Journal: Nature

Article Title: Targeting G1–S-checkpoint-compromised cancers with cyclin A/B RxL inhibitors

doi: 10.1038/s41586-025-09433-w

Figure Lengend Snippet: a , Representative γH2AX and DAPI confocal microscopic images of NCI-H1048 cells treated with the cyclin A/B RxL inhibitor (CIRc-004) at 20 nM or DMSO for 72 h. Magnification = 63x, scale bar = 10 µm. b, c , Immunoblot analysis for phospho-RPA2 S33 ( b ) and phospho-KAP1 ( c ) of NCI-H1048 treated with CIRc-004 at indicated concentrations for 24 h. d , Immunoblot analysis of NCI-H1048 cells infected with indicated sgRNAs and then treated CIRc-004 at 20 nM or DMSO for 72 h. e , Immunoblot analysis of histone lysates from NCI-H1048 cells treated with the selective cyclin A RxL inhibitor (CIRc-018), the selective cyclin B RxL inhibitor (CIRc-019), the cyclin A/B RxL inhibitor (CIRc-004), or DMSO (vehicle) for 72 h. f , E2F3 Immunoblot analysis after IP of endogenous cyclin A in NCI-H1048 cells treated with CIRc-004 (300 nM), CIRc-005 (inactive enantiomer of CIRc-004, I.E), cyclin A RxL inhibitor (CIRc-018) or DMSO for 2 h. E2F3 band intensity is normalized to cyclin A shown at the bottom. n = 2 biological independent experiments. g , Immunoblot analysis of NCI-H82 cells infected with a doxycycline (DOX) inducible E2F1 sgRNA-resistant cDNA and then superinfected with an sgRNA targeted endogenous E2F1 grown in the presence or absence of DOX for 24 h. h , Dose response assays of NCI-H82 cells from g grown in the presence or absence of DOX for 24 h and then treated with increasing concentrations of CIRc-004 for 6 days. Data are mean +/− SD and arrows indicates DMSO-treated sample which was used for normalization. i,k , Immunoblot analysis of NCI-H1048 ( i ) and Jurkat ( k ) cells infected with a doxycycline (DOX) inducible E2F1, E2F2 or E2F3 cDNA grown in the presence or absence of DOX for 24 h. j , l , Quantitation of average half-maximal effective concentration (EC50) without (light blue) or with (dark blue) DOX of NCI-H1048 ( j ) or Jurkat cells ( l ) from i, k expressing DOX inducible E2F1, E2F2, E2F3 treated with CIRc-004 at increasing concentrations for 3 days ( j) or 6 days ( l) . For a-e , h, j, l , representative immunoblots from 3 independent experiments are shown. For histone blots in d , e , total histone H3 run as sample processing control on separate gel.

Article Snippet: To make the DOX-on pTripz neo E2F1, E2F2 or E2F3 construct, pDONR223 E2F1 (W. G. Kaelin’s laboratory), pCMVHA E2F2 (Addgene, 24226) and pCMV Tag2B E2F3 (Addgene, 202522) were used as templates for overhang PCR to introduce the attB1 and attB2 sites onto the 5′ and 3′ ends of E2F1 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGCCTTGGCCGGGGCCCCTGCG; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTGAAATCCAGGGGGGTGAGGTCCCC-3′), E2F2 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGCTGCAAGGGCCCCGGGCCTTG-3′; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTATTAATCAACAGGTCCCCAAGGTC-3′) and E2F3 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGAGAAAGGGAATCCAGCCCGCT; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTACTACACATGAAGTCTTCCACCAG-3′).

Techniques: Western Blot, Infection, Quantitation Assay, Concentration Assay, Expressing, Control

Journal: BMC Molecular Biology

Article Title: Identification of a candidate alternative promoter region of the human Bcl2L11 (Bim) gene

doi: 10.1186/1471-2199-9-56

Figure Lengend Snippet: BCL2L11(BIM)-P1 activity is regulated by E2F . For simplicity the alias BIM is used in the figure instead of the approved gene symbol BIM. A . Inducibility of endogenous E1 and E2-bearing BIM transcripts by transiently transfected E2F expression construct in HEK293 cells; real-time experiments were performed as previously in cells transfected with either pBst or an E2F expression construct, and the fold inducibility (relatively to pBst transfected cells) of individual transcripts by the E2F expression plasmid is presented; the results confirm reporter data and show that the expression of endogenous BIM transcripts derived from P1 can be induced by E2F. *p < 0.01, Anova: single factor. B . Analysis of the effects of E2F overerexpression on pBIM-P1-1918(+) activity in HEK293 cells. A concentration-dependent inducibility of P1 activity is observed; by contrast, a version of P1 comprising a 5' deletion of 1300 bp results in a promoter construct with a basal activity comparable to P1-1918, but without the capacity for E2F-mediated activation, suggesting the presence of E2F responsive elements in the deleted region. *p < 0.01, Anova: single factor.

Article Snippet: HEK293 cells were cotransfected with 0.05 μg of reporter plasmid, 0.01 μg of Renilla vector (pRL-TK, Promega), 0.01 μg of empty plasmid Bluescript (Stratagene, Inc.) or 0.1 or 0.05 μg Human E2F expression construct (Origene, Inc.) in 95 μl of serum-free medium per well in 96-well plate using Lipofectamine 2000 [ ].

Techniques: Activity Assay, Transfection, Expressing, Construct, Plasmid Preparation, Derivative Assay, Concentration Assay, Activation Assay

Journal: BMC Molecular Biology

Article Title: Identification of a candidate alternative promoter region of the human Bcl2L11 (Bim) gene

doi: 10.1186/1471-2199-9-56

Figure Lengend Snippet: Effects of E2F on BCL2L11-P1 constructs . For simplicity the alias BIM is used in the figure instead of the approved gene symbol BCL2L11. A . Sequence of the -1918 P1 region showing the position of 5' deletion variants. Forward primers used to generate the various P1 5' deletion variants are indicated (arrows). The putative E2F binding site is boxed, and the transcript initiation site is indicated (+1). B . Analysis of the effects of E2F over-expression on pBIM-P1 and 5'deletion variants activity in HEK293 cells. A concentration-dependent inducibility of P1 activity is observed in construct pBIM-P1-1918, -1565 and -1326, which contain a putative E2F responsive element. By contrast, pBIM-P1-1284 and -940 display basal activities comparable to pBCL2L11-P1-1918, but without the capacity for E2F-mediated response, suggesting a loss of E2F responsive element(s). *p < 0.05 and **p < 0.01, Anova: single factor.

Article Snippet: HEK293 cells were cotransfected with 0.05 μg of reporter plasmid, 0.01 μg of Renilla vector (pRL-TK, Promega), 0.01 μg of empty plasmid Bluescript (Stratagene, Inc.) or 0.1 or 0.05 μg Human E2F expression construct (Origene, Inc.) in 95 μl of serum-free medium per well in 96-well plate using Lipofectamine 2000 [ ].

Techniques: Construct, Sequencing, Binding Assay, Over Expression, Activity Assay, Concentration Assay

Journal: BMC Molecular Biology

Article Title: Identification of a candidate alternative promoter region of the human Bcl2L11 (Bim) gene

doi: 10.1186/1471-2199-9-56

Figure Lengend Snippet: E2F binding to a candidate E2F binding site in BCL2L11-P1 . EMSA on the candidate E2F binding site (CTCTGCGCGCCAGAGG). HEK293 cells were transfected with the E2F expression construct, and nuclear extracts were assayed for capacity for specific binding to the candidate E2F binding site through competition with a specific (E2F) or unspecific (NF-κB) unlabelled competitor double stranded (ds) oligonucleotide. A specific shift is identified (arrow) upon transfection with the E2F expression plasmid, which can only be competed with a specific ds oligonucleotide.

Article Snippet: HEK293 cells were cotransfected with 0.05 μg of reporter plasmid, 0.01 μg of Renilla vector (pRL-TK, Promega), 0.01 μg of empty plasmid Bluescript (Stratagene, Inc.) or 0.1 or 0.05 μg Human E2F expression construct (Origene, Inc.) in 95 μl of serum-free medium per well in 96-well plate using Lipofectamine 2000 [ ].

Techniques: Binding Assay, Transfection, Expressing, Construct, Plasmid Preparation

Journal: Frontiers in Oncology

Article Title: An E2F1/DDX11/EZH2 Positive Feedback Loop Promotes Cell Proliferation in Hepatocellular Carcinoma

doi: 10.3389/fonc.2020.593293

Figure Lengend Snippet: E2F1/DDX11/EZH2 forms a positive feedback loop in HCC cells. (A) GSEA indicated that DDX11 may be a downstream target of E2F transcription factors. (B, C) HepG2 and PLC8024 cells were transfected with siRNAs for E2F family members, including E2F1, E2F2, and E2F3. The expression of E2Fs and DDX11 mRNA was determined by qRT-PCR (B) and western blot (C) . (D) E2F1 was overexpressed in HCC cells. Expression of E2F1, DDX11, EZH2, and p21 was examined. (E) Dual luciferase reporter assays were performed in HepG2 cells with E2F1 overexpression or knockdown to indicate the effect of E2F1 on the activity of DDX11 promoter. ** P < 0.01, *** P < 0.001. (F) ChIP assays were used to detect the enrichment of E2F1 on DDX11 promoter. * P < 0.05. (G) Correlation between DDX11 mRNA and E2F1 was determined in 24 HCC tissues (Pearson correlation analysis). (H) The positive correlation of E2F1 and DDX11 protein expression was confirmed in 303 paraffin-embedded HCC tissues. Patients with high expression of E2F1 were accompanied with more DDX11 expression. (I) Cells with E2F1 silence were transfected with DDX11 overexpression vector. Colony formation was performed to examine the role of DDX11 in shE1F1-mediated cell growth suppression. * P < 0.05. (J) Cells were transfected with E2F1 siRNA and DDX11 overexpression vector for 36 h. The mRNA expression of EZH2 was examined. ns, not significant. (K) According to the published data (GDS2445), DDX11 mRNA was downregulated in EZH2 -/- cells. (L) The association of EZH2 and DDX11 was determined in TCGA cases. (M) Cells were overexpressed with EZH2 and/or knockdown of E2F1. The mRNA expression of DDX11 was examined. * P < 0.05.

Article Snippet: Stable cell lines were constructed by transfecting cells with pcDNA (3.1) overexpression vector encoding full-length DDX11 cDNA or DDX11 shRNA purchased from Santa-cruz company (sc-77104-SH), and then selected by G418 for two weeks. siRNAs targeting p21 (#6456, Cell Signaling Technology), E2F1 (sc-29297, Santa-cruz Biotechnology), E2F2 (sc-29298, Santa-cruz Biotechnology), E2F3 (sc-37817, Santa-cruz Biotechnology), and EZH2 (#6509, Cell Signaling Technology) were also transiently introduced into HCC cells.

Techniques: Transfection, Expressing, Quantitative RT-PCR, Western Blot, Luciferase, Over Expression, Knockdown, Activity Assay, Plasmid Preparation

Journal: Biomedicines

Article Title: Expression Profiles of CDKN2A , MDM2 , E2F2 and LTF Genes in Oral Squamous Cell Carcinoma

doi: 10.3390/biomedicines10123011

Figure Lengend Snippet: Relative quantification (RQ) values for CDKN2A , MDM2 , E2F2 and LTF genes in tumour vs. margin in patients with OSCC (Spearman’s rank correlation coefficients r, p -Value).

Article Snippet: The qPCR was performed in a volume of 20 μL using 1 μL of cDNA, 10 μL of TaqMan TM Fast Advanced Master Mix (Applied Biosystems, Foster City, CA, USA), 1 μL of TaqMan TM Gene Expression Assays (Assay ID: Hs00923894_m1 for CDKN2A , Assay ID: Hs01066930_m1 for MDM2 , Assay ID: Hs00914334_m1 for E2F2 , Assay ID: Hs00918090_m1 for LTF and Assay ID: Hs03929097_g1 for GAPH ), and 8 μL of nuclease free H 2 O (EURx, Gdańsk, Poland).

Techniques: Quantitative Proteomics

Journal: Biomedicines

Article Title: Expression Profiles of CDKN2A , MDM2 , E2F2 and LTF Genes in Oral Squamous Cell Carcinoma

doi: 10.3390/biomedicines10123011

Figure Lengend Snippet: Relative quantification (RQ) values of E2F2 in the group of patients with OSCC according to G1, G2 and G3 in tumour samples.

Article Snippet: The qPCR was performed in a volume of 20 μL using 1 μL of cDNA, 10 μL of TaqMan TM Fast Advanced Master Mix (Applied Biosystems, Foster City, CA, USA), 1 μL of TaqMan TM Gene Expression Assays (Assay ID: Hs00923894_m1 for CDKN2A , Assay ID: Hs01066930_m1 for MDM2 , Assay ID: Hs00914334_m1 for E2F2 , Assay ID: Hs00918090_m1 for LTF and Assay ID: Hs03929097_g1 for GAPH ), and 8 μL of nuclease free H 2 O (EURx, Gdańsk, Poland).

Techniques: Quantitative Proteomics