|
Addgene inc
taggcaccatggtccactgcag mythdf1 e4 Taggcaccatggtccactgcag Mythdf1 E4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/taggcaccatggtccactgcag mythdf1 e4/product/Addgene inc Average 95 stars, based on 1 article reviews
taggcaccatggtccactgcag mythdf1 e4 - by Bioz Stars,
2026-02
95/100 stars
|
Buy from Supplier |
|
Addgene inc
12urab 12urab, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/12urab/product/Addgene inc Average 93 stars, based on 1 article reviews
12urab - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Addgene inc
gfp Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gfp/product/Addgene inc Average 93 stars, based on 1 article reviews
gfp - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Addgene inc
plex cas9 addgene Plex Cas9 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plex cas9 addgene/product/Addgene inc Average 92 stars, based on 1 article reviews
plex cas9 addgene - by Bioz Stars,
2026-02
92/100 stars
|
Buy from Supplier |
|
Addgene inc
ecori restriction sites Ecori Restriction Sites, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ecori restriction sites/product/Addgene inc Average 93 stars, based on 1 article reviews
ecori restriction sites - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pet Pet, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pet/product/Addgene inc Average 93 stars, based on 1 article reviews
pet - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Addgene inc
lentiviral gfp cre empty vector ![]() Lentiviral Gfp Cre Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentiviral gfp cre empty vector/product/Addgene inc Average 91 stars, based on 1 article reviews
lentiviral gfp cre empty vector - by Bioz Stars,
2026-02
91/100 stars
|
Buy from Supplier |
|
Addgene inc
puro cre empty vector ![]() Puro Cre Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/puro cre empty vector/product/Addgene inc Average 93 stars, based on 1 article reviews
puro cre empty vector - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Addgene inc
luciferase vector ori empty plasmid ![]() Luciferase Vector Ori Empty Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/luciferase vector ori empty plasmid/product/Addgene inc Average 93 stars, based on 1 article reviews
luciferase vector ori empty plasmid - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Addgene inc
luc cre empty vector ![]() Luc Cre Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/luc cre empty vector/product/Addgene inc Average 93 stars, based on 1 article reviews
luc cre empty vector - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pet his6 sumo vector ![]() Pet His6 Sumo Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pet his6 sumo vector/product/Addgene inc Average 91 stars, based on 1 article reviews
pet his6 sumo vector - by Bioz Stars,
2026-02
91/100 stars
|
Buy from Supplier |
|
Addgene inc
gall 10 his6 mbp tev ura s cerevisiae expression vector ![]() Gall 10 His6 Mbp Tev Ura S Cerevisiae Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gall 10 his6 mbp tev ura s cerevisiae expression vector/product/Addgene inc Average 93 stars, based on 1 article reviews
gall 10 his6 mbp tev ura s cerevisiae expression vector - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: bioRxiv
Article Title: MCC950/CRID3 potently targets the NACHT domain of wildtype NLRP3 but not disease-associated mutants for inflammasome inhibition
doi: 10.1101/634493
Figure Lengend Snippet: (A-F) Wild type (A- B), Nlrp3 L351P/L351P (C-D) or Nlrp3 A350V/A350V (E-F) BMDMs that were transduced with a Cre-recombinase expressing lentiviral vector, were left unstimulated (Ctrl) or stimulated with LPS and then left untreated or treated with ATP or nigericin (Nig) in absence or presence of MCC950/CRID3. Supernatants was analyzed for IL-1β (A,C,E) and IL-18 (B,D,F) secretion. Graphs show mean ± s.d. of triplicate wells and represent three independent experiments.
Article Snippet: To induce lentivirus production, the
Techniques: Transduction, Expressing, Plasmid Preparation