating that the readily detectable pEgfr signal localized to pericytes in wild-type hosts (white arrows) ( E ) disappears in Hb-egf mutant hosts ( F ). pEgfr can be detected in cancer cells but at many-fold lower levels than in perivascular cells (see Supplementary Fig. S4). Micrographs are representative of 2 fields of 12 and 11 tumors obtained from wt or Hb-egf mutant hosts, respectively.

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Mesenchymal-derived Hb-egf activates Egfr inside tumor pericytes. ( A-B ) Co-staining of Hb-egf staining (red) and Meca-32 (endothelial cell marker; green) by confocal microscopy (2,520x) reveals both cancer cell expression (red) and endothelial cell co-localization (yellow) of Hb-egf. ( C ) Schematic description of the orthotopic transplant experiment aimed at assessing the contribution of mesenchymal-derived Hb-egf to the angiogenic phenotype of pancreatic neuroendocrine tumorigenesis (PNET) tumors. ( D ) Comparison of pericyte coverage of the tumor neovasculature in wild-type (wt) versus Hb-egf mutant (Hb−/−) hosts. ** P < 0.0005. (Number of tumors analyzed for each host genotype: N wt = 11, N Hb = 12.) ( E-F ) Representative staining of tumors for nuclei (DAPI; blue), NG2 (pericyte marker; red), and pEgfr (green) illustrating that the readily detectable pEgfr signal localized to pericytes in wild-type hosts (white arrows) ( E ) disappears in Hb-egf mutant hosts ( F ). pEgfr can be detected in cancer cells but at many-fold lower levels than in perivascular cells (see Supplementary Fig. S4). Micrographs are representative of 2 fields of 12 and 11 tumors obtained from wt or Hb-egf mutant hosts, respectively.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Derivative Assay, Staining, Marker, Confocal Microscopy, Expressing, Comparison, Mutagenesis

PD-L1 expression positively correlates with proinflammatory markers in M1-polarized macrophages. (A-C) PD-L1-overexpressing (PD-L1 HI ) and control (PD-L1 NC ) THP-1-M cells were stimulated with LPS (100 ng/ml) + IFN-γ (20 ng/ml) for 12 h followed by RNA sequencing. A Heatmap of inflammatory gene expression in PD-L1 HI vs. PD-L1 NC cells. B MA plot showing differential gene expression between PD-L1 HI and PD-L1 NC cells. C TPM expression values of IL-6, IL-27 and NOS2. D - E PD-L1 HI and PD-L1 NC cells were stimulated with LPS + IFN-γ for 24 h. ( n = 3 independent biological replicates) ( D ) qRT-PCR analysis of IL-6, IL-27 and NOS2 mRNA levels ( n = 3 independent biological replicates). E ELISA for IL-6/IL-27 and Griess reagent assay for NO in supernatants ( n = 3 independent biological replicates). (F-G) PD-L1-knockout THP-1-M (PD-L1 KO /THP-1-M) and PD-L1 NC /THP-1-M were stimulated with LPS + IFN-γ for 24 h. F qRT-PCR analysis of IL-6, IL-27 and NOS2 mRNA levels ( n = 3 independent biological replicates). G ELISA and Griess reagent detection of IL-6/IL-27 proteins and NO in supernatants ( n = 3 independent biological replicates). The data are presented as the mean ± SEM. Statistical analysis for C, D, E, F and G was performed by Student’s t-test. * p < 0.05

Journal: Cell Communication and Signaling : CCS

Article Title: PD-L1 mediates M1 polarization of macrophages via the AIM2/IL-18/STAT1 signaling axis during sepsis

doi: 10.1186/s12964-025-02578-1

Figure Lengend Snippet: PD-L1 expression positively correlates with proinflammatory markers in M1-polarized macrophages. (A-C) PD-L1-overexpressing (PD-L1 HI ) and control (PD-L1 NC ) THP-1-M cells were stimulated with LPS (100 ng/ml) + IFN-γ (20 ng/ml) for 12 h followed by RNA sequencing. A Heatmap of inflammatory gene expression in PD-L1 HI vs. PD-L1 NC cells. B MA plot showing differential gene expression between PD-L1 HI and PD-L1 NC cells. C TPM expression values of IL-6, IL-27 and NOS2. D - E PD-L1 HI and PD-L1 NC cells were stimulated with LPS + IFN-γ for 24 h. ( n = 3 independent biological replicates) ( D ) qRT-PCR analysis of IL-6, IL-27 and NOS2 mRNA levels ( n = 3 independent biological replicates). E ELISA for IL-6/IL-27 and Griess reagent assay for NO in supernatants ( n = 3 independent biological replicates). (F-G) PD-L1-knockout THP-1-M (PD-L1 KO /THP-1-M) and PD-L1 NC /THP-1-M were stimulated with LPS + IFN-γ for 24 h. F qRT-PCR analysis of IL-6, IL-27 and NOS2 mRNA levels ( n = 3 independent biological replicates). G ELISA and Griess reagent detection of IL-6/IL-27 proteins and NO in supernatants ( n = 3 independent biological replicates). The data are presented as the mean ± SEM. Statistical analysis for C, D, E, F and G was performed by Student’s t-test. * p < 0.05

Article Snippet: IL-27, IL-6, IL-18, and IFN-γ concentrations in cell supernatants or plasma were quantified using ELISA kits (Boster Biological Technology; Wuhan, China) with absorbance measurements at 450 nm.

Techniques: Expressing, Control, RNA Sequencing, Gene Expression, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Knock-Out

Triple-verification strategy (gene silencing/antibody neutralization/site-directed mutagenesis) confirms regulatory hierarchy of PD-L1/AIM2/IL-18/STAT1 signaling axis in macrophage M1 polarization. A PD-L1 HI /THP-1-M and PD-L1 NC /THP-1-M cells were pretreated with AIM2-targeting siRNA or scramble siRNA (scr siRNA) prior to 24 h LPS (100 ng/ml) + IFN-γ (20 ng/ml) co-stimulation, with subsequent Western blotting analysis of STAT1 phosphorylation. B - C Anti-IL-18 neutralizing antibody (1 µg/ml) and isotype control (1 µg/ml) were pretreated for 24 h followed by LPS + IFN-γ 24 h co-stimulation. B qRT-PCR quantification of IFN-γ mRNA ( n = 3 independent biological replicates). C STAT1 phosphorylation profiling by Western blotting. D Truncation mutant validation: LPS + IFN-γ-stimulated (24 h) PD-L1 Δ35–90 cells analyzed for STAT1 activation vs. full length type. E Following AIM2 silencing in PD-L1 HI /THP-1-M and PD-L1 NC /THP-1-M cells, qRT-PCR quantification of IL-6, IL-27 and NOS2 mRNA after 24 h LPS + IFN-γ stimulation ( n = 3 independent biological replicates). F Post IL-18 neutralization, mRNA levels of IL-6, IL-27 and NOS2 were assessed by qRT-PCR under LPS + IFN-γ 24 h stimulation ( n = 3 independent biological replicates). G STAT1-silenced cells were analyzed for IL-6/IL-27/NOS2 transcriptional changes post 24 h LPS + IFN-γ exposure ( n = 3 independent biological replicates). H Truncated PD-L1 Δ35–90 mutants were evaluated for IL-6, IL-27 and NOS2 mRNA expression following LPS + IFN-γ 24 h challenge ( n = 3 independent biological replicates). The data are presented as the mean ± SEM. Statistical analysis for B, E, F, G and H was performed by Student’s t-test. * p < 0.05

Journal: Cell Communication and Signaling : CCS

Article Title: PD-L1 mediates M1 polarization of macrophages via the AIM2/IL-18/STAT1 signaling axis during sepsis

doi: 10.1186/s12964-025-02578-1

Figure Lengend Snippet: Triple-verification strategy (gene silencing/antibody neutralization/site-directed mutagenesis) confirms regulatory hierarchy of PD-L1/AIM2/IL-18/STAT1 signaling axis in macrophage M1 polarization. A PD-L1 HI /THP-1-M and PD-L1 NC /THP-1-M cells were pretreated with AIM2-targeting siRNA or scramble siRNA (scr siRNA) prior to 24 h LPS (100 ng/ml) + IFN-γ (20 ng/ml) co-stimulation, with subsequent Western blotting analysis of STAT1 phosphorylation. B - C Anti-IL-18 neutralizing antibody (1 µg/ml) and isotype control (1 µg/ml) were pretreated for 24 h followed by LPS + IFN-γ 24 h co-stimulation. B qRT-PCR quantification of IFN-γ mRNA ( n = 3 independent biological replicates). C STAT1 phosphorylation profiling by Western blotting. D Truncation mutant validation: LPS + IFN-γ-stimulated (24 h) PD-L1 Δ35–90 cells analyzed for STAT1 activation vs. full length type. E Following AIM2 silencing in PD-L1 HI /THP-1-M and PD-L1 NC /THP-1-M cells, qRT-PCR quantification of IL-6, IL-27 and NOS2 mRNA after 24 h LPS + IFN-γ stimulation ( n = 3 independent biological replicates). F Post IL-18 neutralization, mRNA levels of IL-6, IL-27 and NOS2 were assessed by qRT-PCR under LPS + IFN-γ 24 h stimulation ( n = 3 independent biological replicates). G STAT1-silenced cells were analyzed for IL-6/IL-27/NOS2 transcriptional changes post 24 h LPS + IFN-γ exposure ( n = 3 independent biological replicates). H Truncated PD-L1 Δ35–90 mutants were evaluated for IL-6, IL-27 and NOS2 mRNA expression following LPS + IFN-γ 24 h challenge ( n = 3 independent biological replicates). The data are presented as the mean ± SEM. Statistical analysis for B, E, F, G and H was performed by Student’s t-test. * p < 0.05

Article Snippet: IL-27, IL-6, IL-18, and IFN-γ concentrations in cell supernatants or plasma were quantified using ELISA kits (Boster Biological Technology; Wuhan, China) with absorbance measurements at 450 nm.

Techniques: Neutralization, Mutagenesis, Western Blot, Phospho-proteomics, Control, Quantitative RT-PCR, Biomarker Discovery, Activation Assay, Expressing

PD-L1 knockout reduces septic mortality dampens systemic inflammation and alleviates vital organ (cardiac/hepatic/renal) injury in murine models. A PD-L1 wild-type (WT) and knockout (KO) mice were subjected to CLP followed by survival monitoring, inflammatory marker assessment, and multi-organ functional evaluation. B Survival rates of PD-L1 WT and PD-L1 KO mice at indicated time points post-CLP ( n = 15 mice per group). Results were compared by log-rank test. C mRNA levels of IL-6, IL-27, and NOS2 in monocytes analyzed by qRT-PCR at 24 h post-CLP ( n = 3 mice per group). D Serum concentrations of IL-6 and IL-27 proteins measured by ELISA, and NO levels determined by Griess assay at 24 h post-CLP ( n = 3 mice per group). E Serum biomarkers of organ function including ALT and AST for hepatic injury, BUN for renal dysfunction, and cTnI for cardiac damage at 24 h post-CLP ( n = 3 mice per group). The data are presented as the mean ± SEM. Statistical analysis for C, D and E was performed by Student’s t-test. * p < 0.05

Journal: Cell Communication and Signaling : CCS

Article Title: PD-L1 mediates M1 polarization of macrophages via the AIM2/IL-18/STAT1 signaling axis during sepsis

doi: 10.1186/s12964-025-02578-1

Figure Lengend Snippet: PD-L1 knockout reduces septic mortality dampens systemic inflammation and alleviates vital organ (cardiac/hepatic/renal) injury in murine models. A PD-L1 wild-type (WT) and knockout (KO) mice were subjected to CLP followed by survival monitoring, inflammatory marker assessment, and multi-organ functional evaluation. B Survival rates of PD-L1 WT and PD-L1 KO mice at indicated time points post-CLP ( n = 15 mice per group). Results were compared by log-rank test. C mRNA levels of IL-6, IL-27, and NOS2 in monocytes analyzed by qRT-PCR at 24 h post-CLP ( n = 3 mice per group). D Serum concentrations of IL-6 and IL-27 proteins measured by ELISA, and NO levels determined by Griess assay at 24 h post-CLP ( n = 3 mice per group). E Serum biomarkers of organ function including ALT and AST for hepatic injury, BUN for renal dysfunction, and cTnI for cardiac damage at 24 h post-CLP ( n = 3 mice per group). The data are presented as the mean ± SEM. Statistical analysis for C, D and E was performed by Student’s t-test. * p < 0.05

Article Snippet: IL-27, IL-6, IL-18, and IFN-γ concentrations in cell supernatants or plasma were quantified using ELISA kits (Boster Biological Technology; Wuhan, China) with absorbance measurements at 450 nm.

Techniques: Knock-Out, Marker, Functional Assay, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Griess Assay