dimethoxy Search Results


95
Chem Impex International etoposide
Etoposide, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/etoposide/product/Chem Impex International
Average 95 stars, based on 1 article reviews
etoposide - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

93
Valiant Co Ltd rotenone
Rotenone, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rotenone/product/Valiant Co Ltd
Average 93 stars, based on 1 article reviews
rotenone - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

86
ChromaDex thb
Fig. 1. Chemical Structures of <t>Tetrahydropalmatine</t> <t>(THP;</t> A) and Tetrahydroberberine <t>(THB;</t> B)
Thb, supplied by ChromaDex, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/thb/product/ChromaDex
Average 86 stars, based on 1 article reviews
thb - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

86
ChromaDex dl canadine tetrahydroberberine
Fig. 1. Chemical Structures of <t>Tetrahydropalmatine</t> <t>(THP;</t> A) and Tetrahydroberberine <t>(THB;</t> B)
Dl Canadine Tetrahydroberberine, supplied by ChromaDex, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dl canadine tetrahydroberberine/product/ChromaDex
Average 86 stars, based on 1 article reviews
dl canadine tetrahydroberberine - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

93
ChromaDex tricin
Fig. 1. Chemical Structures of <t>Tetrahydropalmatine</t> <t>(THP;</t> A) and Tetrahydroberberine <t>(THB;</t> B)
Tricin, supplied by ChromaDex, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tricin/product/ChromaDex
Average 93 stars, based on 1 article reviews
tricin - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

95
Chem Impex International fmoc rink amide linker
Fig. 1. Chemical Structures of <t>Tetrahydropalmatine</t> <t>(THP;</t> A) and Tetrahydroberberine <t>(THB;</t> B)
Fmoc Rink Amide Linker, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fmoc rink amide linker/product/Chem Impex International
Average 95 stars, based on 1 article reviews
fmoc rink amide linker - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

95
Chem Impex International fmoc pal peg ps resin
Fig. 1. Chemical Structures of <t>Tetrahydropalmatine</t> <t>(THP;</t> A) and Tetrahydroberberine <t>(THB;</t> B)
Fmoc Pal Peg Ps Resin, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fmoc pal peg ps resin/product/Chem Impex International
Average 95 stars, based on 1 article reviews
fmoc pal peg ps resin - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

92
Valiant Co Ltd m1404 verapamil hydrochloride mp biomedicals
KEY RESOURCES TABLE
M1404 Verapamil Hydrochloride Mp Biomedicals, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m1404 verapamil hydrochloride mp biomedicals/product/Valiant Co Ltd
Average 92 stars, based on 1 article reviews
m1404 verapamil hydrochloride mp biomedicals - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

95
Chem Impex International cas
KEY RESOURCES TABLE
Cas, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cas/product/Chem Impex International
Average 95 stars, based on 1 article reviews
cas - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

93
ChromaDex pterostilbene caffeine co crystal
KEY RESOURCES TABLE
Pterostilbene Caffeine Co Crystal, supplied by ChromaDex, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pterostilbene caffeine co crystal/product/ChromaDex
Average 93 stars, based on 1 article reviews
pterostilbene caffeine co crystal - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

95
Chem Impex International inc fmoc 3 4 dimethoxy l phenylalanine dmf chem impex
KEY RESOURCES TABLE
Inc Fmoc 3 4 Dimethoxy L Phenylalanine Dmf Chem Impex, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/inc fmoc 3 4 dimethoxy l phenylalanine dmf chem impex/product/Chem Impex International
Average 95 stars, based on 1 article reviews
inc fmoc 3 4 dimethoxy l phenylalanine dmf chem impex - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

94
Chem Impex International 4 6 dimethoxy 1 3 5 triazin 2 yl
KEY RESOURCES TABLE
4 6 Dimethoxy 1 3 5 Triazin 2 Yl, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/4 6 dimethoxy 1 3 5 triazin 2 yl/product/Chem Impex International
Average 94 stars, based on 1 article reviews
4 6 dimethoxy 1 3 5 triazin 2 yl - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

Image Search Results


Fig. 1. Chemical Structures of Tetrahydropalmatine (THP; A) and Tetrahydroberberine (THB; B)

Journal: Biological & pharmaceutical bulletin

Article Title: Pharmacokinetics and brain distribution of tetrahydropalmatine and tetrahydroberberine after oral administration of DA-9701, a new botanical gastroprokinetic agent, in rats.

doi: 10.1248/bpb.b14-00678

Figure Lengend Snippet: Fig. 1. Chemical Structures of Tetrahydropalmatine (THP; A) and Tetrahydroberberine (THB; B)

Article Snippet: THP (purity 99.1%) and THB (purity 97.2%) were obtained from ChromaDex (Irvine, CA, U.S.A.).

Techniques:

Fig. 4. Mean Plasma and Brain Concentration–Time Profiles of THP (A) and THB (B), and Their Brain-to-Plasma Concentration (Br/P) Ratios (C) Following Single Oral Administration of 328 mg/kg DA-9701 (Equivalent to 1.5 mg/kg THP and 0.39 mg/kg THB; n=3 at Each Time Point)

Journal: Biological & pharmaceutical bulletin

Article Title: Pharmacokinetics and brain distribution of tetrahydropalmatine and tetrahydroberberine after oral administration of DA-9701, a new botanical gastroprokinetic agent, in rats.

doi: 10.1248/bpb.b14-00678

Figure Lengend Snippet: Fig. 4. Mean Plasma and Brain Concentration–Time Profiles of THP (A) and THB (B), and Their Brain-to-Plasma Concentration (Br/P) Ratios (C) Following Single Oral Administration of 328 mg/kg DA-9701 (Equivalent to 1.5 mg/kg THP and 0.39 mg/kg THB; n=3 at Each Time Point)

Article Snippet: THP (purity 99.1%) and THB (purity 97.2%) were obtained from ChromaDex (Irvine, CA, U.S.A.).

Techniques: Clinical Proteomics, Concentration Assay

Fig. 5. Mean Plasma and Brain Concentration–Time Profiles of THP (A) and THB (B), and Their Brain-to-Plasma Concentration (Br/P) Ratios (C) Following Multiple Oral Administration of DA-9701 (150 mg/kg/d of DA-9701 for 7 d; Equivalent to 0.77 mg/kg/d as THP and 0.21 mg/kg/d as THB; n=4 at Each Time Point)

Journal: Biological & pharmaceutical bulletin

Article Title: Pharmacokinetics and brain distribution of tetrahydropalmatine and tetrahydroberberine after oral administration of DA-9701, a new botanical gastroprokinetic agent, in rats.

doi: 10.1248/bpb.b14-00678

Figure Lengend Snippet: Fig. 5. Mean Plasma and Brain Concentration–Time Profiles of THP (A) and THB (B), and Their Brain-to-Plasma Concentration (Br/P) Ratios (C) Following Multiple Oral Administration of DA-9701 (150 mg/kg/d of DA-9701 for 7 d; Equivalent to 0.77 mg/kg/d as THP and 0.21 mg/kg/d as THB; n=4 at Each Time Point)

Article Snippet: THP (purity 99.1%) and THB (purity 97.2%) were obtained from ChromaDex (Irvine, CA, U.S.A.).

Techniques: Clinical Proteomics, Concentration Assay

KEY RESOURCES TABLE

Journal: Current biology : CB

Article Title: Regulation of glucose-dependent Golgi-derived microtubules by cAMP/EPAC2 promotes secretory vesicle biogenesis in pancreatic β-cells

doi: 10.1016/j.cub.2019.06.032

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-EB1 BD Transduction Cat#: 610535 Rat anti-EB3 Absea Cat#: 010314H04 Rabbit anti-Giantin Abcam Cat#: ab24586 Mouse anti-GM130 BD Transduction Cat#:610823 Rabbit EPAC1 Abcam Cat#: ab124162 Rabbit EPAC2 Abcam Cat#: ab124189 Mouse GAPDH Santa Cruz Cat#: sc-32233 Mouse anti-E cadherin BD Transduction Cat#: 610181 Guinea Pig anti-GCC185 [ 44 ] N/A Guinea Pig anti-Insulin Agilent Technologies Cat#: A0564 Rabbit anti-β-tubulin Abcam Cat#: ab18251 Anti-GFP FITC Abcam Cat#: ab6662 Chemicals Vectashield Mounting Medium Vector Labs Cat#: H-1000 Nocodazole Sigma-Aldrich Cat#: M1404 Verapamil hydrochloride MP Biomedicals Cat#: 0219554501 MPA Sigma-Aldrich Cat#: M5255 GKA50 Sigma-Aldrich Cat#: SML0849 Diazoxide Tocris Bioscience Cat#: 0934 Metformin Sigma-Aldrich Cat#: PHR1084 Sodium Pyruvate ThermoFisher Cat#: 11360070 KCl EM Science Cat#: PX1405-1 8-br-cAMP Sigma-Aldrich Cat#: B7880 8-br-cAMP-AM Biolog Cat#: B 020 Ionomycin Sigma-Aldrich Cat#: I3909 PKI Sigma-Aldrich Cat#: P9115 Forskolin Sigma-Aldrich Cat#: F6886 8-pCPT-2O-Me-cAMP Sigma-Aldrich Cat#: C8988 HJC0197 Cayman Chemical Cat#: 19092 ESI-09 Sigma-Aldrich Cat#: SML0814 BAPTA-AM Invitrogen Cat#: B1205 D (+)-glucose Acros Cat# 41095-0010 NaHCO 3 HyClone Cat# SH30173.04 EGTA Sigma-Aldrich Cat# E3889 NaCl Sigma-Aldrich Cat# S9625 MgSO 4 Sigma-Aldrich Cat# M7506 KH 2 PO 4 ThermoFisher Cat# BP363 HEPES Sigma-Aldrich Cat# H4034 CaCl 2 Sigma-Aldrich Cat# C1016 BSA ThermoFisher Cat# BP1605 Critical Commercial Assays Mouse Ultrasensitive Insulin ELISA Alpco 80-INSMSU-E10 Experimental Models: Cell Lines MIN6 cells [ 52 ] N/A hTERT RPE-1 cells ATCC Cat#: CRL-4000 Experimental Models: Organisms/Strains CD-1 (ICR) Mice Charles River Inc. Stain code:022 Oligonucleotides Cdk5Rap2 51-100 Fwd Sigma-Aldrich GGCTCGAGGCCGCGAATTCCACAGT Cdk5Rap2 51-100 Rev Sigma-Aldrich GGATGCCACCCCGGGATCCTC shRNA EPAC2 Mouse shRNA #1 Origene TL509420A CGACAAGGAAGACTTCAATCGGATTCTGA EPAC2 Mouse shRNA #2 Origene TL50942C CCATTACCACGCACAGCCTTCTCAAGGTA Recombinant DNA pCMV Cdk5Rap2 51-100 F75A [ 42 ] N/A pCIG McMahon Plasmid Database 2165 Emerald-EB3 Addgene Plasmid# 54076 TGN-RFP [ 53 ] N/A Dominant negative AKAP450 [ 41 ] N/A Software and Algorithms Graphpad Prism Graphpad https://www.graphpad.com Image J Image J https://imagej.nih.gov/ij/ Adobe illustrator/photoshop Adobe http://www.adobe.com Imaris Bitplane http://www.bitplane.com Open in a separate window KEY RESOURCES TABLE Glucose triggers GDMT nucleation in β-cells, which mirrors biphasic insulin release Glucose-dependent GDMT nucleation is regulated by EPAC2 downstream of cAMP GDMTs are necessary for insulin granule biogenesis at the TGN Glucose-dependent GDMT nucleation maintains the secretion/storage insulin balance

Techniques: Transduction, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Staining, shRNA, Recombinant, Dominant Negative Mutation, Software