dhodh Search Results


93
OriGene human dhodh
Human Dhodh, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dhodh/DHODH+(NM_001025193)+Human+Untagged+Clone/us11787797-1910-2-11
Average 93 stars, based on 1 article reviews
human dhodh - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

96
Proteintech dihydroorotate dehydrogenase dhodh
Dihydroorotate Dehydrogenase Dhodh, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dhodh/DHODH+Antibody/pmc10945144-46-44-47
Average 96 stars, based on 1 article reviews
dihydroorotate dehydrogenase dhodh - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

95
Santa Cruz Biotechnology dhodh d 6
MEDS433 becomes highly effective also in partially resistant cell lines if the time of exposure is increased. ( A , B ) Apoptotic rate and corresponding viable cell counts of OCI AML3 ( A , n = 3) and MV4-11 ( B , n = 3) treated for 3 or 6 days with MEDS433 at different concentrations. ( C ) Flow cytometry plots of a representative experiment of MV4-11 cells treated with MEDS433 for 3 or 6 days. ( D ) Dihydroorotate Dehydrogenase <t>(DHODH)</t> protein levels before and after treatment with MEDS433 at different concentrations. ( n = 3) DMSO: dimethyl sulfoxide. M: MEDS433. Statistical significance: t -test, * p < 0.05; ** p < 0.01; *** p < 0.001.
Dhodh D 6, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dhodh/DHODH+Antibody/pmc07957697-199-17-23
Average 95 stars, based on 1 article reviews
dhodh d 6 - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc cell signaling 26381s
MEDS433 becomes highly effective also in partially resistant cell lines if the time of exposure is increased. ( A , B ) Apoptotic rate and corresponding viable cell counts of OCI AML3 ( A , n = 3) and MV4-11 ( B , n = 3) treated for 3 or 6 days with MEDS433 at different concentrations. ( C ) Flow cytometry plots of a representative experiment of MV4-11 cells treated with MEDS433 for 3 or 6 days. ( D ) Dihydroorotate Dehydrogenase <t>(DHODH)</t> protein levels before and after treatment with MEDS433 at different concentrations. ( n = 3) DMSO: dimethyl sulfoxide. M: MEDS433. Statistical significance: t -test, * p < 0.05; ** p < 0.01; *** p < 0.001.
Cell Signaling 26381s, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dhodh/DHODH+Rabbit+mAb/pmc12128873-135-34-34
Average 94 stars, based on 1 article reviews
cell signaling 26381s - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

90
OriGene acgacaagcatatggccacgggagatgagcg
MEDS433 becomes highly effective also in partially resistant cell lines if the time of exposure is increased. ( A , B ) Apoptotic rate and corresponding viable cell counts of OCI AML3 ( A , n = 3) and MV4-11 ( B , n = 3) treated for 3 or 6 days with MEDS433 at different concentrations. ( C ) Flow cytometry plots of a representative experiment of MV4-11 cells treated with MEDS433 for 3 or 6 days. ( D ) Dihydroorotate Dehydrogenase <t>(DHODH)</t> protein levels before and after treatment with MEDS433 at different concentrations. ( n = 3) DMSO: dimethyl sulfoxide. M: MEDS433. Statistical significance: t -test, * p < 0.05; ** p < 0.01; *** p < 0.001.
Acgacaagcatatggccacgggagatgagcg, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dhodh/DHODH+(NM_001361)+Human+Untagged+Clone/pmc04836973-268-18-12
Average 90 stars, based on 1 article reviews
acgacaagcatatggccacgggagatgagcg - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc dhodh antibody
Fig. 5. <t>DHODH</t> <t>regulates</t> <t>CoQ</t> to exert cardioprotective effects and prevent ferroptotic induction. (A,B) Western blotting and quantitative analysis of DHODH, CoQ, Ferritin light chain and TFR expression in H9C2 cells. (C,D) Determination of ROS levels in
Dhodh Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dhodh/DHODH+Antibody/pm39082362-150-5-8
Average 93 stars, based on 1 article reviews
dhodh antibody - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

90
Biorbyt rabbit polyclonal anti dhodh
Western blot detection of selected proteins from the de novo pyrimidine biosynthesis pathway in adult human brain. ( A ) CAD protein in 40 and 80 μg of brain sample, B1 and B2, respectively. ( B ) DHODH protein in 180 μg of brain ( B ) protein using <t>polyclonal</t> antibody. Lane E: commercial DHODH enzyme lacking its 31 first amino acids (250 ng of protein). ( C ) DHODH protein in hippocampus (H, 100 μg of protein), entorhinal cortex (EC, 180 μg of protein) and putamen (P, 180 μg of protein) using polyclonal antibody. White arrows indicate the corresponding band for DHODH. ( D ) DHODH protein using monoclonal antibody for detection of commercial enzyme lacking its first 31 amino acids (E, 250 ng of protein) and in 40 and 80 μg of brain sample, B1 and B2, respectively. ( E ) Fragment of DHODH protein used as immunogen to produce the monoclonal antibody. NT and T homogenates of untransformed bacteria and bacteria transformed with the DHODH fragment sequence, respectively. S and P: supernatant and pellet, respectively. ( F ) DHODH protein in neuroblastoma SH-SY5Y cell line (70 μg of protein) and brain tissue (B, 250 μg of protein) using polyclonal antibody. ( G ) Quantification of brain DHODH protein with the polyclonal antibody in brain (B, 180 μg of protein) by comparison with the commercial enzyme lacking its first 31 amino acids at 0.4 and 4.0 ng (E1 and E2), respectively. M: molecular weight marker.
Rabbit Polyclonal Anti Dhodh, supplied by Biorbyt, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dhodh/DHODH+antibody/pmc06814620-231-9-14
Average 90 stars, based on 1 article reviews
rabbit polyclonal anti dhodh - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
ProSci Incorporated dhodh
Western blot detection of selected proteins from the de novo pyrimidine biosynthesis pathway in adult human brain. ( A ) CAD protein in 40 and 80 μg of brain sample, B1 and B2, respectively. ( B ) DHODH protein in 180 μg of brain ( B ) protein using <t>polyclonal</t> antibody. Lane E: commercial DHODH enzyme lacking its 31 first amino acids (250 ng of protein). ( C ) DHODH protein in hippocampus (H, 100 μg of protein), entorhinal cortex (EC, 180 μg of protein) and putamen (P, 180 μg of protein) using polyclonal antibody. White arrows indicate the corresponding band for DHODH. ( D ) DHODH protein using monoclonal antibody for detection of commercial enzyme lacking its first 31 amino acids (E, 250 ng of protein) and in 40 and 80 μg of brain sample, B1 and B2, respectively. ( E ) Fragment of DHODH protein used as immunogen to produce the monoclonal antibody. NT and T homogenates of untransformed bacteria and bacteria transformed with the DHODH fragment sequence, respectively. S and P: supernatant and pellet, respectively. ( F ) DHODH protein in neuroblastoma SH-SY5Y cell line (70 μg of protein) and brain tissue (B, 250 μg of protein) using polyclonal antibody. ( G ) Quantification of brain DHODH protein with the polyclonal antibody in brain (B, 180 μg of protein) by comparison with the commercial enzyme lacking its first 31 amino acids at 0.4 and 4.0 ng (E1 and E2), respectively. M: molecular weight marker.
Dhodh, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dhodh/DHODH+Antibody/pm36231015-82-31-37
Average 90 stars, based on 1 article reviews
dhodh - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
OriGene dhodh protein
<t>DHODH</t> inhibitors affect DHODH enzyme activity but not the <t>DHODH</t> <t>protein</t> expression in A375 cells. A, DHODH enzymatic assay with A771726 and BQR using pure human DHODH enzyme. B, DHODH enzymatic assay with A771726 and BQR using A375, H929 and Ramos cells lysates. C, A375 cells were incubated with 10, 30, 100 and 200 µM A771726 and 0.016, 0.05, 0.15 and 0.45 µM of BQR for 24 and 48 hours and cell viability was determined by Trypan blue stain. D, Western blot of A375 cell lysate after treatment with A771726 and BQR. Cells were harvested at 48 hours after treatment for Western blot analysis. Tubulinβ served as protein loading control. Values shown are mean ± SE of 3 independent experiments. *, P < 0.05, **, P < 0.01 and ***, P <0.001.
Dhodh Protein, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dhodh/Dhodh+(NM_020046)+Mouse+Recombinant+Protein/pmc05604460-58-0-4
Average 90 stars, based on 1 article reviews
dhodh protein - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
OriGene purification human dhapat cdna
Fig. 1. Recombinant human <t>DHAPAT</t> expression in HEK-293E cells. (A) Fluorescence of samples treated with buffers containing different combinations of chaotropic agents (A - 50 mM NaCl and 30% glycerol, B - 50 mM NaCl and 20% glycerol, C - 50 mM NaCl and 5% glycerol, D e 1 M NaCl and 30% glycerol, E e 1 M NaCl and 5% glycerol, F e 500 mM NaCl and 30% glycerol, G e 500 mM NaCl and 5% glycerol) to increase eGFP-DHAPAT solubility after cell lysis. (B) eGFP-DHAPAT fluorescence recovered after solubilization with or without detergents. (C) eGFP fluorescence detection in SDS-PAGE. The fluorescent band corresponds to the expected molecular weight of DHAPAT fused to eGFP (109 kDa, considering that membrane proteins migrate with a discrepancy of up to the 30% of the expected molecular weight, due to the interaction with detergent micelles [35]). (D) F-SEC profile su- perposition representing the best detergents for human DHAPAT solubilization from HEK-293E cells.
Purification Human Dhapat Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dhodh/DHODH+(NM_001361)+Human+Tagged+ORF+Clone/pm27836547-35-9-17
Average 90 stars, based on 1 article reviews
purification human dhapat cdna - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

93
OriGene mgfp tagged dhodh lenti orf
Pharmacological PDE7A inhibition suppresses multiple genes that encode enzymes regulating the pyrimidine biosynthesis pathway in TNBC (A) Heatmap showing the top 30 upregulated and top 30 downregulated genes in MDA-MB-231 cells treated with BRL-50481 (50 μM) for 72 h compared with DMSO-treated cells ( n = 3 biological replicates/group). (B) Biological pathways that were altered in MDA-MB-231 cells treated with the PDE7A inhibitor BRL-50481 (50 μM) for 72 h compared with DMSO-treated cells based on the mRNA expression profiles identified from RNA sequencing results. (C) Heatmap showing metabolite levels of altered metabolites in MDA-MB-231 cells treated with BRL-50481 (50 μM) for 72 h compared with DMSO-treated cells ( n = 3 biological replicates/group). (D) Heatmap showing mRNA levels of altered pyrimidine biosynthesis genes in MDA-MB-231 cells treated with BRL-50481 (50 μM) for 72 h compared with DMSO-treated cells ( n = 3 biological replicates/group). (E) Schematic for the pyrimidine biosynthesis pathway showing metabolite levels measured through our global metabolomics analysis. Dihydroorotic acid, UMP, and dTMP levels are highlighted in red rectangles. (F) A schematic showing metabolites and enzymes of the de novo pyrimidine biosynthesis pathway. (G) <t>DHODH</t> and CAD mRNA expression levels in the indicated TNBC cells treated with 50 μM BRL-50481 for 72 h compared with DMSO-treated cells are shown. ACTINB was used for normalization ( n = 3 biological replicates/group). (H) DHODH and CAD protein levels in MDA-MB-231 cells treated with 50 μM BRL-50481 or DMSO for 72 h were measured using immunoblotting. ACTINB was used as a loading control. All quantitative data represent the mean ± SEM. ∗ p < 0.05 and ∗∗ p < 0.01. See also and , , and .
Mgfp Tagged Dhodh Lenti Orf, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dhodh/DHODH+(NM_001361)+Human+Tagged+ORF+Clone+Lentiviral+Particle/pmc12490241-485-1-9
Average 93 stars, based on 1 article reviews
mgfp tagged dhodh lenti orf - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

90
OriGene recombinant hdhodh
<t> Recombinant hDHODH </t> Activity of Selected Compounds
Recombinant Hdhodh, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dhodh/DHODH+(NM_001361)+Human+Recombinant+Protein/pmc09774970-1266-21-30
Average 90 stars, based on 1 article reviews
recombinant hdhodh - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


MEDS433 becomes highly effective also in partially resistant cell lines if the time of exposure is increased. ( A , B ) Apoptotic rate and corresponding viable cell counts of OCI AML3 ( A , n = 3) and MV4-11 ( B , n = 3) treated for 3 or 6 days with MEDS433 at different concentrations. ( C ) Flow cytometry plots of a representative experiment of MV4-11 cells treated with MEDS433 for 3 or 6 days. ( D ) Dihydroorotate Dehydrogenase (DHODH) protein levels before and after treatment with MEDS433 at different concentrations. ( n = 3) DMSO: dimethyl sulfoxide. M: MEDS433. Statistical significance: t -test, * p < 0.05; ** p < 0.01; *** p < 0.001.

Journal: Cancers

Article Title: The Synergism between DHODH Inhibitors and Dipyridamole Leads to Metabolic Lethality in Acute Myeloid Leukemia

doi: 10.3390/cancers13051003

Figure Lengend Snippet: MEDS433 becomes highly effective also in partially resistant cell lines if the time of exposure is increased. ( A , B ) Apoptotic rate and corresponding viable cell counts of OCI AML3 ( A , n = 3) and MV4-11 ( B , n = 3) treated for 3 or 6 days with MEDS433 at different concentrations. ( C ) Flow cytometry plots of a representative experiment of MV4-11 cells treated with MEDS433 for 3 or 6 days. ( D ) Dihydroorotate Dehydrogenase (DHODH) protein levels before and after treatment with MEDS433 at different concentrations. ( n = 3) DMSO: dimethyl sulfoxide. M: MEDS433. Statistical significance: t -test, * p < 0.05; ** p < 0.01; *** p < 0.001.

Article Snippet: We utilized antibodies targeting Cleaved Caspase 3 (#9661, Cell signaling Technologies, Danvers, MA, USA), Vinculin (SAB4200080) and DHODH (D-6) (sc-166377), both purchased from Santa Cruz.

Techniques: Flow Cytometry

The synergism between DHODH inhibitors and dipyridamole is confirmed when in vivo conditions are mimicked. ( A ) Apoptosis induced by MEDS433 in combination with dipyridamole in the presence of uridine at low concentrations (1 to 10 µM) on THP1 ( n = 3), MV4-11 ( n = 3) and OCI AML3 cells ( n = 3). ( B ) Cells were exposed to MEDS433 for 3 days and to dipyridamole for 3, 2 or 1 concomitant day(s), as shown in the figure legend; apoptosis was then evaluated on day 3 ( n = 3). ( C ) Apoptosis induced by teriflunomide, dipyridamole and their combination, alone or in the presence of physiological uridine concentrations (5 µM), on THP1 ( n = 3) and MV4-11 cells ( n = 3). DMSO: dimethyl sulfoxide. M: MEDS433. Dp: dipyridamole. Ur: uridine. Tf: teriflunomide. Statistical significance: Anova/Tukey, * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Journal: Cancers

Article Title: The Synergism between DHODH Inhibitors and Dipyridamole Leads to Metabolic Lethality in Acute Myeloid Leukemia

doi: 10.3390/cancers13051003

Figure Lengend Snippet: The synergism between DHODH inhibitors and dipyridamole is confirmed when in vivo conditions are mimicked. ( A ) Apoptosis induced by MEDS433 in combination with dipyridamole in the presence of uridine at low concentrations (1 to 10 µM) on THP1 ( n = 3), MV4-11 ( n = 3) and OCI AML3 cells ( n = 3). ( B ) Cells were exposed to MEDS433 for 3 days and to dipyridamole for 3, 2 or 1 concomitant day(s), as shown in the figure legend; apoptosis was then evaluated on day 3 ( n = 3). ( C ) Apoptosis induced by teriflunomide, dipyridamole and their combination, alone or in the presence of physiological uridine concentrations (5 µM), on THP1 ( n = 3) and MV4-11 cells ( n = 3). DMSO: dimethyl sulfoxide. M: MEDS433. Dp: dipyridamole. Ur: uridine. Tf: teriflunomide. Statistical significance: Anova/Tukey, * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Article Snippet: We utilized antibodies targeting Cleaved Caspase 3 (#9661, Cell signaling Technologies, Danvers, MA, USA), Vinculin (SAB4200080) and DHODH (D-6) (sc-166377), both purchased from Santa Cruz.

Techniques: In Vivo

The combination of dipyridamole and DHODH inhibitors is effective against primary AML cells. ( A ) Apoptosis induced by MEDS433 (left panel, n = 12) or teriflunomide 100 µM (right panel, n = 5), alone and in combination with dipyridamole, on AML primary cells. ( B ) Flow cytometry plots of a representative sample of primary AML cells treated with MEDS433, dipyridamole and their combination (patient 3 of ). ( C ) Apoptotic rate induced by MEDS433 alone and in combination with increasing dipyridamole concentrations, with or without uridine at hyperphysiological concentrations (100 µM), on primary AML samples ( n = 4). In all the experiments, MEDS433 was utilized at 1 µM and apoptosis was evaluated after 3 days of treatment; unless otherwise specified, dipyridamole was utilized at 1 µM. DMSO: dimethyl sulfoxide. M: MEDS433. Dp: dipyridamole. Tf: teriflunomide. Ur: uridine. Statistical significance: Anova/Tukey, * p < 0.05; ** p < 0.01; *** p < 0.001, **** p < 0.0001.

Journal: Cancers

Article Title: The Synergism between DHODH Inhibitors and Dipyridamole Leads to Metabolic Lethality in Acute Myeloid Leukemia

doi: 10.3390/cancers13051003

Figure Lengend Snippet: The combination of dipyridamole and DHODH inhibitors is effective against primary AML cells. ( A ) Apoptosis induced by MEDS433 (left panel, n = 12) or teriflunomide 100 µM (right panel, n = 5), alone and in combination with dipyridamole, on AML primary cells. ( B ) Flow cytometry plots of a representative sample of primary AML cells treated with MEDS433, dipyridamole and their combination (patient 3 of ). ( C ) Apoptotic rate induced by MEDS433 alone and in combination with increasing dipyridamole concentrations, with or without uridine at hyperphysiological concentrations (100 µM), on primary AML samples ( n = 4). In all the experiments, MEDS433 was utilized at 1 µM and apoptosis was evaluated after 3 days of treatment; unless otherwise specified, dipyridamole was utilized at 1 µM. DMSO: dimethyl sulfoxide. M: MEDS433. Dp: dipyridamole. Tf: teriflunomide. Ur: uridine. Statistical significance: Anova/Tukey, * p < 0.05; ** p < 0.01; *** p < 0.001, **** p < 0.0001.

Article Snippet: We utilized antibodies targeting Cleaved Caspase 3 (#9661, Cell signaling Technologies, Danvers, MA, USA), Vinculin (SAB4200080) and DHODH (D-6) (sc-166377), both purchased from Santa Cruz.

Techniques: Flow Cytometry

Toxicity of DHODH inhibitors alone and in combination with dipyridamole. ( A ) Left panel: apoptosis distribution induced by MEDS433 on PBMC, based on annexin V vs. propidium iodide expression ( n = 3). Middle panel: differentiation of T-lymphocytes treated with MEDS433 at increasing concentrations ( n = 3); the analysis was performed on the CD3+ population, identifying the following subsets: naïve (CD45RA + CD62L+), CM (central memory: CD45RA-CD62L+), EM (effector memory: CD45RA-CD62L-), and Temra (terminally differentiated effector memory CD45RA + CD62L-). Right panel: apoptosis induced by MEDS433 at 0.1 µM, dipyridamole and their combination on PBMC ( n = 3). ( B ) Apoptosis induced by MEDS433 alone (0.1 µM) or in combination with dipyridamole on activated T-lymphocytes, without (left panel, n = 3) or in the presence of uridine at the physiological concentration of 5 µM (middle panel, n = 3). The same experiment was performed by replacing MEDS433 with Teriflunomide 100 µM (right panel, n = 3). ( C ) Comparison between the long and short-term toxicity of MEDS433 (0.1 µM) vs. chemotherapy (Idarubicin or Ara-c) on activated T-lymphocytes. The cells were treated for 3 days with MEDS433 alone and in combination with dipyridamole, or with Ara-C or idarubicin. After 3 days, cells were washed and replated without drugs, in the presence of physiological uridine concentrations (5 µM). If not otherwise specified, apoptosis was evaluated after 3 days of treatment. PBMC: peripheral blood mononuclear cells. DMSO: dimethyl sulfoxide. M: MEDS433. Dp: dipyridamole. Tf: teriflunomide. Ur: uridine. A: Ara-C. Ida: idarubicin. Statistical significance: Anova/Tukey, * p < 0.05; ** p < 0.01; *** p < 0.001, **** p < 0.0001.

Journal: Cancers

Article Title: The Synergism between DHODH Inhibitors and Dipyridamole Leads to Metabolic Lethality in Acute Myeloid Leukemia

doi: 10.3390/cancers13051003

Figure Lengend Snippet: Toxicity of DHODH inhibitors alone and in combination with dipyridamole. ( A ) Left panel: apoptosis distribution induced by MEDS433 on PBMC, based on annexin V vs. propidium iodide expression ( n = 3). Middle panel: differentiation of T-lymphocytes treated with MEDS433 at increasing concentrations ( n = 3); the analysis was performed on the CD3+ population, identifying the following subsets: naïve (CD45RA + CD62L+), CM (central memory: CD45RA-CD62L+), EM (effector memory: CD45RA-CD62L-), and Temra (terminally differentiated effector memory CD45RA + CD62L-). Right panel: apoptosis induced by MEDS433 at 0.1 µM, dipyridamole and their combination on PBMC ( n = 3). ( B ) Apoptosis induced by MEDS433 alone (0.1 µM) or in combination with dipyridamole on activated T-lymphocytes, without (left panel, n = 3) or in the presence of uridine at the physiological concentration of 5 µM (middle panel, n = 3). The same experiment was performed by replacing MEDS433 with Teriflunomide 100 µM (right panel, n = 3). ( C ) Comparison between the long and short-term toxicity of MEDS433 (0.1 µM) vs. chemotherapy (Idarubicin or Ara-c) on activated T-lymphocytes. The cells were treated for 3 days with MEDS433 alone and in combination with dipyridamole, or with Ara-C or idarubicin. After 3 days, cells were washed and replated without drugs, in the presence of physiological uridine concentrations (5 µM). If not otherwise specified, apoptosis was evaluated after 3 days of treatment. PBMC: peripheral blood mononuclear cells. DMSO: dimethyl sulfoxide. M: MEDS433. Dp: dipyridamole. Tf: teriflunomide. Ur: uridine. A: Ara-C. Ida: idarubicin. Statistical significance: Anova/Tukey, * p < 0.05; ** p < 0.01; *** p < 0.001, **** p < 0.0001.

Article Snippet: We utilized antibodies targeting Cleaved Caspase 3 (#9661, Cell signaling Technologies, Danvers, MA, USA), Vinculin (SAB4200080) and DHODH (D-6) (sc-166377), both purchased from Santa Cruz.

Techniques: Expressing, Concentration Assay, Comparison

Fig. 5. DHODH regulates CoQ to exert cardioprotective effects and prevent ferroptotic induction. (A,B) Western blotting and quantitative analysis of DHODH, CoQ, Ferritin light chain and TFR expression in H9C2 cells. (C,D) Determination of ROS levels in

Journal: Frontiers in bioscience (Landmark edition)

Article Title: DHODH Alleviates Heart Failure via the Modulation of CoQ-Related Ferroptotic Inhibition.

doi: 10.31083/j.fbl2907267

Figure Lengend Snippet: Fig. 5. DHODH regulates CoQ to exert cardioprotective effects and prevent ferroptotic induction. (A,B) Western blotting and quantitative analysis of DHODH, CoQ, Ferritin light chain and TFR expression in H9C2 cells. (C,D) Determination of ROS levels in

Article Snippet: The following antibodies were used: DHODH Antibody, E9X8R, CellSignaling, USA; CoQ Antibody, A15193, Abclonal, China; GPX4 Antibody, HY-P80450, MCE, China; SLC7A11 Antibody, D2M7A, CellSignaling, USA; FSP1 Antibody, A21808, Abclonal, China; GAPDH Antibody, A19056, Abclonal, China; PCBP1 Antibody, A19276, Abclonal, China; TFR Antibody, A5865, Abclonal, China; Ferritin Light Chain Antibody, A11241, Abclonal, China; IgG H&L Antibody, AB150081, Abcam, USA.

Techniques: Western Blot, Expressing

Western blot detection of selected proteins from the de novo pyrimidine biosynthesis pathway in adult human brain. ( A ) CAD protein in 40 and 80 μg of brain sample, B1 and B2, respectively. ( B ) DHODH protein in 180 μg of brain ( B ) protein using polyclonal antibody. Lane E: commercial DHODH enzyme lacking its 31 first amino acids (250 ng of protein). ( C ) DHODH protein in hippocampus (H, 100 μg of protein), entorhinal cortex (EC, 180 μg of protein) and putamen (P, 180 μg of protein) using polyclonal antibody. White arrows indicate the corresponding band for DHODH. ( D ) DHODH protein using monoclonal antibody for detection of commercial enzyme lacking its first 31 amino acids (E, 250 ng of protein) and in 40 and 80 μg of brain sample, B1 and B2, respectively. ( E ) Fragment of DHODH protein used as immunogen to produce the monoclonal antibody. NT and T homogenates of untransformed bacteria and bacteria transformed with the DHODH fragment sequence, respectively. S and P: supernatant and pellet, respectively. ( F ) DHODH protein in neuroblastoma SH-SY5Y cell line (70 μg of protein) and brain tissue (B, 250 μg of protein) using polyclonal antibody. ( G ) Quantification of brain DHODH protein with the polyclonal antibody in brain (B, 180 μg of protein) by comparison with the commercial enzyme lacking its first 31 amino acids at 0.4 and 4.0 ng (E1 and E2), respectively. M: molecular weight marker.

Journal: Aging (Albany NY)

Article Title: Brain pyrimidine nucleotide synthesis and Alzheimer disease

doi: 10.18632/aging.102328

Figure Lengend Snippet: Western blot detection of selected proteins from the de novo pyrimidine biosynthesis pathway in adult human brain. ( A ) CAD protein in 40 and 80 μg of brain sample, B1 and B2, respectively. ( B ) DHODH protein in 180 μg of brain ( B ) protein using polyclonal antibody. Lane E: commercial DHODH enzyme lacking its 31 first amino acids (250 ng of protein). ( C ) DHODH protein in hippocampus (H, 100 μg of protein), entorhinal cortex (EC, 180 μg of protein) and putamen (P, 180 μg of protein) using polyclonal antibody. White arrows indicate the corresponding band for DHODH. ( D ) DHODH protein using monoclonal antibody for detection of commercial enzyme lacking its first 31 amino acids (E, 250 ng of protein) and in 40 and 80 μg of brain sample, B1 and B2, respectively. ( E ) Fragment of DHODH protein used as immunogen to produce the monoclonal antibody. NT and T homogenates of untransformed bacteria and bacteria transformed with the DHODH fragment sequence, respectively. S and P: supernatant and pellet, respectively. ( F ) DHODH protein in neuroblastoma SH-SY5Y cell line (70 μg of protein) and brain tissue (B, 250 μg of protein) using polyclonal antibody. ( G ) Quantification of brain DHODH protein with the polyclonal antibody in brain (B, 180 μg of protein) by comparison with the commercial enzyme lacking its first 31 amino acids at 0.4 and 4.0 ng (E1 and E2), respectively. M: molecular weight marker.

Article Snippet: Membranes were analyzed by immunoblotting with the following antibodies: rabbit polyclonal anti-DHODH (1:500) from biorbyt (orb247660, Cambridge, UK), rabbit mono and polyclonal anti-CAD (1:500), mouse monoclonal anti-DHODH (1:1,000), mouse polyclonal anti-UCK2 (1:250) from Abcam (ab40800, ab99312, ab54621, ab167683, Cambridge, UK), mouse anti-actin (1:1,000) from Sigma (A5441, St. Louis, MO, USA), and rabbit anti-CII (1:1,000) from Thermo Fisher Scientific (459200, Waltham, MA, USA).

Techniques: Western Blot, Bacteria, Transformation Assay, Sequencing, Comparison, Molecular Weight, Marker

DHODH inhibitors affect DHODH enzyme activity but not the DHODH protein expression in A375 cells. A, DHODH enzymatic assay with A771726 and BQR using pure human DHODH enzyme. B, DHODH enzymatic assay with A771726 and BQR using A375, H929 and Ramos cells lysates. C, A375 cells were incubated with 10, 30, 100 and 200 µM A771726 and 0.016, 0.05, 0.15 and 0.45 µM of BQR for 24 and 48 hours and cell viability was determined by Trypan blue stain. D, Western blot of A375 cell lysate after treatment with A771726 and BQR. Cells were harvested at 48 hours after treatment for Western blot analysis. Tubulinβ served as protein loading control. Values shown are mean ± SE of 3 independent experiments. *, P < 0.05, **, P < 0.01 and ***, P <0.001.

Journal: Journal of Cancer

Article Title: Dihydroorotate dehydrogenase Inhibitors Target c-Myc and Arrest Melanoma, Myeloma and Lymphoma cells at S-phase

doi: 10.7150/jca.14835

Figure Lengend Snippet: DHODH inhibitors affect DHODH enzyme activity but not the DHODH protein expression in A375 cells. A, DHODH enzymatic assay with A771726 and BQR using pure human DHODH enzyme. B, DHODH enzymatic assay with A771726 and BQR using A375, H929 and Ramos cells lysates. C, A375 cells were incubated with 10, 30, 100 and 200 µM A771726 and 0.016, 0.05, 0.15 and 0.45 µM of BQR for 24 and 48 hours and cell viability was determined by Trypan blue stain. D, Western blot of A375 cell lysate after treatment with A771726 and BQR. Cells were harvested at 48 hours after treatment for Western blot analysis. Tubulinβ served as protein loading control. Values shown are mean ± SE of 3 independent experiments. *, P < 0.05, **, P < 0.01 and ***, P <0.001.

Article Snippet: DHODH protein (25 ng) (Origene, USA) was dissolved in assay buffer and added to the 96-well plate containing DHODH inhibitors.

Techniques: Activity Assay, Expressing, Enzymatic Assay, Incubation, Staining, Western Blot, Control

Fig. 1. Recombinant human DHAPAT expression in HEK-293E cells. (A) Fluorescence of samples treated with buffers containing different combinations of chaotropic agents (A - 50 mM NaCl and 30% glycerol, B - 50 mM NaCl and 20% glycerol, C - 50 mM NaCl and 5% glycerol, D e 1 M NaCl and 30% glycerol, E e 1 M NaCl and 5% glycerol, F e 500 mM NaCl and 30% glycerol, G e 500 mM NaCl and 5% glycerol) to increase eGFP-DHAPAT solubility after cell lysis. (B) eGFP-DHAPAT fluorescence recovered after solubilization with or without detergents. (C) eGFP fluorescence detection in SDS-PAGE. The fluorescent band corresponds to the expected molecular weight of DHAPAT fused to eGFP (109 kDa, considering that membrane proteins migrate with a discrepancy of up to the 30% of the expected molecular weight, due to the interaction with detergent micelles [35]). (D) F-SEC profile su- perposition representing the best detergents for human DHAPAT solubilization from HEK-293E cells.

Journal: Biochemical and biophysical research communications

Article Title: Recombinant human dihydroxyacetonephosphate acyl-transferase characterization as an integral monotopic membrane protein.

doi: 10.1016/j.bbrc.2016.11.019

Figure Lengend Snippet: Fig. 1. Recombinant human DHAPAT expression in HEK-293E cells. (A) Fluorescence of samples treated with buffers containing different combinations of chaotropic agents (A - 50 mM NaCl and 30% glycerol, B - 50 mM NaCl and 20% glycerol, C - 50 mM NaCl and 5% glycerol, D e 1 M NaCl and 30% glycerol, E e 1 M NaCl and 5% glycerol, F e 500 mM NaCl and 30% glycerol, G e 500 mM NaCl and 5% glycerol) to increase eGFP-DHAPAT solubility after cell lysis. (B) eGFP-DHAPAT fluorescence recovered after solubilization with or without detergents. (C) eGFP fluorescence detection in SDS-PAGE. The fluorescent band corresponds to the expected molecular weight of DHAPAT fused to eGFP (109 kDa, considering that membrane proteins migrate with a discrepancy of up to the 30% of the expected molecular weight, due to the interaction with detergent micelles [35]). (D) F-SEC profile su- perposition representing the best detergents for human DHAPAT solubilization from HEK-293E cells.

Article Snippet: Full-length human DHAPAT in HEK-293E cells: cloning, expression and purification Human DHAPAT cDNA (NM_014236.3) was supplied by Origene.

Techniques: Recombinant, Expressing, Fluorescence, Solubility, Lysis, SDS Page, Molecular Weight, Membrane

Fig. 2. Characterization of recombinant human DHAPATD135. (A) Prediction of the secondary structure organization of DHAPAT. Based on the hydropathy plot and the hy- drophobic nature of the amino acids included in predicted a-helices (115e132, 168e178, 409e425, 464e481, 565e580, 600e624), we identified putative portions interacting with the peroxisomal membrane. (B) Size-exclusion chromatography elution profile of purified DHAPATD135 shows a major peak at 8.6 ml, corresponding to the void volume of the column and a minor peak at 14 ml, which corresponds to approximately 60 kDa size, the expected size of DHAPATD135 (54 kDa). (C) The purity of DHAPAT sample after SEC is confirmed by SDS-PAGE, showing a single band corresponding to approximately 60 kDa. (D) Radioactivity assay based on ADPS coupled-reaction shows that DHAPATD135 is not active, as it did not produce palmitoyl-DHAP, the ADPS substrate. ADPS alone with DHAPAT substrates was used as negative control and ADPS with palmitoyl-DHAP (DHAPAT product) as positive control.

Journal: Biochemical and biophysical research communications

Article Title: Recombinant human dihydroxyacetonephosphate acyl-transferase characterization as an integral monotopic membrane protein.

doi: 10.1016/j.bbrc.2016.11.019

Figure Lengend Snippet: Fig. 2. Characterization of recombinant human DHAPATD135. (A) Prediction of the secondary structure organization of DHAPAT. Based on the hydropathy plot and the hy- drophobic nature of the amino acids included in predicted a-helices (115e132, 168e178, 409e425, 464e481, 565e580, 600e624), we identified putative portions interacting with the peroxisomal membrane. (B) Size-exclusion chromatography elution profile of purified DHAPATD135 shows a major peak at 8.6 ml, corresponding to the void volume of the column and a minor peak at 14 ml, which corresponds to approximately 60 kDa size, the expected size of DHAPATD135 (54 kDa). (C) The purity of DHAPAT sample after SEC is confirmed by SDS-PAGE, showing a single band corresponding to approximately 60 kDa. (D) Radioactivity assay based on ADPS coupled-reaction shows that DHAPATD135 is not active, as it did not produce palmitoyl-DHAP, the ADPS substrate. ADPS alone with DHAPAT substrates was used as negative control and ADPS with palmitoyl-DHAP (DHAPAT product) as positive control.

Article Snippet: Full-length human DHAPAT in HEK-293E cells: cloning, expression and purification Human DHAPAT cDNA (NM_014236.3) was supplied by Origene.

Techniques: Recombinant, Membrane, Size-exclusion Chromatography, SDS Page, Radioactivity, Negative Control, Positive Control

Fig. 3. Full-length recombinant human DHAPAT expression and purification from P. pastoris. (A) Superposition of all elution profiles of solubilized DHAPAT shows that DHAPAT from P. pastoris is mainly aggregated with most detergents. (B) Size-exclusion chromatography elution profile of purified DHAPAT in complex with FSC-12 micelles (19 kDa) shows a single monodisperse peak at 10.4 ml (void volume 8.9 ml). (C) The purity of DHAPAT sample after SEC is confirmed by SDS-PAGE, showing a single band corresponding to approximately 70 kDa. (D) Radioactivity assay based on the production of radioactive alkyl-DHAP by ADPS, using acyl-DHAP produced by DHAPAT. The negative control was performed incubating acyl-CoA and DHAP without DHAPAT. Incubation of ADPS with palmitoyl-DHAP (DHAPAT product) was the positive control.

Journal: Biochemical and biophysical research communications

Article Title: Recombinant human dihydroxyacetonephosphate acyl-transferase characterization as an integral monotopic membrane protein.

doi: 10.1016/j.bbrc.2016.11.019

Figure Lengend Snippet: Fig. 3. Full-length recombinant human DHAPAT expression and purification from P. pastoris. (A) Superposition of all elution profiles of solubilized DHAPAT shows that DHAPAT from P. pastoris is mainly aggregated with most detergents. (B) Size-exclusion chromatography elution profile of purified DHAPAT in complex with FSC-12 micelles (19 kDa) shows a single monodisperse peak at 10.4 ml (void volume 8.9 ml). (C) The purity of DHAPAT sample after SEC is confirmed by SDS-PAGE, showing a single band corresponding to approximately 70 kDa. (D) Radioactivity assay based on the production of radioactive alkyl-DHAP by ADPS, using acyl-DHAP produced by DHAPAT. The negative control was performed incubating acyl-CoA and DHAP without DHAPAT. Incubation of ADPS with palmitoyl-DHAP (DHAPAT product) was the positive control.

Article Snippet: Full-length human DHAPAT in HEK-293E cells: cloning, expression and purification Human DHAPAT cDNA (NM_014236.3) was supplied by Origene.

Techniques: Recombinant, Expressing, Size-exclusion Chromatography, SDS Page, Radioactivity, Produced, Negative Control, Incubation, Positive Control

Fig. 4. Recombinant ADPS and DHAPAT interaction in vitro. (A) SDS-page of pull-down experiments between ADPS and His8-GFPuv-DHAPAT. 1, sample before incubating with resin; 2e4, unbound fractions containing manly ADPS; 5, elution with 500 mM imidazole, containing both ADPS and DHAPAT; 6e8, ADPS in buffer containing FSC-12 after 10, 20, 30 min, respectively. After 30 min incubation in FSC-12, ADPS gives rise to two new bands of 40 kDa and 20 kDa. (B) Interaction between APDS and DHAPAT analyzed by native- PAGE. 1, ADPS þ DHAPAT (1:1); 2, ADPS þ DHAPAT (2:1); 3, DHAPAT; 4, ADPS; 5, DHAPAT þ control protein; 6, control protein.

Journal: Biochemical and biophysical research communications

Article Title: Recombinant human dihydroxyacetonephosphate acyl-transferase characterization as an integral monotopic membrane protein.

doi: 10.1016/j.bbrc.2016.11.019

Figure Lengend Snippet: Fig. 4. Recombinant ADPS and DHAPAT interaction in vitro. (A) SDS-page of pull-down experiments between ADPS and His8-GFPuv-DHAPAT. 1, sample before incubating with resin; 2e4, unbound fractions containing manly ADPS; 5, elution with 500 mM imidazole, containing both ADPS and DHAPAT; 6e8, ADPS in buffer containing FSC-12 after 10, 20, 30 min, respectively. After 30 min incubation in FSC-12, ADPS gives rise to two new bands of 40 kDa and 20 kDa. (B) Interaction between APDS and DHAPAT analyzed by native- PAGE. 1, ADPS þ DHAPAT (1:1); 2, ADPS þ DHAPAT (2:1); 3, DHAPAT; 4, ADPS; 5, DHAPAT þ control protein; 6, control protein.

Article Snippet: Full-length human DHAPAT in HEK-293E cells: cloning, expression and purification Human DHAPAT cDNA (NM_014236.3) was supplied by Origene.

Techniques: Recombinant, In Vitro, SDS Page, Incubation, Clear Native PAGE, Control

Pharmacological PDE7A inhibition suppresses multiple genes that encode enzymes regulating the pyrimidine biosynthesis pathway in TNBC (A) Heatmap showing the top 30 upregulated and top 30 downregulated genes in MDA-MB-231 cells treated with BRL-50481 (50 μM) for 72 h compared with DMSO-treated cells ( n = 3 biological replicates/group). (B) Biological pathways that were altered in MDA-MB-231 cells treated with the PDE7A inhibitor BRL-50481 (50 μM) for 72 h compared with DMSO-treated cells based on the mRNA expression profiles identified from RNA sequencing results. (C) Heatmap showing metabolite levels of altered metabolites in MDA-MB-231 cells treated with BRL-50481 (50 μM) for 72 h compared with DMSO-treated cells ( n = 3 biological replicates/group). (D) Heatmap showing mRNA levels of altered pyrimidine biosynthesis genes in MDA-MB-231 cells treated with BRL-50481 (50 μM) for 72 h compared with DMSO-treated cells ( n = 3 biological replicates/group). (E) Schematic for the pyrimidine biosynthesis pathway showing metabolite levels measured through our global metabolomics analysis. Dihydroorotic acid, UMP, and dTMP levels are highlighted in red rectangles. (F) A schematic showing metabolites and enzymes of the de novo pyrimidine biosynthesis pathway. (G) DHODH and CAD mRNA expression levels in the indicated TNBC cells treated with 50 μM BRL-50481 for 72 h compared with DMSO-treated cells are shown. ACTINB was used for normalization ( n = 3 biological replicates/group). (H) DHODH and CAD protein levels in MDA-MB-231 cells treated with 50 μM BRL-50481 or DMSO for 72 h were measured using immunoblotting. ACTINB was used as a loading control. All quantitative data represent the mean ± SEM. ∗ p < 0.05 and ∗∗ p < 0.01. See also and , , and .

Journal: Cell Reports Medicine

Article Title: PDE7A inhibition suppresses triple-negative breast cancer by attenuating de novo pyrimidine biosynthesis

doi: 10.1016/j.xcrm.2025.102356

Figure Lengend Snippet: Pharmacological PDE7A inhibition suppresses multiple genes that encode enzymes regulating the pyrimidine biosynthesis pathway in TNBC (A) Heatmap showing the top 30 upregulated and top 30 downregulated genes in MDA-MB-231 cells treated with BRL-50481 (50 μM) for 72 h compared with DMSO-treated cells ( n = 3 biological replicates/group). (B) Biological pathways that were altered in MDA-MB-231 cells treated with the PDE7A inhibitor BRL-50481 (50 μM) for 72 h compared with DMSO-treated cells based on the mRNA expression profiles identified from RNA sequencing results. (C) Heatmap showing metabolite levels of altered metabolites in MDA-MB-231 cells treated with BRL-50481 (50 μM) for 72 h compared with DMSO-treated cells ( n = 3 biological replicates/group). (D) Heatmap showing mRNA levels of altered pyrimidine biosynthesis genes in MDA-MB-231 cells treated with BRL-50481 (50 μM) for 72 h compared with DMSO-treated cells ( n = 3 biological replicates/group). (E) Schematic for the pyrimidine biosynthesis pathway showing metabolite levels measured through our global metabolomics analysis. Dihydroorotic acid, UMP, and dTMP levels are highlighted in red rectangles. (F) A schematic showing metabolites and enzymes of the de novo pyrimidine biosynthesis pathway. (G) DHODH and CAD mRNA expression levels in the indicated TNBC cells treated with 50 μM BRL-50481 for 72 h compared with DMSO-treated cells are shown. ACTINB was used for normalization ( n = 3 biological replicates/group). (H) DHODH and CAD protein levels in MDA-MB-231 cells treated with 50 μM BRL-50481 or DMSO for 72 h were measured using immunoblotting. ACTINB was used as a loading control. All quantitative data represent the mean ± SEM. ∗ p < 0.05 and ∗∗ p < 0.01. See also and , , and .

Article Snippet: The mGFP-tagged DHODH Lenti ORF Clone was purchased from OriGene (Rockville, MD, USA).

Techniques: Inhibition, Expressing, RNA Sequencing, Western Blot, Control

Pharmacological inhibition of DHODH suppresses TNBC tumor growth (A) The indicated TNBC cell lines were treated with BAY-2402234 at the indicated concentrations for 72 h and analyzed for cell viability using the MTT assay. Relative cell viability is plotted relative to DMSO-treated cells ( n = 3 biological replicates/group). (B) TNBC cell lines were treated with BAY-2402234 at the indicated concentrations, and soft-agar assays were performed. Representative images of soft-agar assays for the indicated TNBC cell lines treated with BAY-2402234 (0.5 or 1 nM) are shown. Scale bar, 500 μm. (C) The indicated TNBC cell lines were treated with DMSO or BAY-2402234 (0.5 or 1 nM), and a quantitative soft-agar assay was performed using the CytoSelect 96-well quantitative soft-agar assay kit. Fluorescence intensities (arbitrary unit) under the indicated conditions for the indicated TNBC cell lines are shown ( n = 3 biological replicates/group). (D) The indicated TNBC cell lines were injected subcutaneously into the flanks of female NSG mice ( n = 5/group, each cell line). Mice were treated every alternate day with either vehicle or BAY-2402234 (2 mg/kg) intraperitoneally, and tumor growth was measured. Average tumor volumes at the indicated time points are plotted. (E) MTT assay was performed to measure cell viability for the indicated TNBC cells treated with DMSO or the indicated concentration of BAY-2402234 for 72 h with or without 100 μM uridine ( n = 4 biological replicates/group). All quantitative data represent the mean ± SEM. ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001. See also and .

Journal: Cell Reports Medicine

Article Title: PDE7A inhibition suppresses triple-negative breast cancer by attenuating de novo pyrimidine biosynthesis

doi: 10.1016/j.xcrm.2025.102356

Figure Lengend Snippet: Pharmacological inhibition of DHODH suppresses TNBC tumor growth (A) The indicated TNBC cell lines were treated with BAY-2402234 at the indicated concentrations for 72 h and analyzed for cell viability using the MTT assay. Relative cell viability is plotted relative to DMSO-treated cells ( n = 3 biological replicates/group). (B) TNBC cell lines were treated with BAY-2402234 at the indicated concentrations, and soft-agar assays were performed. Representative images of soft-agar assays for the indicated TNBC cell lines treated with BAY-2402234 (0.5 or 1 nM) are shown. Scale bar, 500 μm. (C) The indicated TNBC cell lines were treated with DMSO or BAY-2402234 (0.5 or 1 nM), and a quantitative soft-agar assay was performed using the CytoSelect 96-well quantitative soft-agar assay kit. Fluorescence intensities (arbitrary unit) under the indicated conditions for the indicated TNBC cell lines are shown ( n = 3 biological replicates/group). (D) The indicated TNBC cell lines were injected subcutaneously into the flanks of female NSG mice ( n = 5/group, each cell line). Mice were treated every alternate day with either vehicle or BAY-2402234 (2 mg/kg) intraperitoneally, and tumor growth was measured. Average tumor volumes at the indicated time points are plotted. (E) MTT assay was performed to measure cell viability for the indicated TNBC cells treated with DMSO or the indicated concentration of BAY-2402234 for 72 h with or without 100 μM uridine ( n = 4 biological replicates/group). All quantitative data represent the mean ± SEM. ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001. See also and .

Article Snippet: The mGFP-tagged DHODH Lenti ORF Clone was purchased from OriGene (Rockville, MD, USA).

Techniques: Inhibition, MTT Assay, Soft Agar Assay, Fluorescence, Injection, Concentration Assay

Genetic inhibition of PDE7A suppresses TNBC tumor growth in part via DHODH downregulation, and co-targeting PDE7A and DHODH potently inhibits TNBC (A) Immunoblotting for PDE7A protein expression in MDA-MB-231 cells expressing non-specific single guide RNA (NS sgRNA) or PDE7A -targeting sgRNA. ACTINB was used as a loading control. (B) MDA-MB-231 cells expressing NS sgRNA or PDE7A-targeting sgRNA were analyzed by soft-agar assay. Representative images of the soft-agar assays for MDA-MB-231 cells expressing either NS sgRNA or PDE7A -targeting sgRNA are shown. Scale bar, 500 μm. (C) MDA-MB-231 cells expressing either NS sgRNA or PDE7A -targeting sgRNA were analyzed using the quantitative soft-agar assay using the CytoSelect 96-well quantitative soft-agar assay kit. Fluorescence intensities (arbitrary unit) under the indicated conditions are shown ( n = 3 biological replicates/group). (D) MDA-MB-231 cells expressing an empty vector or V5-tagged DHODH open reading frame (ORF)-expressing cells simultaneously expressing NS sgRNA or PDE7A -targeting sgRNA. DHODH protein expression was assessed by an antibody for V5-tag. ACTINB was used as the loading control. (E) MDA-MB-231 cells expressing an empty vector or DHODH ORF-expressing cells simultaneously expressing NS sgRNA or PDE7A -targeting sgRNA were analyzed using a soft-agar assay. Representative images of the soft-agar assay under indicated conditions are shown. Scale bar, 500 μm. (F) MDA-MB-231 cells expressing an empty vector or V5-tagged DHODH ORF-expressing cells simultaneously expressing NS sgRNA or PDE7A-targeting sgRNA were analyzed using the quantitative soft-agar assay performed with the CytoSelect 96-well quantitative soft-agar assay kit. Fluorescence intensities (arbitrary unit) under the indicated conditions are shown ( n = 3 biological replicates/group). (G) MDA-MB-231 cells expressing NS sgRNA or PDE7A -targeting sgRNA and simultaneously expressing DHODH ORF or an empty vector control were analyzed for caspase-3 activity using the caspase-3-based colorimetric assay. Relative caspase-3 activity under the indicated conditions is shown ( n = 4 biological replicates/group). (H) MDA-MB-231 cells expressing NS sgRNA or PDE7A -targeting sgRNA and simultaneously expressing DHODH ORF or an empty vector control were subcutaneously injected into the flanks of female NSG mice ( n = 5/group), and tumor volumes were measured. Average tumor volumes at the indicated times are shown. (I) The indicated TNBC cell lines were treated with DMSO, BAY-2402234 (0.5 nM), BRL-50481 (20 μM), or both BAY-2402234 (0.5 nM) and BRL-50481 (20 μM) and were analyzed by the soft-agar assay. Representative images of the soft-agar assays for these indicated TNBC cell lines under the indicated conditions are plotted. Scale bar, 500 μm. (J) The indicated TNBC cell lines were treated with DMSO, BAY-2402234 (0.5 nM), BRL-50481 (20 μM), or both BAY-2402234 (0.5 nM) and BRL-50481 (20 μM) and were analyzed using the quantitative soft-agar assay performed using the CytoSelect 96-well quantitative soft-agar assay kit. Fluorescence intensities (arbitrary unit) under the indicated conditions are shown ( n = 3 biological replicates/group). (K) The indicated TNBC cell lines were treated with DMSO, BAY-2402234 (0.5 nM), BRL-50481 (20 μM), or BAY-2402234 (0.5 nM) + BRL-50481 (20 μM) and analyzed for caspase-3 activity using a caspase-3-based colorimetric assay. Relative caspase-3 activity is shown under the indicated conditions ( n = 4 biological replicates/group). All quantitative data represent the mean ± SEM. ∗∗∗∗ p < 0.0001. See also and .

Journal: Cell Reports Medicine

Article Title: PDE7A inhibition suppresses triple-negative breast cancer by attenuating de novo pyrimidine biosynthesis

doi: 10.1016/j.xcrm.2025.102356

Figure Lengend Snippet: Genetic inhibition of PDE7A suppresses TNBC tumor growth in part via DHODH downregulation, and co-targeting PDE7A and DHODH potently inhibits TNBC (A) Immunoblotting for PDE7A protein expression in MDA-MB-231 cells expressing non-specific single guide RNA (NS sgRNA) or PDE7A -targeting sgRNA. ACTINB was used as a loading control. (B) MDA-MB-231 cells expressing NS sgRNA or PDE7A-targeting sgRNA were analyzed by soft-agar assay. Representative images of the soft-agar assays for MDA-MB-231 cells expressing either NS sgRNA or PDE7A -targeting sgRNA are shown. Scale bar, 500 μm. (C) MDA-MB-231 cells expressing either NS sgRNA or PDE7A -targeting sgRNA were analyzed using the quantitative soft-agar assay using the CytoSelect 96-well quantitative soft-agar assay kit. Fluorescence intensities (arbitrary unit) under the indicated conditions are shown ( n = 3 biological replicates/group). (D) MDA-MB-231 cells expressing an empty vector or V5-tagged DHODH open reading frame (ORF)-expressing cells simultaneously expressing NS sgRNA or PDE7A -targeting sgRNA. DHODH protein expression was assessed by an antibody for V5-tag. ACTINB was used as the loading control. (E) MDA-MB-231 cells expressing an empty vector or DHODH ORF-expressing cells simultaneously expressing NS sgRNA or PDE7A -targeting sgRNA were analyzed using a soft-agar assay. Representative images of the soft-agar assay under indicated conditions are shown. Scale bar, 500 μm. (F) MDA-MB-231 cells expressing an empty vector or V5-tagged DHODH ORF-expressing cells simultaneously expressing NS sgRNA or PDE7A-targeting sgRNA were analyzed using the quantitative soft-agar assay performed with the CytoSelect 96-well quantitative soft-agar assay kit. Fluorescence intensities (arbitrary unit) under the indicated conditions are shown ( n = 3 biological replicates/group). (G) MDA-MB-231 cells expressing NS sgRNA or PDE7A -targeting sgRNA and simultaneously expressing DHODH ORF or an empty vector control were analyzed for caspase-3 activity using the caspase-3-based colorimetric assay. Relative caspase-3 activity under the indicated conditions is shown ( n = 4 biological replicates/group). (H) MDA-MB-231 cells expressing NS sgRNA or PDE7A -targeting sgRNA and simultaneously expressing DHODH ORF or an empty vector control were subcutaneously injected into the flanks of female NSG mice ( n = 5/group), and tumor volumes were measured. Average tumor volumes at the indicated times are shown. (I) The indicated TNBC cell lines were treated with DMSO, BAY-2402234 (0.5 nM), BRL-50481 (20 μM), or both BAY-2402234 (0.5 nM) and BRL-50481 (20 μM) and were analyzed by the soft-agar assay. Representative images of the soft-agar assays for these indicated TNBC cell lines under the indicated conditions are plotted. Scale bar, 500 μm. (J) The indicated TNBC cell lines were treated with DMSO, BAY-2402234 (0.5 nM), BRL-50481 (20 μM), or both BAY-2402234 (0.5 nM) and BRL-50481 (20 μM) and were analyzed using the quantitative soft-agar assay performed using the CytoSelect 96-well quantitative soft-agar assay kit. Fluorescence intensities (arbitrary unit) under the indicated conditions are shown ( n = 3 biological replicates/group). (K) The indicated TNBC cell lines were treated with DMSO, BAY-2402234 (0.5 nM), BRL-50481 (20 μM), or BAY-2402234 (0.5 nM) + BRL-50481 (20 μM) and analyzed for caspase-3 activity using a caspase-3-based colorimetric assay. Relative caspase-3 activity is shown under the indicated conditions ( n = 4 biological replicates/group). All quantitative data represent the mean ± SEM. ∗∗∗∗ p < 0.0001. See also and .

Article Snippet: The mGFP-tagged DHODH Lenti ORF Clone was purchased from OriGene (Rockville, MD, USA).

Techniques: Inhibition, Western Blot, Expressing, Control, Soft Agar Assay, Fluorescence, Plasmid Preparation, Activity Assay, Colorimetric Assay, Injection

Pharmacological inhibition of PDE7A and DHODH combinatorically inhibits TNBC tumor growth and metastasis in mice (A and B) The indicated TNBC PDXs (TM00096 and TM00098) were subcutaneously injected into the flanks of female NSG mice ( n = 6/group, each PDX). The mice were treated every alternate day with vehicle, BRL-50481 (10 mg/kg), BAY-2402234 (0.5 mg/kg body weight), or the combination of BRL-50481 (10 mg/kg) and BAY-2402234 (0.5 mg/kg) intraperitoneally and analyzed for tumor growth. Average tumor volumes at the indicated time points are shown. (C) Firefly luciferase-labeled ( F-Luc ) MDA-MB-231 cells were orthotopically injected into the mammary fat pad of female NSG mice ( n = 5/group). The mice were treated daily with vehicle, BRL-50481 (10 mg/kg body weight), BAY-2402234 (0.5 mg/kg body weight), or the combination of BRL-50481 (10 mg/kg body weight) and BAY-2402234 (0.5 mg/kg body weight) and analyzed for tumor growth. Tumor growth was measured via weekly bioluminescence imaging. Representative whole-body bioluminescence images at the indicated weeks are shown. (D) Whole-body bioluminescence intensities at the indicated weeks for the experiment shown in (C) are shown ( n = 5/group). (E) Lungs and livers were collected and imaged at the end of the experiment shown in (C). (F) Bioluminescence intensities for the lungs and livers for images in the (E) are shown ( n = 5/group). (G) A model summarizing the role of PDE7A in TNBC. All quantitative data represent the mean ± SEM. ns, not significant p value; ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001.

Journal: Cell Reports Medicine

Article Title: PDE7A inhibition suppresses triple-negative breast cancer by attenuating de novo pyrimidine biosynthesis

doi: 10.1016/j.xcrm.2025.102356

Figure Lengend Snippet: Pharmacological inhibition of PDE7A and DHODH combinatorically inhibits TNBC tumor growth and metastasis in mice (A and B) The indicated TNBC PDXs (TM00096 and TM00098) were subcutaneously injected into the flanks of female NSG mice ( n = 6/group, each PDX). The mice were treated every alternate day with vehicle, BRL-50481 (10 mg/kg), BAY-2402234 (0.5 mg/kg body weight), or the combination of BRL-50481 (10 mg/kg) and BAY-2402234 (0.5 mg/kg) intraperitoneally and analyzed for tumor growth. Average tumor volumes at the indicated time points are shown. (C) Firefly luciferase-labeled ( F-Luc ) MDA-MB-231 cells were orthotopically injected into the mammary fat pad of female NSG mice ( n = 5/group). The mice were treated daily with vehicle, BRL-50481 (10 mg/kg body weight), BAY-2402234 (0.5 mg/kg body weight), or the combination of BRL-50481 (10 mg/kg body weight) and BAY-2402234 (0.5 mg/kg body weight) and analyzed for tumor growth. Tumor growth was measured via weekly bioluminescence imaging. Representative whole-body bioluminescence images at the indicated weeks are shown. (D) Whole-body bioluminescence intensities at the indicated weeks for the experiment shown in (C) are shown ( n = 5/group). (E) Lungs and livers were collected and imaged at the end of the experiment shown in (C). (F) Bioluminescence intensities for the lungs and livers for images in the (E) are shown ( n = 5/group). (G) A model summarizing the role of PDE7A in TNBC. All quantitative data represent the mean ± SEM. ns, not significant p value; ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001.

Article Snippet: The mGFP-tagged DHODH Lenti ORF Clone was purchased from OriGene (Rockville, MD, USA).

Techniques: Inhibition, Injection, Luciferase, Labeling, Imaging

 Recombinant hDHODH  Activity of Selected Compounds

Journal: Journal of medicinal chemistry

Article Title: Targeting Chikungunya Virus Replication by Benzoannulene Inhibitors

doi: 10.1021/acs.jmedchem.0c02183

Figure Lengend Snippet: Recombinant hDHODH Activity of Selected Compounds

Article Snippet: Enzyme activity was monitored kinetically by the reduction in DCIP absorbance at 600 nm over the course of 1 h. Purified recombinant hDHODH (full-length, C-terminal MYC/DDK-tag) enzyme was purchased from Origene (catalog no. TP309034).

Techniques: Recombinant, Activity Assay