|
Cell Signaling Technology Inc
cebpap30 p30 Cebpap30 P30, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cebpap30 p30/product/Cell Signaling Technology Inc Average 92 stars, based on 1 article reviews
cebpap30 p30 - by Bioz Stars,
2026-06
92/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
logmar Logmar, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/logmar/product/Cell Signaling Technology Inc Average 91 stars, based on 1 article reviews
logmar - by Bioz Stars,
2026-06
91/100 stars
|
Buy from Supplier |
|
Sigma-Genosys
upstream (27-bp) and downstream (29-bp) primers Upstream (27 Bp) And Downstream (29 Bp) Primers, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/upstream (27-bp) and downstream (29-bp) primers/product/Sigma-Genosys Average 90 stars, based on 1 article reviews
upstream (27-bp) and downstream (29-bp) primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Beijing TransGen Biotech
upstream and downstream primers Upstream And Downstream Primers, supplied by Beijing TransGen Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/upstream and downstream primers/product/Beijing TransGen Biotech Average 90 stars, based on 1 article reviews
upstream and downstream primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
GeNOsys Inc
primers upstream 5′ ccgtgcttcgtgctttggacta 3′ downstream 5′ agaggggtgcat gcttgggttc Primers Upstream 5′ Ccgtgcttcgtgctttggacta 3′ Downstream 5′ Agaggggtgcat Gcttgggttc, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers upstream 5′ ccgtgcttcgtgctttggacta 3′ downstream 5′ agaggggtgcat gcttgggttc/product/GeNOsys Inc Average 90 stars, based on 1 article reviews
primers upstream 5′ ccgtgcttcgtgctttggacta 3′ downstream 5′ agaggggtgcat gcttgggttc - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
PrimerDesign Inc
downstream primers Downstream Primers, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/downstream primers/product/PrimerDesign Inc Average 90 stars, based on 1 article reviews
downstream primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Promega
downstream control primer Downstream Control Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/downstream control primer/product/Promega Average 90 stars, based on 1 article reviews
downstream control primer - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
UniTaq Bio
f1-unitaq bi-q-unitaq a1i-upstream target-snp1-downstream target-unitaq bi′-univ.primer u2′ F1 Unitaq Bi Q Unitaq A1i Upstream Target Snp1 Downstream Target Unitaq Bi′ Univ.Primer U2′, supplied by UniTaq Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/f1-unitaq bi-q-unitaq a1i-upstream target-snp1-downstream target-unitaq bi′-univ.primer u2′/product/UniTaq Bio Average 90 stars, based on 1 article reviews
f1-unitaq bi-q-unitaq a1i-upstream target-snp1-downstream target-unitaq bi′-univ.primer u2′ - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
SeqWright
primers located about upstream and downstream from the h275 residue ![]() Primers Located About Upstream And Downstream From The H275 Residue, supplied by SeqWright, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers located about upstream and downstream from the h275 residue/product/SeqWright Average 90 stars, based on 1 article reviews
primers located about upstream and downstream from the h275 residue - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Immunotec inc
downstream primer 5'-gcctctagaaatcagagtttgagt-3 ![]() Downstream Primer 5' Gcctctagaaatcagagtttgagt 3, supplied by Immunotec inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/downstream primer 5'-gcctctagaaatcagagtttgagt-3/product/Immunotec inc Average 90 stars, based on 1 article reviews
downstream primer 5'-gcctctagaaatcagagtttgagt-3 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
GeNOsys Inc
downstream primer 59-gaagggacaccctttcacat-39 ![]() Downstream Primer 59 Gaagggacaccctttcacat 39, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/downstream primer 59-gaagggacaccctttcacat-39/product/GeNOsys Inc Average 90 stars, based on 1 article reviews
downstream primer 59-gaagggacaccctttcacat-39 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Promega
hpxr-r specific downstream primer ![]() Hpxr R Specific Downstream Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hpxr-r specific downstream primer/product/Promega Average 90 stars, based on 1 article reviews
hpxr-r specific downstream primer - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Diagnostic Microbiology and Infectious Disease
Article Title: Reverse-transcription polymerase chain reaction/pyrosequencing to characterize neuraminidase H275 residue of influenza A 2009 H1N1 virus for rapid and specific detection of the viral oseltamivir resistance marker in a clinical laboratory
doi: 10.1016/j.diagmicrobio.2011.09.003
Figure Lengend Snippet: Pyrogram sequence results at residue H275 (highlighted) representing either oseltamivir-susceptible codon (CAC, underlined) (A) or oseltamivir-resistant codon (TAC, underlined) (B). The letters listed below the peaks of each panel are the nucleotides dispensed during pyrosequencing on the PyroMark ID system.
Article Snippet: Two pairs of primers located about 200 bp upstream and downstream from the
Techniques: Sequencing, Residue
Journal: Diagnostic Microbiology and Infectious Disease
Article Title: Reverse-transcription polymerase chain reaction/pyrosequencing to characterize neuraminidase H275 residue of influenza A 2009 H1N1 virus for rapid and specific detection of the viral oseltamivir resistance marker in a clinical laboratory
doi: 10.1016/j.diagmicrobio.2011.09.003
Figure Lengend Snippet: Alignment of representative sequences by Sanger method (as “S”) and sequences by RT-PCR-pyroseq method (as “P”) to the reference sequence (CA04, GenBank number: 22780 9833: 620-1058, as described in ). Two clustered mutation residues, N248 (A248) and H275, are underlined and highlighted. Of the 16 nonclustered mutations detected in the Sanger sequencing, 2 nearest to the H275 residue from either direction are shown here (highlighted only).
Article Snippet: Two pairs of primers located about 200 bp upstream and downstream from the
Techniques: Reverse Transcription Polymerase Chain Reaction, Sequencing, Mutagenesis, Residue
Journal: Diagnostic Microbiology and Infectious Disease
Article Title: Reverse-transcription polymerase chain reaction/pyrosequencing to characterize neuraminidase H275 residue of influenza A 2009 H1N1 virus for rapid and specific detection of the viral oseltamivir resistance marker in a clinical laboratory
doi: 10.1016/j.diagmicrobio.2011.09.003
Figure Lengend Snippet: Sensitivity testing of the RT-PCR-pyroseq method on 10-fold dilutions using real-time PCR Ct values in pandemic 2009 H1N1 virus identification as references
Article Snippet: Two pairs of primers located about 200 bp upstream and downstream from the
Techniques: Real-time Polymerase Chain Reaction, Virus, Sequencing
a " width="100%" height="100%">
Journal: Diagnostic Microbiology and Infectious Disease
Article Title: Reverse-transcription polymerase chain reaction/pyrosequencing to characterize neuraminidase H275 residue of influenza A 2009 H1N1 virus for rapid and specific detection of the viral oseltamivir resistance marker in a clinical laboratory
doi: 10.1016/j.diagmicrobio.2011.09.003
Figure Lengend Snippet: Specificity of the RT-PCR-pyroseq method for detection of 2009 H1N1 neuraminidase residue H275 sequences
Article Snippet: Two pairs of primers located about 200 bp upstream and downstream from the
Techniques: Residue, Amplification, Sequencing, Virus, Negative Control