eif6 Search Results


86
Thermo Fisher gene exp eif6 mm04208296 m1
Gene Exp Eif6 Mm04208296 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp eif6 mm04208296 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp eif6 mm04208296 m1 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

93
Proteintech anti eif3a
Anti Eif3a, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti eif3a/product/Proteintech
Average 93 stars, based on 1 article reviews
anti eif3a - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc anti eif6
Anti Eif6, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti eif6/product/Cell Signaling Technology Inc
Average 94 stars, based on 1 article reviews
anti eif6 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

92
Bethyl rabbit anti eif6
Rabbit Anti Eif6, supplied by Bethyl, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti eif6/product/Bethyl
Average 92 stars, based on 1 article reviews
rabbit anti eif6 - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc rabbit anti eif6
Rabbit Anti Eif6, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti eif6/product/Cell Signaling Technology Inc
Average 94 stars, based on 1 article reviews
rabbit anti eif6 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology anti eif6 monoclonal antibody
Anti Eif6 Monoclonal Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti eif6 monoclonal antibody/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
anti eif6 monoclonal antibody - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

87
Thermo Fisher gene exp eif6 hs00158272 m1
Gene Exp Eif6 Hs00158272 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp eif6 hs00158272 m1/product/Thermo Fisher
Average 87 stars, based on 1 article reviews
gene exp eif6 hs00158272 m1 - by Bioz Stars, 2026-03
87/100 stars
  Buy from Supplier

92
Boster Bio ihc
Ihc, supplied by Boster Bio, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ihc/product/Boster Bio
Average 92 stars, based on 1 article reviews
ihc - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

88
Thermo Fisher gene exp eif6 dm01844498 s1
(a) Representative stereomicroscope images of GMRGAL4/+ and <t>GMR>eIF6</t> eyes, showing a noteworthy rough eye phenotype. Scale bar 300 µm. (b) Western blot showing the levels of eIF6 expression in GMRGAL4/+ and GMR>eIF6 adult eyes. Representative western blots from three independent experiments are shown. Molecular weight markers (kDa) are shown to the left of each panel. Ratio was calculated with ImageJ software. The value corresponds to the intensity ratio between eIF6 and β-actin bands for each genotype. (c) Representative SEM images of GMRGAL4/+ and GMR>eIF6 adult eyes. eIF6 overexpressing eyes have an aberrant morphology, showing flattened ommatidia and randomly arranged bristles. Scale bar, respectively for 2400X, 5000X and 10000X magnifications are 10 µm, 5 µm and 2.5 µm (d) Representative tangential sections of GMRGAL4/+ and GMR>eIF6 adult eyes indicating that photoreceptors are still present in GMR>eIF6 eyes, even if their arrangement is lost. Scale bar 10 µm.
Gene Exp Eif6 Dm01844498 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp eif6 dm01844498 s1/product/Thermo Fisher
Average 88 stars, based on 1 article reviews
gene exp eif6 dm01844498 s1 - by Bioz Stars, 2026-03
88/100 stars
  Buy from Supplier

90
Thermo Fisher gene exp eif6 mm00550245 m1
(a) Representative stereomicroscope images of GMRGAL4/+ and <t>GMR>eIF6</t> eyes, showing a noteworthy rough eye phenotype. Scale bar 300 µm. (b) Western blot showing the levels of eIF6 expression in GMRGAL4/+ and GMR>eIF6 adult eyes. Representative western blots from three independent experiments are shown. Molecular weight markers (kDa) are shown to the left of each panel. Ratio was calculated with ImageJ software. The value corresponds to the intensity ratio between eIF6 and β-actin bands for each genotype. (c) Representative SEM images of GMRGAL4/+ and GMR>eIF6 adult eyes. eIF6 overexpressing eyes have an aberrant morphology, showing flattened ommatidia and randomly arranged bristles. Scale bar, respectively for 2400X, 5000X and 10000X magnifications are 10 µm, 5 µm and 2.5 µm (d) Representative tangential sections of GMRGAL4/+ and GMR>eIF6 adult eyes indicating that photoreceptors are still present in GMR>eIF6 eyes, even if their arrangement is lost. Scale bar 10 µm.
Gene Exp Eif6 Mm00550245 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp eif6 mm00550245 m1/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
gene exp eif6 mm00550245 m1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
OriGene human eif3a
(a) Representative stereomicroscope images of GMRGAL4/+ and <t>GMR>eIF6</t> eyes, showing a noteworthy rough eye phenotype. Scale bar 300 µm. (b) Western blot showing the levels of eIF6 expression in GMRGAL4/+ and GMR>eIF6 adult eyes. Representative western blots from three independent experiments are shown. Molecular weight markers (kDa) are shown to the left of each panel. Ratio was calculated with ImageJ software. The value corresponds to the intensity ratio between eIF6 and β-actin bands for each genotype. (c) Representative SEM images of GMRGAL4/+ and GMR>eIF6 adult eyes. eIF6 overexpressing eyes have an aberrant morphology, showing flattened ommatidia and randomly arranged bristles. Scale bar, respectively for 2400X, 5000X and 10000X magnifications are 10 µm, 5 µm and 2.5 µm (d) Representative tangential sections of GMRGAL4/+ and GMR>eIF6 adult eyes indicating that photoreceptors are still present in GMR>eIF6 eyes, even if their arrangement is lost. Scale bar 10 µm.
Human Eif3a, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human eif3a/product/OriGene
Average 90 stars, based on 1 article reviews
human eif3a - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


(a) Representative stereomicroscope images of GMRGAL4/+ and GMR>eIF6 eyes, showing a noteworthy rough eye phenotype. Scale bar 300 µm. (b) Western blot showing the levels of eIF6 expression in GMRGAL4/+ and GMR>eIF6 adult eyes. Representative western blots from three independent experiments are shown. Molecular weight markers (kDa) are shown to the left of each panel. Ratio was calculated with ImageJ software. The value corresponds to the intensity ratio between eIF6 and β-actin bands for each genotype. (c) Representative SEM images of GMRGAL4/+ and GMR>eIF6 adult eyes. eIF6 overexpressing eyes have an aberrant morphology, showing flattened ommatidia and randomly arranged bristles. Scale bar, respectively for 2400X, 5000X and 10000X magnifications are 10 µm, 5 µm and 2.5 µm (d) Representative tangential sections of GMRGAL4/+ and GMR>eIF6 adult eyes indicating that photoreceptors are still present in GMR>eIF6 eyes, even if their arrangement is lost. Scale bar 10 µm.

Journal: bioRxiv

Article Title: The eukaryotic Initiation Factor 6 (eIF6) regulates ecdysone biosynthesis by modulating translation in Drosophila

doi: 10.1101/201558

Figure Lengend Snippet: (a) Representative stereomicroscope images of GMRGAL4/+ and GMR>eIF6 eyes, showing a noteworthy rough eye phenotype. Scale bar 300 µm. (b) Western blot showing the levels of eIF6 expression in GMRGAL4/+ and GMR>eIF6 adult eyes. Representative western blots from three independent experiments are shown. Molecular weight markers (kDa) are shown to the left of each panel. Ratio was calculated with ImageJ software. The value corresponds to the intensity ratio between eIF6 and β-actin bands for each genotype. (c) Representative SEM images of GMRGAL4/+ and GMR>eIF6 adult eyes. eIF6 overexpressing eyes have an aberrant morphology, showing flattened ommatidia and randomly arranged bristles. Scale bar, respectively for 2400X, 5000X and 10000X magnifications are 10 µm, 5 µm and 2.5 µm (d) Representative tangential sections of GMRGAL4/+ and GMR>eIF6 adult eyes indicating that photoreceptors are still present in GMR>eIF6 eyes, even if their arrangement is lost. Scale bar 10 µm.

Article Snippet: For RNA-Seq validation, Taqman probes specific for eIF6 (Dm01844498_g1) and rpl32 (Dm02151827_g1) were used, together with standard primers ( rpl32 Fwd CGGATCGATATGCTAAGCTGT, Rev CGACGCACTCYCYYGTCG; shd Fwd CGGGCTACTCGCTTAATGCAG, Rev AGCAGCACCACCTCCATTTC).

Techniques: Western Blot, Expressing, Molecular Weight, Software

(a) Mid-pupal stage retinae (40h APF) stained for the Drosophila caspase Dcp-1. GMRGAL4/+ retinae show Dcp-1 positive cells, indicating that PCD is ongoing at this developmental stage. On the contrary, GMR>eIF6 retinae do not show Dcp-1 positive cells, indicating a block in PCD. Scale bar 10 µm. (b) Late-pupal stage (60h APF) retinae stained for the Drosophila caspase Dcp-1. GMRGAL4/+ retinae show the absence of Dcp-1 positive cells, as expected (PCD already finished at this developmental stage). On the contrary, GMR>eIF6 retinae, show Dcp-1 positive cells, indicating a delay in PCD associated to more eIF6 levels. Scale bar 10 µm. (c-d) Representative barplot showing the Dcp-1 positive cells counts average from four different area (n=4) at 40h APF (c) and 60h APF (d) retinae with error bars indicating the SEM. P-values were calculated using an unpaired two-tailed Student t-test. Dcp-1 positive cells counts indicate an overall delay and increase in PCD when eIF6 gene dosage is increased during eye development.

Journal: bioRxiv

Article Title: The eukaryotic Initiation Factor 6 (eIF6) regulates ecdysone biosynthesis by modulating translation in Drosophila

doi: 10.1101/201558

Figure Lengend Snippet: (a) Mid-pupal stage retinae (40h APF) stained for the Drosophila caspase Dcp-1. GMRGAL4/+ retinae show Dcp-1 positive cells, indicating that PCD is ongoing at this developmental stage. On the contrary, GMR>eIF6 retinae do not show Dcp-1 positive cells, indicating a block in PCD. Scale bar 10 µm. (b) Late-pupal stage (60h APF) retinae stained for the Drosophila caspase Dcp-1. GMRGAL4/+ retinae show the absence of Dcp-1 positive cells, as expected (PCD already finished at this developmental stage). On the contrary, GMR>eIF6 retinae, show Dcp-1 positive cells, indicating a delay in PCD associated to more eIF6 levels. Scale bar 10 µm. (c-d) Representative barplot showing the Dcp-1 positive cells counts average from four different area (n=4) at 40h APF (c) and 60h APF (d) retinae with error bars indicating the SEM. P-values were calculated using an unpaired two-tailed Student t-test. Dcp-1 positive cells counts indicate an overall delay and increase in PCD when eIF6 gene dosage is increased during eye development.

Article Snippet: For RNA-Seq validation, Taqman probes specific for eIF6 (Dm01844498_g1) and rpl32 (Dm02151827_g1) were used, together with standard primers ( rpl32 Fwd CGGATCGATATGCTAAGCTGT, Rev CGACGCACTCYCYYGTCG; shd Fwd CGGGCTACTCGCTTAATGCAG, Rev AGCAGCACCACCTCCATTTC).

Techniques: Staining, Blocking Assay, Two Tailed Test

(a) Mid-pupal stage (40h APF) retinae stained for Armadillo, the Drosophila β-catenin homologue, showing that when eIF6 is increased there are extra-numerary cells (indicated as *) around each ommatidium. Scale bar 10 µm. (b) Late-pupal stage (60h APF) retinae stained for Armadillo, showing the loss of all cells around ommatidia upon eIF6 overexpression. Scale bar 10 µm.

Journal: bioRxiv

Article Title: The eukaryotic Initiation Factor 6 (eIF6) regulates ecdysone biosynthesis by modulating translation in Drosophila

doi: 10.1101/201558

Figure Lengend Snippet: (a) Mid-pupal stage (40h APF) retinae stained for Armadillo, the Drosophila β-catenin homologue, showing that when eIF6 is increased there are extra-numerary cells (indicated as *) around each ommatidium. Scale bar 10 µm. (b) Late-pupal stage (60h APF) retinae stained for Armadillo, showing the loss of all cells around ommatidia upon eIF6 overexpression. Scale bar 10 µm.

Article Snippet: For RNA-Seq validation, Taqman probes specific for eIF6 (Dm01844498_g1) and rpl32 (Dm02151827_g1) were used, together with standard primers ( rpl32 Fwd CGGATCGATATGCTAAGCTGT, Rev CGACGCACTCYCYYGTCG; shd Fwd CGGGCTACTCGCTTAATGCAG, Rev AGCAGCACCACCTCCATTTC).

Techniques: Staining, Over Expression

(a-b) Overexpression of eIF6 in cone cells results in rough eye phenotype. (a) Representative stereomicroscope images of spaGAL4/+ and spa>eIF6 eyes showing a rough eye phenotype. Scale bar 100 µm (b) Representative tangential semithin sections of spaGAL4/+ and spa>eIF6 adult eyes showing disruption of the structure upon eIF6 overexpression in cone cells. Scale bar 10 µm. (c) Mid-pupal stage (40h APF) retinae of spaGAL4/+ and spa>eIF6 genotypes stained for Dcp-1 confirm the block in apoptosis already demonstrated in GMR>eIF6 retinae. (d) Late-pupal stage (60h APF) retinae of spaGAL4/+ and spa>eIF6 genotypes stained for Dcp-1 confirming the delayed and increased apoptosis already observed in GMR>eIF6 retinae. (c-d) Scale bar 10 µm.

Journal: bioRxiv

Article Title: The eukaryotic Initiation Factor 6 (eIF6) regulates ecdysone biosynthesis by modulating translation in Drosophila

doi: 10.1101/201558

Figure Lengend Snippet: (a-b) Overexpression of eIF6 in cone cells results in rough eye phenotype. (a) Representative stereomicroscope images of spaGAL4/+ and spa>eIF6 eyes showing a rough eye phenotype. Scale bar 100 µm (b) Representative tangential semithin sections of spaGAL4/+ and spa>eIF6 adult eyes showing disruption of the structure upon eIF6 overexpression in cone cells. Scale bar 10 µm. (c) Mid-pupal stage (40h APF) retinae of spaGAL4/+ and spa>eIF6 genotypes stained for Dcp-1 confirm the block in apoptosis already demonstrated in GMR>eIF6 retinae. (d) Late-pupal stage (60h APF) retinae of spaGAL4/+ and spa>eIF6 genotypes stained for Dcp-1 confirming the delayed and increased apoptosis already observed in GMR>eIF6 retinae. (c-d) Scale bar 10 µm.

Article Snippet: For RNA-Seq validation, Taqman probes specific for eIF6 (Dm01844498_g1) and rpl32 (Dm02151827_g1) were used, together with standard primers ( rpl32 Fwd CGGATCGATATGCTAAGCTGT, Rev CGACGCACTCYCYYGTCG; shd Fwd CGGGCTACTCGCTTAATGCAG, Rev AGCAGCACCACCTCCATTTC).

Techniques: Over Expression, Disruption, Staining, Blocking Assay

(a) Venn Diagram indicating genes differentially expressed in GMR>eIF6 larval eye imaginal discs and GMR>eIF6 retinae with respect to controls ( GMRGAL4/+) . (b) The Ecdysone Biosynthetic Pathway is shut off when eIF6 is upregulated. Heat Map representing absolute gene expression levels in GMR>eIF6 and GMRGAL4/+ eye imaginal disc samples for the subset of gene sets involved in Ecdysone Biosynthesis by Gene Ontology analysis. (c) Gene Set Association Analysis (GSAA) indicates a significative upregulation of ribosomal machinery. Representative Enrichment Plots indicating a striking upregulation of genes involved in rRNA Processing and Ribosome Biogenesis in both GMR>eIF6 eye imaginal discs and GMR>eIF6 retinae with respect to their controls ( GMRGAL4/+) . (d) mRNAs involved in Programmed Cell Death and in Eye Differentiation are upregulated in GMR>eIF6 retinae. Heat Map representing absolute gene expression levels in GMR>DeIF6 and GMRGAL4/+ retinae samples for the subset of gene sets involved in Programmed Cell Death and Eye Differentiation by Gene Ontology Analysis.

Journal: bioRxiv

Article Title: The eukaryotic Initiation Factor 6 (eIF6) regulates ecdysone biosynthesis by modulating translation in Drosophila

doi: 10.1101/201558

Figure Lengend Snippet: (a) Venn Diagram indicating genes differentially expressed in GMR>eIF6 larval eye imaginal discs and GMR>eIF6 retinae with respect to controls ( GMRGAL4/+) . (b) The Ecdysone Biosynthetic Pathway is shut off when eIF6 is upregulated. Heat Map representing absolute gene expression levels in GMR>eIF6 and GMRGAL4/+ eye imaginal disc samples for the subset of gene sets involved in Ecdysone Biosynthesis by Gene Ontology analysis. (c) Gene Set Association Analysis (GSAA) indicates a significative upregulation of ribosomal machinery. Representative Enrichment Plots indicating a striking upregulation of genes involved in rRNA Processing and Ribosome Biogenesis in both GMR>eIF6 eye imaginal discs and GMR>eIF6 retinae with respect to their controls ( GMRGAL4/+) . (d) mRNAs involved in Programmed Cell Death and in Eye Differentiation are upregulated in GMR>eIF6 retinae. Heat Map representing absolute gene expression levels in GMR>DeIF6 and GMRGAL4/+ retinae samples for the subset of gene sets involved in Programmed Cell Death and Eye Differentiation by Gene Ontology Analysis.

Article Snippet: For RNA-Seq validation, Taqman probes specific for eIF6 (Dm01844498_g1) and rpl32 (Dm02151827_g1) were used, together with standard primers ( rpl32 Fwd CGGATCGATATGCTAAGCTGT, Rev CGACGCACTCYCYYGTCG; shd Fwd CGGGCTACTCGCTTAATGCAG, Rev AGCAGCACCACCTCCATTTC).

Techniques: Gene Expression

(a) In vitro iRIA assays showing that eIF6 increased dosage reduce the number of free 60S subunits. Values represent the mean ± SEM from two replicates. Assays were repeated three times. Student’s t-test was used to calculate p values. (b) In vitro SUnSET assays showing that eIF6 increased gene is associated with increased puromycin incorporation. Barplots represent the mean ± SEM from three replicates. Assays were repeated three times. Student’s t-test was used to calculate p values. Quantification of SUnSET assay was performed with ImageJ software. (c) Representative SUnSET assay performed using immunofluorescence experiments, indicating a two-fold increase in general translation when eIF6 levels are increased in eye imaginal discs. Scale bar 10 µm. (d) Adult wings MS>eIF6 have a completely aberrant phenotype. (e) In vitro SUnSET assays showing that eIF6 increased gene is associated with 2-fold puromycin incorporation in wing discs. Barplots represent the mean ± SEM from three replicates. Assays were repeated three times. Student’s t-test was used to calculate p values. Quantification of SUnSET assay was performed with ImageJ software.

Journal: bioRxiv

Article Title: The eukaryotic Initiation Factor 6 (eIF6) regulates ecdysone biosynthesis by modulating translation in Drosophila

doi: 10.1101/201558

Figure Lengend Snippet: (a) In vitro iRIA assays showing that eIF6 increased dosage reduce the number of free 60S subunits. Values represent the mean ± SEM from two replicates. Assays were repeated three times. Student’s t-test was used to calculate p values. (b) In vitro SUnSET assays showing that eIF6 increased gene is associated with increased puromycin incorporation. Barplots represent the mean ± SEM from three replicates. Assays were repeated three times. Student’s t-test was used to calculate p values. Quantification of SUnSET assay was performed with ImageJ software. (c) Representative SUnSET assay performed using immunofluorescence experiments, indicating a two-fold increase in general translation when eIF6 levels are increased in eye imaginal discs. Scale bar 10 µm. (d) Adult wings MS>eIF6 have a completely aberrant phenotype. (e) In vitro SUnSET assays showing that eIF6 increased gene is associated with 2-fold puromycin incorporation in wing discs. Barplots represent the mean ± SEM from three replicates. Assays were repeated three times. Student’s t-test was used to calculate p values. Quantification of SUnSET assay was performed with ImageJ software.

Article Snippet: For RNA-Seq validation, Taqman probes specific for eIF6 (Dm01844498_g1) and rpl32 (Dm02151827_g1) were used, together with standard primers ( rpl32 Fwd CGGATCGATATGCTAAGCTGT, Rev CGACGCACTCYCYYGTCG; shd Fwd CGGGCTACTCGCTTAATGCAG, Rev AGCAGCACCACCTCCATTTC).

Techniques: In Vitro, Software, Immunofluorescence

(a-b) 20-HE treatment partially rescue the rough eye phenotype and the delay in apoptosis in 40h APF retinae (a) The barplot represents the average of n>8 independently collected samples with error bars indicating the SEM. P-values were calculated using an upaired two-tailed Student t-test. The graph shows the GMR>eIF6 adult fly eye size with or without treatment with 20-HE. As indicated in the barplot, the fly eye size is partially rescued when the hormone is added to the fly food. (b) Immunofluorescence images showing that 20-HE treatment (240 µg/mL in standard fly food) rescues the apoptotic delay observed in GMR>eIF6 40h APF retinae. (c-e) Real-time PCR analyses of the indicated genes showing an inverse correlation between eIF6 and shd mRNA levels. The RNA level of each gene was calculated relative to RpL32 expression as a reference gene. The barplot represents the average of at least three independent biological replicates with error bars indicating the SEM. p-values were calculated using an upaired two-tailed Student t-test. (c) Real-time PCR analyses of the indicated genes in GMRGAL4/+ and GMR>eIF6 eye imaginal discs. Upon eIF6 overexpression, GMR>eIF6 eye imaginal discs have less abundance of shd mRNA levels compared to GMRGAL4/+ eye imaginal discs. (d-e) During development, eIF6 and shd mRNA levels show an inverse correlation by comparing embryos with first instar larval RNA extracts (d) or by comparing first and thirs instar larval RNA extracts (e) . (f-g) The ecdysone biosynthetic pathway genes shd and EcR are modulated upon translation modulation in S2 cells. (f) Real time analysis evidences that upon inhibition of translation with rapamycin treatment (1 µM, 2 hours) the level of shd and EcR mRNA levels increase, contrary to the drop observed upon translation stimulation with insulin (1 µM, 12 hours). The RNA level of each gene was calculated relative to RpL32 expression as a reference gene. The barplot represents the average of at least three independent biological replicates with error bars indicating the SEM. p-values were calculated using an upaired two-tailed Student t-test. (g). Representative western blot showing the decreased or increased rate of protein synthesis upon rapamycin or insulin treatment respectively with SUnSET method

Journal: bioRxiv

Article Title: The eukaryotic Initiation Factor 6 (eIF6) regulates ecdysone biosynthesis by modulating translation in Drosophila

doi: 10.1101/201558

Figure Lengend Snippet: (a-b) 20-HE treatment partially rescue the rough eye phenotype and the delay in apoptosis in 40h APF retinae (a) The barplot represents the average of n>8 independently collected samples with error bars indicating the SEM. P-values were calculated using an upaired two-tailed Student t-test. The graph shows the GMR>eIF6 adult fly eye size with or without treatment with 20-HE. As indicated in the barplot, the fly eye size is partially rescued when the hormone is added to the fly food. (b) Immunofluorescence images showing that 20-HE treatment (240 µg/mL in standard fly food) rescues the apoptotic delay observed in GMR>eIF6 40h APF retinae. (c-e) Real-time PCR analyses of the indicated genes showing an inverse correlation between eIF6 and shd mRNA levels. The RNA level of each gene was calculated relative to RpL32 expression as a reference gene. The barplot represents the average of at least three independent biological replicates with error bars indicating the SEM. p-values were calculated using an upaired two-tailed Student t-test. (c) Real-time PCR analyses of the indicated genes in GMRGAL4/+ and GMR>eIF6 eye imaginal discs. Upon eIF6 overexpression, GMR>eIF6 eye imaginal discs have less abundance of shd mRNA levels compared to GMRGAL4/+ eye imaginal discs. (d-e) During development, eIF6 and shd mRNA levels show an inverse correlation by comparing embryos with first instar larval RNA extracts (d) or by comparing first and thirs instar larval RNA extracts (e) . (f-g) The ecdysone biosynthetic pathway genes shd and EcR are modulated upon translation modulation in S2 cells. (f) Real time analysis evidences that upon inhibition of translation with rapamycin treatment (1 µM, 2 hours) the level of shd and EcR mRNA levels increase, contrary to the drop observed upon translation stimulation with insulin (1 µM, 12 hours). The RNA level of each gene was calculated relative to RpL32 expression as a reference gene. The barplot represents the average of at least three independent biological replicates with error bars indicating the SEM. p-values were calculated using an upaired two-tailed Student t-test. (g). Representative western blot showing the decreased or increased rate of protein synthesis upon rapamycin or insulin treatment respectively with SUnSET method

Article Snippet: For RNA-Seq validation, Taqman probes specific for eIF6 (Dm01844498_g1) and rpl32 (Dm02151827_g1) were used, together with standard primers ( rpl32 Fwd CGGATCGATATGCTAAGCTGT, Rev CGACGCACTCYCYYGTCG; shd Fwd CGGGCTACTCGCTTAATGCAG, Rev AGCAGCACCACCTCCATTTC).

Techniques: Two Tailed Test, Immunofluorescence, Real-time Polymerase Chain Reaction, Expressing, Over Expression, Inhibition, Western Blot