evagreen supermix Search Results


97
Solis BioDyne hot firepol evagreen qpcr supermix
Hot Firepol Evagreen Qpcr Supermix, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hot firepol evagreen qpcr supermix/product/Solis BioDyne
Average 97 stars, based on 1 article reviews
hot firepol evagreen qpcr supermix - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

99
Solis BioDyne hot firepol evagreen dna ploymerase
Hot Firepol Evagreen Dna Ploymerase, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hot firepol evagreen dna ploymerase/product/Solis BioDyne
Average 99 stars, based on 1 article reviews
hot firepol evagreen dna ploymerase - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

90
MJ Research ssofast evagreen supermix
Ssofast Evagreen Supermix, supplied by MJ Research, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ssofast evagreen supermix/product/MJ Research
Average 90 stars, based on 1 article reviews
ssofast evagreen supermix - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Yeasen Biotechnology ssofasttm evagreen ® supermix kit
Ssofasttm Evagreen ® Supermix Kit, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ssofasttm evagreen ® supermix kit/product/Yeasen Biotechnology
Average 90 stars, based on 1 article reviews
ssofasttm evagreen ® supermix kit - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Biomark Inc ssofast evagreen supermix with low rox
Ssofast Evagreen Supermix With Low Rox, supplied by Biomark Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ssofast evagreen supermix with low rox/product/Biomark Inc
Average 90 stars, based on 1 article reviews
ssofast evagreen supermix with low rox - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Promega sso fast evagreen supermix
Quantification of PCR amplified nucleic acid using AccuCal calibrator. a The workflow associated with using AccuCal to quantify input nucleic acid amount in each PCR, b AccuCal calibrator was diluted so that 0, 40, 60, 80, 120, 140 and 200 ng in <t>Sso</t> Fast <t>EvaGreen</t> <t>Supermix</t> were added to respective wells of a PCR plate and subjected to 40 amplification cycles. c The fluorescence intensity of each AccuCal calibrator (after subtraction of mean 0 ng AccuCal fluorescence) was plotted against the amount (pmols) and a linear regression line fitted to generate the calibration curve. d Ten-fold dilutions of lambda DNA, ranging from 4.5 × 10 6 – 4.5 × 10 1 copies/PCR, were amplified in quadruplicate in Sso Fast EvaGreen Supermix on the same plate as the AccuCal calibrators. e The calibration curve was used, alongside the calculated efficiency of each amplification reaction and the cycle numbers between the take-off point (Cq) and second derivative maxima for each amplification reaction, to quantify the mean starting amount of DNA in each PCR. The standard error of the mean is also presented. f The theoretical and determined number of copies/PCR, plus SEM, were plotted against each other and a regression line drawn to demonstrate the agreement between the two values
Sso Fast Evagreen Supermix, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sso fast evagreen supermix/product/Promega
Average 90 stars, based on 1 article reviews
sso fast evagreen supermix - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Omega Bio Tek ssofast evagreen supermix
Quantification of PCR amplified nucleic acid using AccuCal calibrator. a The workflow associated with using AccuCal to quantify input nucleic acid amount in each PCR, b AccuCal calibrator was diluted so that 0, 40, 60, 80, 120, 140 and 200 ng in <t>Sso</t> Fast <t>EvaGreen</t> <t>Supermix</t> were added to respective wells of a PCR plate and subjected to 40 amplification cycles. c The fluorescence intensity of each AccuCal calibrator (after subtraction of mean 0 ng AccuCal fluorescence) was plotted against the amount (pmols) and a linear regression line fitted to generate the calibration curve. d Ten-fold dilutions of lambda DNA, ranging from 4.5 × 10 6 – 4.5 × 10 1 copies/PCR, were amplified in quadruplicate in Sso Fast EvaGreen Supermix on the same plate as the AccuCal calibrators. e The calibration curve was used, alongside the calculated efficiency of each amplification reaction and the cycle numbers between the take-off point (Cq) and second derivative maxima for each amplification reaction, to quantify the mean starting amount of DNA in each PCR. The standard error of the mean is also presented. f The theoretical and determined number of copies/PCR, plus SEM, were plotted against each other and a regression line drawn to demonstrate the agreement between the two values
Ssofast Evagreen Supermix, supplied by Omega Bio Tek, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ssofast evagreen supermix/product/Omega Bio Tek
Average 90 stars, based on 1 article reviews
ssofast evagreen supermix - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Rad Laboratories Inc ssofasttm evagreen supermix
Quantification of PCR amplified nucleic acid using AccuCal calibrator. a The workflow associated with using AccuCal to quantify input nucleic acid amount in each PCR, b AccuCal calibrator was diluted so that 0, 40, 60, 80, 120, 140 and 200 ng in <t>Sso</t> Fast <t>EvaGreen</t> <t>Supermix</t> were added to respective wells of a PCR plate and subjected to 40 amplification cycles. c The fluorescence intensity of each AccuCal calibrator (after subtraction of mean 0 ng AccuCal fluorescence) was plotted against the amount (pmols) and a linear regression line fitted to generate the calibration curve. d Ten-fold dilutions of lambda DNA, ranging from 4.5 × 10 6 – 4.5 × 10 1 copies/PCR, were amplified in quadruplicate in Sso Fast EvaGreen Supermix on the same plate as the AccuCal calibrators. e The calibration curve was used, alongside the calculated efficiency of each amplification reaction and the cycle numbers between the take-off point (Cq) and second derivative maxima for each amplification reaction, to quantify the mean starting amount of DNA in each PCR. The standard error of the mean is also presented. f The theoretical and determined number of copies/PCR, plus SEM, were plotted against each other and a regression line drawn to demonstrate the agreement between the two values
Ssofasttm Evagreen Supermix, supplied by Rad Laboratories Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ssofasttm evagreen supermix/product/Rad Laboratories Inc
Average 90 stars, based on 1 article reviews
ssofasttm evagreen supermix - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Sciencewerke Pte ssofasttm evagreen ® supermix kit
Quantification of PCR amplified nucleic acid using AccuCal calibrator. a The workflow associated with using AccuCal to quantify input nucleic acid amount in each PCR, b AccuCal calibrator was diluted so that 0, 40, 60, 80, 120, 140 and 200 ng in <t>Sso</t> Fast <t>EvaGreen</t> <t>Supermix</t> were added to respective wells of a PCR plate and subjected to 40 amplification cycles. c The fluorescence intensity of each AccuCal calibrator (after subtraction of mean 0 ng AccuCal fluorescence) was plotted against the amount (pmols) and a linear regression line fitted to generate the calibration curve. d Ten-fold dilutions of lambda DNA, ranging from 4.5 × 10 6 – 4.5 × 10 1 copies/PCR, were amplified in quadruplicate in Sso Fast EvaGreen Supermix on the same plate as the AccuCal calibrators. e The calibration curve was used, alongside the calculated efficiency of each amplification reaction and the cycle numbers between the take-off point (Cq) and second derivative maxima for each amplification reaction, to quantify the mean starting amount of DNA in each PCR. The standard error of the mean is also presented. f The theoretical and determined number of copies/PCR, plus SEM, were plotted against each other and a regression line drawn to demonstrate the agreement between the two values
Ssofasttm Evagreen ® Supermix Kit, supplied by Sciencewerke Pte, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ssofasttm evagreen ® supermix kit/product/Sciencewerke Pte
Average 90 stars, based on 1 article reviews
ssofasttm evagreen ® supermix kit - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Biomark Inc evagreen supermix with low rox
Quantification of PCR amplified nucleic acid using AccuCal calibrator. a The workflow associated with using AccuCal to quantify input nucleic acid amount in each PCR, b AccuCal calibrator was diluted so that 0, 40, 60, 80, 120, 140 and 200 ng in <t>Sso</t> Fast <t>EvaGreen</t> <t>Supermix</t> were added to respective wells of a PCR plate and subjected to 40 amplification cycles. c The fluorescence intensity of each AccuCal calibrator (after subtraction of mean 0 ng AccuCal fluorescence) was plotted against the amount (pmols) and a linear regression line fitted to generate the calibration curve. d Ten-fold dilutions of lambda DNA, ranging from 4.5 × 10 6 – 4.5 × 10 1 copies/PCR, were amplified in quadruplicate in Sso Fast EvaGreen Supermix on the same plate as the AccuCal calibrators. e The calibration curve was used, alongside the calculated efficiency of each amplification reaction and the cycle numbers between the take-off point (Cq) and second derivative maxima for each amplification reaction, to quantify the mean starting amount of DNA in each PCR. The standard error of the mean is also presented. f The theoretical and determined number of copies/PCR, plus SEM, were plotted against each other and a regression line drawn to demonstrate the agreement between the two values
Evagreen Supermix With Low Rox, supplied by Biomark Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/evagreen supermix with low rox/product/Biomark Inc
Average 90 stars, based on 1 article reviews
evagreen supermix with low rox - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Newmarket Scientific Ltd 5x hot firepol® evagreen® qpcr supermix
Quantification of PCR amplified nucleic acid using AccuCal calibrator. a The workflow associated with using AccuCal to quantify input nucleic acid amount in each PCR, b AccuCal calibrator was diluted so that 0, 40, 60, 80, 120, 140 and 200 ng in <t>Sso</t> Fast <t>EvaGreen</t> <t>Supermix</t> were added to respective wells of a PCR plate and subjected to 40 amplification cycles. c The fluorescence intensity of each AccuCal calibrator (after subtraction of mean 0 ng AccuCal fluorescence) was plotted against the amount (pmols) and a linear regression line fitted to generate the calibration curve. d Ten-fold dilutions of lambda DNA, ranging from 4.5 × 10 6 – 4.5 × 10 1 copies/PCR, were amplified in quadruplicate in Sso Fast EvaGreen Supermix on the same plate as the AccuCal calibrators. e The calibration curve was used, alongside the calculated efficiency of each amplification reaction and the cycle numbers between the take-off point (Cq) and second derivative maxima for each amplification reaction, to quantify the mean starting amount of DNA in each PCR. The standard error of the mean is also presented. f The theoretical and determined number of copies/PCR, plus SEM, were plotted against each other and a regression line drawn to demonstrate the agreement between the two values
5x Hot Firepol® Evagreen® Qpcr Supermix, supplied by Newmarket Scientific Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/5x hot firepol® evagreen® qpcr supermix/product/Newmarket Scientific Ltd
Average 90 stars, based on 1 article reviews
5x hot firepol® evagreen® qpcr supermix - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Bioteke Corporation ssofast evagreen supermix
Quantification of PCR amplified nucleic acid using AccuCal calibrator. a The workflow associated with using AccuCal to quantify input nucleic acid amount in each PCR, b AccuCal calibrator was diluted so that 0, 40, 60, 80, 120, 140 and 200 ng in <t>Sso</t> Fast <t>EvaGreen</t> <t>Supermix</t> were added to respective wells of a PCR plate and subjected to 40 amplification cycles. c The fluorescence intensity of each AccuCal calibrator (after subtraction of mean 0 ng AccuCal fluorescence) was plotted against the amount (pmols) and a linear regression line fitted to generate the calibration curve. d Ten-fold dilutions of lambda DNA, ranging from 4.5 × 10 6 – 4.5 × 10 1 copies/PCR, were amplified in quadruplicate in Sso Fast EvaGreen Supermix on the same plate as the AccuCal calibrators. e The calibration curve was used, alongside the calculated efficiency of each amplification reaction and the cycle numbers between the take-off point (Cq) and second derivative maxima for each amplification reaction, to quantify the mean starting amount of DNA in each PCR. The standard error of the mean is also presented. f The theoretical and determined number of copies/PCR, plus SEM, were plotted against each other and a regression line drawn to demonstrate the agreement between the two values
Ssofast Evagreen Supermix, supplied by Bioteke Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ssofast evagreen supermix/product/Bioteke Corporation
Average 90 stars, based on 1 article reviews
ssofast evagreen supermix - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Quantification of PCR amplified nucleic acid using AccuCal calibrator. a The workflow associated with using AccuCal to quantify input nucleic acid amount in each PCR, b AccuCal calibrator was diluted so that 0, 40, 60, 80, 120, 140 and 200 ng in Sso Fast EvaGreen Supermix were added to respective wells of a PCR plate and subjected to 40 amplification cycles. c The fluorescence intensity of each AccuCal calibrator (after subtraction of mean 0 ng AccuCal fluorescence) was plotted against the amount (pmols) and a linear regression line fitted to generate the calibration curve. d Ten-fold dilutions of lambda DNA, ranging from 4.5 × 10 6 – 4.5 × 10 1 copies/PCR, were amplified in quadruplicate in Sso Fast EvaGreen Supermix on the same plate as the AccuCal calibrators. e The calibration curve was used, alongside the calculated efficiency of each amplification reaction and the cycle numbers between the take-off point (Cq) and second derivative maxima for each amplification reaction, to quantify the mean starting amount of DNA in each PCR. The standard error of the mean is also presented. f The theoretical and determined number of copies/PCR, plus SEM, were plotted against each other and a regression line drawn to demonstrate the agreement between the two values

Journal: BMC Biotechnology

Article Title: A simple, accurate and universal method for quantification of PCR

doi: 10.1186/s12896-016-0256-y

Figure Lengend Snippet: Quantification of PCR amplified nucleic acid using AccuCal calibrator. a The workflow associated with using AccuCal to quantify input nucleic acid amount in each PCR, b AccuCal calibrator was diluted so that 0, 40, 60, 80, 120, 140 and 200 ng in Sso Fast EvaGreen Supermix were added to respective wells of a PCR plate and subjected to 40 amplification cycles. c The fluorescence intensity of each AccuCal calibrator (after subtraction of mean 0 ng AccuCal fluorescence) was plotted against the amount (pmols) and a linear regression line fitted to generate the calibration curve. d Ten-fold dilutions of lambda DNA, ranging from 4.5 × 10 6 – 4.5 × 10 1 copies/PCR, were amplified in quadruplicate in Sso Fast EvaGreen Supermix on the same plate as the AccuCal calibrators. e The calibration curve was used, alongside the calculated efficiency of each amplification reaction and the cycle numbers between the take-off point (Cq) and second derivative maxima for each amplification reaction, to quantify the mean starting amount of DNA in each PCR. The standard error of the mean is also presented. f The theoretical and determined number of copies/PCR, plus SEM, were plotted against each other and a regression line drawn to demonstrate the agreement between the two values

Article Snippet: Serial dilutions of lambda DNA were also amplified as above in either Sso Fast EvaGreen Supermix or in Go Taq hot start colorless mastermix (Promega), the latter being detected with an hydrolysis probe specific to the amplicon and having the sequence 5′ 56-FAM/aacactcaggcacgcggtctg/3IABkFQ 3′ (Integrated DNA Technologies).

Techniques: Amplification, Fluorescence, Lambda DNA Preparation

Quantification using both AccuCal-D and AccuCal-P. a Five, ten-fold dilutions of a known quantity of lambda DNA, ranging from 4.5 × 10 5 to 4.5 × 10 1 , were amplified twice in quadruplicate and detected using either EvaGreen, the intercalating dye in Sso Fast mastermix, or a FAM-labelled hydrolysis probe specific to the target amplicon. In both cases, AccuCal-D and AccuCal-P calibrators were included on the same plate and used to independently quantify the starting amount of input DNA in each PCR. The theoretical amount versus the calculated amount, determined by either AccuCal-D or AccuCal-P, using the EvaGreen dye (EG) or the hydrolysis probe (P), was plotted and the linear regression of each is shown in the graph on the right. b Five, ten-fold dilutions of a known quantity of lambda DNA in quadruplicate were amplified in Sso Fast mastermix using primers to give a 501 bp amplicon. AccuCal-D and AccuCal-P calibrators were included on the same plate and were used to independently quantify the starting amount of lambda DNA in each PCR. The theoretical amount versus the calculated amount, determined by either AccuCal-D or AccuCal-P, for the 501 bp amplicon, was plotted and the linear regression of each is shown in the graph on the right. c Five, ten-fold dilutions (3 one-hundred fold dilutions on the Eco) of a known quantity of lambda DNA were amplified in various mastermixes (see ) on the different qPCR platforms indicated over 2–10 PCR runs. The theoretical amount versus the mean calculated amount, determined by AccuCal-D, across all platforms was plotted and the linear regression is shown in the graph on the right. The mean number of calculated copies/PCR and SEM are shown in each case

Journal: BMC Biotechnology

Article Title: A simple, accurate and universal method for quantification of PCR

doi: 10.1186/s12896-016-0256-y

Figure Lengend Snippet: Quantification using both AccuCal-D and AccuCal-P. a Five, ten-fold dilutions of a known quantity of lambda DNA, ranging from 4.5 × 10 5 to 4.5 × 10 1 , were amplified twice in quadruplicate and detected using either EvaGreen, the intercalating dye in Sso Fast mastermix, or a FAM-labelled hydrolysis probe specific to the target amplicon. In both cases, AccuCal-D and AccuCal-P calibrators were included on the same plate and used to independently quantify the starting amount of input DNA in each PCR. The theoretical amount versus the calculated amount, determined by either AccuCal-D or AccuCal-P, using the EvaGreen dye (EG) or the hydrolysis probe (P), was plotted and the linear regression of each is shown in the graph on the right. b Five, ten-fold dilutions of a known quantity of lambda DNA in quadruplicate were amplified in Sso Fast mastermix using primers to give a 501 bp amplicon. AccuCal-D and AccuCal-P calibrators were included on the same plate and were used to independently quantify the starting amount of lambda DNA in each PCR. The theoretical amount versus the calculated amount, determined by either AccuCal-D or AccuCal-P, for the 501 bp amplicon, was plotted and the linear regression of each is shown in the graph on the right. c Five, ten-fold dilutions (3 one-hundred fold dilutions on the Eco) of a known quantity of lambda DNA were amplified in various mastermixes (see ) on the different qPCR platforms indicated over 2–10 PCR runs. The theoretical amount versus the mean calculated amount, determined by AccuCal-D, across all platforms was plotted and the linear regression is shown in the graph on the right. The mean number of calculated copies/PCR and SEM are shown in each case

Article Snippet: Serial dilutions of lambda DNA were also amplified as above in either Sso Fast EvaGreen Supermix or in Go Taq hot start colorless mastermix (Promega), the latter being detected with an hydrolysis probe specific to the amplicon and having the sequence 5′ 56-FAM/aacactcaggcacgcggtctg/3IABkFQ 3′ (Integrated DNA Technologies).

Techniques: Lambda DNA Preparation, Amplification