Journal: Scientific Reports

Article Title: Hypoxia-inducible ERO1α promotes cancer progression through modulation of integrin-β1 modification and signalling in HCT116 colorectal cancer cells

doi: 10.1038/s41598-017-09976-7

Figure Lengend Snippet: ERO1A gene deletion in HCT116 cells. ( a ) The human ERO1A gene is located on chromosome 14. Exons are represented as boxes. The asterisk indicates the region targeted by the gRNA, and the arrows indicate the PCR primer set. ( b ) Two representative mutated alleles in the HCT116 cell line induced by CRISPR/Cas9, as detected using RT-PCR. ( c ) CRISPR/Cas9-induced deletion is shown using dashed lines; the red vertical bar indicates the site of the insertion sequence. In KO-1, the origin of the pBluescript backbone sequence (236 bp) was inserted in the gRNA target locus. KO-2 contained a 76-bp deletion and a 1-bp (G) insertion (flame-shift mutation). ( d ) Western blotting analysis of the expression of ERO1α and related proteins: comparison of ERO1α KO clones with WT and mock control. ( e ) Cell growth in each clone was assessed by counting cells at the indicated time points; data represent the means ± s.e.m. ( n = 6). The groups showed no statistically significant differences.

Article Snippet: The primary antibodies that were used are as follows: anti-ERO1α (Abnova), anti-integrin-β1, anti-HIF-1α (BD Biosciences), anti-ERO1β (Proteintech Group), anti-PDI, anti-ILK1, anti-Snail, anti-E-cadherin, anti-α-tubulin (Cell Signaling Technology), anti-PRDX4, anti-GAPDH, and anti-β-actin (Abcam).

Techniques: CRISPR, Reverse Transcription Polymerase Chain Reaction, Sequencing, Mutagenesis, Western Blot, Expressing, Comparison, Clone Assay, Control

Journal: Scientific Reports

Article Title: Hypoxia-inducible ERO1α promotes cancer progression through modulation of integrin-β1 modification and signalling in HCT116 colorectal cancer cells

doi: 10.1038/s41598-017-09976-7

Figure Lengend Snippet: Effect of ERO1α KO on xenograft tumour growth. ( a ) Tumour size was measured twice a week after subcutaneous injection of control and KO cells. ( b ) Tumour weight was measured after dissecting out the tumours; values shown are the means ± s.e.m. ( n = 8). * P < 0.05, n.s, not significant (Student’s t test). ( c ) Representative image of haematoxylin and eosin staining and immunohistochemical staining against ERO1α.

Article Snippet: The primary antibodies that were used are as follows: anti-ERO1α (Abnova), anti-integrin-β1, anti-HIF-1α (BD Biosciences), anti-ERO1β (Proteintech Group), anti-PDI, anti-ILK1, anti-Snail, anti-E-cadherin, anti-α-tubulin (Cell Signaling Technology), anti-PRDX4, anti-GAPDH, and anti-β-actin (Abcam).

Techniques: Injection, Control, Staining, Immunohistochemical staining

Journal: Scientific Reports

Article Title: Hypoxia-inducible ERO1α promotes cancer progression through modulation of integrin-β1 modification and signalling in HCT116 colorectal cancer cells

doi: 10.1038/s41598-017-09976-7

Figure Lengend Snippet: In vitro culture of WT and ERO1α cells under normoxia vs hypoxia. Cultures were incubated for 24, 48, and 72 h under hypoxia or normoxia. ( a ) Cell-proliferation curve of WT and KO clones under hypoxia, assessed by counting cells at the indicated times. Data are shown as the means ± s.e.m. ( n = 4). * P < 0.05, Student’s t test. ( b ) Representative light microscopy images of WT (left) and KO (right). The KO clone displays reduced stacking (piling up) and increased cell-cell integrity as compared with WT. ( c ) Western blotting analysis of oxidizing enzymes and cell adhesion molecules. Under hypoxia, ERO1α depletion impairs the maturation of integrin-β1. The lower integrin band (110 kDa) represents the β1 precursor, and the upper (approximately130 kDa) the mature form. All experiments were conducted at least three times and representative data is presented.

Article Snippet: The primary antibodies that were used are as follows: anti-ERO1α (Abnova), anti-integrin-β1, anti-HIF-1α (BD Biosciences), anti-ERO1β (Proteintech Group), anti-PDI, anti-ILK1, anti-Snail, anti-E-cadherin, anti-α-tubulin (Cell Signaling Technology), anti-PRDX4, anti-GAPDH, and anti-β-actin (Abcam).

Techniques: In Vitro, Incubation, Clone Assay, Light Microscopy, Western Blot

Journal: Scientific Reports

Article Title: Hypoxia-inducible ERO1α promotes cancer progression through modulation of integrin-β1 modification and signalling in HCT116 colorectal cancer cells

doi: 10.1038/s41598-017-09976-7

Figure Lengend Snippet: ERO1α deletion drastically reduces the cell-surface-expressed form of integrin-β1 under hypoxia. ( a ) Normoxic and hypoxic samples were incubated without or with Endo H or PNGase F. ERO1α depletion impaired Endo H-resistant N-glycosylation of integrin-β1 under hypoxia. Membrane integrin-β1 levels in HCT116 clones under normoxia and hypoxia were assessed by performing cell-surface biotinylation assays, flow cytometry, and immunofluorescence labelling of cells: ( b ) Cell-surface biotinylation assay performed on WT and the mock and KO clones under normoxia and hypoxia. Total lysates (whole) and the NeutrAvidin agarose-bound fraction (cell surface) were subjected to western blotting. ( c ) Flow cytometric analysis of integrin-β1 in WT and KO. Cells were collected and incubated with APC-conjugated anti-integrin-β1 antibody or isotype control antibody. FMI, Fluorescence mean intensity. ( d ) Immunocytochemical labelling of integrin-β1 (green) and PDI (red) in WT and KO cells under hypoxia. PDI was used as an ER marker protein. All experiments were conducted in duplicate or triplicate and repeated at least twice.

Article Snippet: The primary antibodies that were used are as follows: anti-ERO1α (Abnova), anti-integrin-β1, anti-HIF-1α (BD Biosciences), anti-ERO1β (Proteintech Group), anti-PDI, anti-ILK1, anti-Snail, anti-E-cadherin, anti-α-tubulin (Cell Signaling Technology), anti-PRDX4, anti-GAPDH, and anti-β-actin (Abcam).

Techniques: Incubation, Membrane, Clone Assay, Flow Cytometry, Immunofluorescence, Cell Surface Biotinylation Assay, Western Blot, Control, Fluorescence, Marker

Journal: Scientific Reports

Article Title: Hypoxia-inducible ERO1α promotes cancer progression through modulation of integrin-β1 modification and signalling in HCT116 colorectal cancer cells

doi: 10.1038/s41598-017-09976-7

Figure Lengend Snippet: ERO1α deletion affects cell motility and integrin- and EMT-related signalling molecules under hypoxia through integrin-β1 downregulation. ( a ) Wound-healing assays performed using the indicated cell clones and culture conditions. Results are given as the means ± s.e.m. ( n = 4); * P < 0.05, Student’s t test. The upper panels show the wound at baseline, the lower the wound after 24 h. Under hypoxia, the KO clone exhibited significantly decreased migration as compared with WT and with KO under normoxia. ( b ) Expression of integrin- and EMT-related molecules in WT and the mock and KO clones under normoxia and hypoxia.

Article Snippet: The primary antibodies that were used are as follows: anti-ERO1α (Abnova), anti-integrin-β1, anti-HIF-1α (BD Biosciences), anti-ERO1β (Proteintech Group), anti-PDI, anti-ILK1, anti-Snail, anti-E-cadherin, anti-α-tubulin (Cell Signaling Technology), anti-PRDX4, anti-GAPDH, and anti-β-actin (Abcam).

Techniques: Clone Assay, Migration, Expressing

Journal: Scientific Reports

Article Title: Hypoxia-inducible ERO1α promotes cancer progression through modulation of integrin-β1 modification and signalling in HCT116 colorectal cancer cells

doi: 10.1038/s41598-017-09976-7

Figure Lengend Snippet: ERO1α re-expression reverses the effect of ERO1α KO. ( a ) Western blotting to confirm ERO1α expression. Res: ERO1α-transfected KO clone. ( b ) Tumour size was measured twice a week after subcutaneous injection; n = 6, * P < 0.05 (Student’s t test). ( c ) Images of tumours at 28 days after inoculation with the indicated clones.

Article Snippet: The primary antibodies that were used are as follows: anti-ERO1α (Abnova), anti-integrin-β1, anti-HIF-1α (BD Biosciences), anti-ERO1β (Proteintech Group), anti-PDI, anti-ILK1, anti-Snail, anti-E-cadherin, anti-α-tubulin (Cell Signaling Technology), anti-PRDX4, anti-GAPDH, and anti-β-actin (Abcam).

Techniques: Expressing, Western Blot, Transfection, Injection, Clone Assay

Journal: ACS bio & med chem Au

Article Title: Identification of Natural Product Sulfuretin Derivatives as Inhibitors for the Endoplasmic Reticulum Redox Protein ERO1α

doi: 10.1021/acsbiomedchemau.1c00062

Figure Lengend Snippet: Purified human ERO1α (0.0625mg/mL) and purified human PDI (0.0625mg/mL) were incubated with increasing concentrations of EN-460, T151742, T151688 or T151750. Each data point shown is the average ± S.D (N=3 independent experiments and performed in triplicates). ****p<0.0001 by Two-way ANOVA.

Article Snippet: CRISPR Cas9: CRISPR Guide RNA 2 (TGTGAACAAGCTGAACGACT) targeting ERO1α and CRISPR Guide RNA 4 (AATTAAATCTGCGAGCTACA) were purchased from Genscript in the pLentiCRISPR V2 plasmid containing puromycin/ampicillin selection marker.

Techniques: Purification, Incubation

Journal: ACS bio & med chem Au

Article Title: Identification of Natural Product Sulfuretin Derivatives as Inhibitors for the Endoplasmic Reticulum Redox Protein ERO1α

doi: 10.1021/acsbiomedchemau.1c00062

Figure Lengend Snippet: Inhibition of ERO1α enzyme activity, reported as percent inhibition compared to vehicle control. Shown is the average of N=3 ± S.D.

Article Snippet: CRISPR Cas9: CRISPR Guide RNA 2 (TGTGAACAAGCTGAACGACT) targeting ERO1α and CRISPR Guide RNA 4 (AATTAAATCTGCGAGCTACA) were purchased from Genscript in the pLentiCRISPR V2 plasmid containing puromycin/ampicillin selection marker.

Techniques: Inhibition, Activity Assay, Control

Journal: ACS bio & med chem Au

Article Title: Identification of Natural Product Sulfuretin Derivatives as Inhibitors for the Endoplasmic Reticulum Redox Protein ERO1α

doi: 10.1021/acsbiomedchemau.1c00062

Figure Lengend Snippet: Surface-electrostatic potential differences are noticeable on the aurone and Calchone derivatives as compared to the ERO1α inhibitor EN-460, with T151742 showing stronger correlation. Blue shows positive charge areas, and red shows negative charge areas.

Article Snippet: CRISPR Cas9: CRISPR Guide RNA 2 (TGTGAACAAGCTGAACGACT) targeting ERO1α and CRISPR Guide RNA 4 (AATTAAATCTGCGAGCTACA) were purchased from Genscript in the pLentiCRISPR V2 plasmid containing puromycin/ampicillin selection marker.

Techniques:

Journal: ACS bio & med chem Au

Article Title: Identification of Natural Product Sulfuretin Derivatives as Inhibitors for the Endoplasmic Reticulum Redox Protein ERO1α

doi: 10.1021/acsbiomedchemau.1c00062

Figure Lengend Snippet: A.) Purified human ERO1α (0.0625mg/mL), varying concentrations of purified human PDI (0.25μM, 0.125μM, 0.0625μM, 0.03125μM, and 0.5% DMSO), and varying concentrations of T151742 (100μM, 75μM, 50μM, 25μM, 10 μM, 0.1 μM and 0.5% DMSO) were assayed using amplex red assay to quantify enzymatic activity. B.) The Lineweaver-Burk plot produced from taking the double reciprocal (1/[PDI]) vs (1/[T151742]). C.) Surface Plasma Resonance demonstrates binding of T151742 directly to ERO1α (Kd =31.4 μM).

Article Snippet: CRISPR Cas9: CRISPR Guide RNA 2 (TGTGAACAAGCTGAACGACT) targeting ERO1α and CRISPR Guide RNA 4 (AATTAAATCTGCGAGCTACA) were purchased from Genscript in the pLentiCRISPR V2 plasmid containing puromycin/ampicillin selection marker.

Techniques: Purification, Amplex Red Assay, Activity Assay, Produced, Clinical Proteomics, Binding Assay

Journal: ACS bio & med chem Au

Article Title: Identification of Natural Product Sulfuretin Derivatives as Inhibitors for the Endoplasmic Reticulum Redox Protein ERO1α

doi: 10.1021/acsbiomedchemau.1c00062

Figure Lengend Snippet: The crystal structure of the active ERO1α (3ahq.pdb) with the co-factor FAD was used for binding studies. A.) T151742 is shown docked with optimal hydrogen bonding of the 6-hydroxyl to GLN93 and the 3-ketone to GLY138; B.) Loss of the 6-hydroxyl in T151688 led to a decrease in binding; C.) Loss of the 4-dimethylamino leads to reposing with GLY138 bond not forming compared to T151742.

Article Snippet: CRISPR Cas9: CRISPR Guide RNA 2 (TGTGAACAAGCTGAACGACT) targeting ERO1α and CRISPR Guide RNA 4 (AATTAAATCTGCGAGCTACA) were purchased from Genscript in the pLentiCRISPR V2 plasmid containing puromycin/ampicillin selection marker.

Techniques: Binding Assay

Journal: ACS bio & med chem Au

Article Title: Identification of Natural Product Sulfuretin Derivatives as Inhibitors for the Endoplasmic Reticulum Redox Protein ERO1α

doi: 10.1021/acsbiomedchemau.1c00062

Figure Lengend Snippet: A.) PC-9 Cells were subjected to the cellular thermal shift assay in the absence or presence of T151742. Upon addition of T151742, Tagg was quantified for ERO1α, ERO1β, and LSD-1. Quantification of the average of n=3 independent experiments based on western blot analysis for ERO1α, ERO1β, and LSD-1. The dashed line (- - -) line represents the cut-off point at 10% which was used to define our aggregation temperature (Tagg) of individual proteins. B.) MTT viability assay comparing potency between ERO1α inhibitor EN-460, T151742, and T151742 derivative SR-F-114, revealing SR-F-114 is about two-fold less effective in vitro versus T151742 and EN-460 in the PC-9 non-small cell lung cancer cell line. Combined n=3 independent experiments performed in quadruplicates*** p <0.001 by one-way ANOVA. C.) Validation of ERO1α knockout in the PC-9 cell line utilizing CRISPR. D.) Two CRISPR deleted ERO1α clones were subjected to treatment of T151742 as well as the non-targeted control PC-9 cell line. Cellular viability was determined by MTT assay. n=3 independent experiments performed in quadruplicates. **** p<0.0001; by two-way ANOVA.

Article Snippet: CRISPR Cas9: CRISPR Guide RNA 2 (TGTGAACAAGCTGAACGACT) targeting ERO1α and CRISPR Guide RNA 4 (AATTAAATCTGCGAGCTACA) were purchased from Genscript in the pLentiCRISPR V2 plasmid containing puromycin/ampicillin selection marker.

Techniques: Thermal Shift Assay, Western Blot, MTT Viability Assay, In Vitro, Biomarker Discovery, Knock-Out, CRISPR, Clone Assay, Control, MTT Assay

Journal: iScience

Article Title: Development of luciferase-based highly sensitive reporters that detect ER-associated protein biogenesis abnormalities

doi: 10.1016/j.isci.2024.111189

Figure Lengend Snippet: Modulating the Ero1α activity has significant impacts on the redox environment of the ER (A) Structure of Bisphenol A (BPA) ( left ), an inhibitor of the Ero1α-dependent oxidation of PDI ( right ). . (B) Effect of BPA treatment on FLuc activity of HeLa cells expressing Calr (40 aa)-FLuc∗. Before assay, the cultures were treated with the indicated concentrations of BPA for 2.5 h. The data represent the means ± SD from four independent samples. One-way ANOVA followed by Dunnett’s test was used for statistical analysis. (C) Effect of BPA treatment on the oxidative state of FLuc∗. HeLa cells expressing Calr (40 aa)-FLuc∗ were treated with ( BPA ) or without ( Mock ) 200 μM BPA for 2.5 h, subjected to alkylation with Mal-PEG 2000 ( Mal-PEG 2K ), separated by reducing SDS-PAGE, and detected with anti-FLAG antibody. Lane 1, mock-transfected cells. Lane 2, no alkylation. Lane 3, proteins fully reduced in a buffer (100 mM Tris-HCl [pH 8.0], 100 mM DTT and 1% SDS) before alkylation of free cysteines with Mal-PEG 2000. An asterisk on lane 4 indicates the fully reduced form of FLuc∗ appearing upon treatment of cells with BPA. (D) Effect of overexpressing Ero1α and its hyperactive mutant on FLuc activity of HeLa cells expressing Calr (40 aa)-FLuc∗. (E) Effect of overexpressing Ero1α or its hyperactive mutant on the oxidative states of indicated FLuc∗ reporter proteins assessed as described in panel C. (F) Structures of Calr (40 aa)-FLuc∗ and Calr (40 aa)-FLuc∗ (−2 Cys) reporters. (G) Effect of overexpressing Ero1α and its hyperactive mutant on FLuc activity of HeLa cells expressing Calr (40 aa)-FLuc∗ (−2 Cys). For comparison, the activities were normalized with that of cells expressing Calr (40 aa)-FLuc∗. In (D) and (G), the data represent the means ± SD from five independent samples. Statistical analysis utilized one-way ANOVA followed by Tukey’s test.

Article Snippet: A human cDNA clone for Ero1α (IRAK013H07) and a human cDNA fragment encoding the C-terminal 490 amino acid residues of LMF1 (IRAK014N12) were obtained from the RIKEN BioResource Research Center.

Techniques: Activity Assay, Expressing, SDS Page, Transfection, Mutagenesis, Comparison

Journal: iScience

Article Title: Development of luciferase-based highly sensitive reporters that detect ER-associated protein biogenesis abnormalities

doi: 10.1016/j.isci.2024.111189

Figure Lengend Snippet:

Article Snippet: A human cDNA clone for Ero1α (IRAK013H07) and a human cDNA fragment encoding the C-terminal 490 amino acid residues of LMF1 (IRAK014N12) were obtained from the RIKEN BioResource Research Center.

Techniques: Virus, Recombinant, Mutagenesis, Western Blot, Control, Software

Journal: International Journal of Molecular Sciences

Article Title: ERO1α as a Potential Drug Target for Breast Cancer: A Systematic Review of Current Evidence

doi: 10.3390/ijms262110276

Figure Lengend Snippet: ERO1α-mediated immunosuppressive mechanism in the tumor microenvironment. Upregulation of ERO1α in cancer cells enhances the secretion of pro-inflammatory cytokines and chemokines such as G-CS), CXCL1, and CXCL2, which promote the recruitment and expansion of polymorphonuclear myeloid-derived suppressor cells (PMN-MDSCs). Simultaneously, ERO1α upregulates PD-L1 expression, further suppressing T cell-mediated anti-tumor immunity.

Article Snippet: 5 , 2019 , Takei et al. [ ] , ERO1α is a novel endogenous marker of hypoxia in human cancer cell lines , human, mice , MDA-MB-231 MCF7 , Under normoxic conditions, ERO1α is expressed across all tested cell lines, with notably higher levels in cancer cell lines. Additionally, the hypoxia marker CA9 is significantly elevated in the aggressive MDA-MB-231 breast cancer cells compared to both normal cells and MCF7 cells..

Techniques: Derivative Assay, Expressing