dac Search Results


90
Cytiva Europe readymatetm aseptic connectors
Readymatetm Aseptic Connectors, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dac/us09663752-54-9-13?v=Cytiva+Europe
Average 90 stars, based on 1 article reviews
readymatetm aseptic connectors - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

95
Chem Impex International resuspension
Resuspension, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dac/pm40106557-243-7-24?v=Chem+Impex+International
Average 95 stars, based on 1 article reviews
resuspension - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

90
Toronto Research Chemicals aza
Aza, supplied by Toronto Research Chemicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dac/pmc06677770-271-3-20?v=Toronto+Research+Chemicals
Average 90 stars, based on 1 article reviews
aza - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
OriGene transcript variant 1
Transcript Variant 1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dac/pmc05580653-332-8-11?v=OriGene
Average 90 stars, based on 1 article reviews
transcript variant 1 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
OriGene mus fbxw4 atg ri
Figure 1. The <t>Fbxw4</t> locus is a common site of proviral insertion and is highly expressed in the murine mammary gland during involution. A. Examination of the UCSC genome browser (genome.ucsc.edu) and the Retroviral Tagged Cancer Gene Database (http://variation.osu. edu/rtcgd/index.html) shows that multiple retroviral insertions have been cloned from within the transcribed Fbxw4 locus. Arrows indicate the directionality of the inserted provirus. The exons are indicated at the bottom and the position and scale of murine chromosome 19 is shown on top. Names given to the cloned proviral insertions are indicated on the left. Insertion sites beginning with ‘mmt’ were cloned from mouse mammary tumor virus induced mammary carcinomas. Insertion sites beginning with ‘Dkm’, ‘248’ and ‘B5’ were cloned from leukemias from murine leukemia virus accelerated hematopoietic cancers. B. FBXW4 is variably expressed in normal murine tissues. Oligos specific for murine Fbxw4 were used to perform quantitative rt-PCR on the ‘mouse normal cDNA TissueScan array’. Values were normalized to quantitative rt-PCR for GAPDH. C. Schematic of the Fbxw4 protein. Numbers represent the amino acids of the protein. Domains contained within Fbxw4 are indicated. doi:10.1371/journal.pone.0063610.g001
Mus Fbxw4 Atg Ri, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dac/pm23658844-72-15-5?v=OriGene
Average 90 stars, based on 1 article reviews
mus fbxw4 atg ri - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

91
Proteintech rabbit anti human arylacetamide deacetylase
Figure 1. The <t>Fbxw4</t> locus is a common site of proviral insertion and is highly expressed in the murine mammary gland during involution. A. Examination of the UCSC genome browser (genome.ucsc.edu) and the Retroviral Tagged Cancer Gene Database (http://variation.osu. edu/rtcgd/index.html) shows that multiple retroviral insertions have been cloned from within the transcribed Fbxw4 locus. Arrows indicate the directionality of the inserted provirus. The exons are indicated at the bottom and the position and scale of murine chromosome 19 is shown on top. Names given to the cloned proviral insertions are indicated on the left. Insertion sites beginning with ‘mmt’ were cloned from mouse mammary tumor virus induced mammary carcinomas. Insertion sites beginning with ‘Dkm’, ‘248’ and ‘B5’ were cloned from leukemias from murine leukemia virus accelerated hematopoietic cancers. B. FBXW4 is variably expressed in normal murine tissues. Oligos specific for murine Fbxw4 were used to perform quantitative rt-PCR on the ‘mouse normal cDNA TissueScan array’. Values were normalized to quantitative rt-PCR for GAPDH. C. Schematic of the Fbxw4 protein. Numbers represent the amino acids of the protein. Domains contained within Fbxw4 are indicated. doi:10.1371/journal.pone.0063610.g001
Rabbit Anti Human Arylacetamide Deacetylase, supplied by Proteintech, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dac/pm37544935-205-4-13?v=Proteintech
Average 91 stars, based on 1 article reviews
rabbit anti human arylacetamide deacetylase - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

90
Johns Hopkins HealthCare data analysis center (dac)
Figure 1. The <t>Fbxw4</t> locus is a common site of proviral insertion and is highly expressed in the murine mammary gland during involution. A. Examination of the UCSC genome browser (genome.ucsc.edu) and the Retroviral Tagged Cancer Gene Database (http://variation.osu. edu/rtcgd/index.html) shows that multiple retroviral insertions have been cloned from within the transcribed Fbxw4 locus. Arrows indicate the directionality of the inserted provirus. The exons are indicated at the bottom and the position and scale of murine chromosome 19 is shown on top. Names given to the cloned proviral insertions are indicated on the left. Insertion sites beginning with ‘mmt’ were cloned from mouse mammary tumor virus induced mammary carcinomas. Insertion sites beginning with ‘Dkm’, ‘248’ and ‘B5’ were cloned from leukemias from murine leukemia virus accelerated hematopoietic cancers. B. FBXW4 is variably expressed in normal murine tissues. Oligos specific for murine Fbxw4 were used to perform quantitative rt-PCR on the ‘mouse normal cDNA TissueScan array’. Values were normalized to quantitative rt-PCR for GAPDH. C. Schematic of the Fbxw4 protein. Numbers represent the amino acids of the protein. Domains contained within Fbxw4 are indicated. doi:10.1371/journal.pone.0063610.g001
Data Analysis Center (Dac), supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dac/pmc08145190-82-1-7?v=Johns+Hopkins+HealthCare
Average 90 stars, based on 1 article reviews
data analysis center (dac) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Almax industries membrane diamond anvil cells
Figure 1. The <t>Fbxw4</t> locus is a common site of proviral insertion and is highly expressed in the murine mammary gland during involution. A. Examination of the UCSC genome browser (genome.ucsc.edu) and the Retroviral Tagged Cancer Gene Database (http://variation.osu. edu/rtcgd/index.html) shows that multiple retroviral insertions have been cloned from within the transcribed Fbxw4 locus. Arrows indicate the directionality of the inserted provirus. The exons are indicated at the bottom and the position and scale of murine chromosome 19 is shown on top. Names given to the cloned proviral insertions are indicated on the left. Insertion sites beginning with ‘mmt’ were cloned from mouse mammary tumor virus induced mammary carcinomas. Insertion sites beginning with ‘Dkm’, ‘248’ and ‘B5’ were cloned from leukemias from murine leukemia virus accelerated hematopoietic cancers. B. FBXW4 is variably expressed in normal murine tissues. Oligos specific for murine Fbxw4 were used to perform quantitative rt-PCR on the ‘mouse normal cDNA TissueScan array’. Values were normalized to quantitative rt-PCR for GAPDH. C. Schematic of the Fbxw4 protein. Numbers represent the amino acids of the protein. Domains contained within Fbxw4 are indicated. doi:10.1371/journal.pone.0063610.g001
Membrane Diamond Anvil Cells, supplied by Almax industries, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dac/pm35867700-204-0-8?v=Almax+industries
Average 90 stars, based on 1 article reviews
membrane diamond anvil cells - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Amryt Pharma col7a1 gene formulated in highly branched poly β-amino ester–ap103
Figure 1. The <t>Fbxw4</t> locus is a common site of proviral insertion and is highly expressed in the murine mammary gland during involution. A. Examination of the UCSC genome browser (genome.ucsc.edu) and the Retroviral Tagged Cancer Gene Database (http://variation.osu. edu/rtcgd/index.html) shows that multiple retroviral insertions have been cloned from within the transcribed Fbxw4 locus. Arrows indicate the directionality of the inserted provirus. The exons are indicated at the bottom and the position and scale of murine chromosome 19 is shown on top. Names given to the cloned proviral insertions are indicated on the left. Insertion sites beginning with ‘mmt’ were cloned from mouse mammary tumor virus induced mammary carcinomas. Insertion sites beginning with ‘Dkm’, ‘248’ and ‘B5’ were cloned from leukemias from murine leukemia virus accelerated hematopoietic cancers. B. FBXW4 is variably expressed in normal murine tissues. Oligos specific for murine Fbxw4 were used to perform quantitative rt-PCR on the ‘mouse normal cDNA TissueScan array’. Values were normalized to quantitative rt-PCR for GAPDH. C. Schematic of the Fbxw4 protein. Numbers represent the amino acids of the protein. Domains contained within Fbxw4 are indicated. doi:10.1371/journal.pone.0063610.g001
Col7a1 Gene Formulated In Highly Branched Poly β Amino Ester–Ap103, supplied by Amryt Pharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dac/pmc08537019-131-16-3?v=Amryt+Pharma
Average 90 stars, based on 1 article reviews
col7a1 gene formulated in highly branched poly β-amino ester–ap103 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Siemens AG speed mixer dac 150 fvz
Figure 1. The <t>Fbxw4</t> locus is a common site of proviral insertion and is highly expressed in the murine mammary gland during involution. A. Examination of the UCSC genome browser (genome.ucsc.edu) and the Retroviral Tagged Cancer Gene Database (http://variation.osu. edu/rtcgd/index.html) shows that multiple retroviral insertions have been cloned from within the transcribed Fbxw4 locus. Arrows indicate the directionality of the inserted provirus. The exons are indicated at the bottom and the position and scale of murine chromosome 19 is shown on top. Names given to the cloned proviral insertions are indicated on the left. Insertion sites beginning with ‘mmt’ were cloned from mouse mammary tumor virus induced mammary carcinomas. Insertion sites beginning with ‘Dkm’, ‘248’ and ‘B5’ were cloned from leukemias from murine leukemia virus accelerated hematopoietic cancers. B. FBXW4 is variably expressed in normal murine tissues. Oligos specific for murine Fbxw4 were used to perform quantitative rt-PCR on the ‘mouse normal cDNA TissueScan array’. Values were normalized to quantitative rt-PCR for GAPDH. C. Schematic of the Fbxw4 protein. Numbers represent the amino acids of the protein. Domains contained within Fbxw4 are indicated. doi:10.1371/journal.pone.0063610.g001
Speed Mixer Dac 150 Fvz, supplied by Siemens AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dac/us09876342-135-1-6?v=Siemens+AG
Average 90 stars, based on 1 article reviews
speed mixer dac 150 fvz - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
FlackTek Inc speed mixer flacktek dac 600.1 vac-p
Figure 1. The <t>Fbxw4</t> locus is a common site of proviral insertion and is highly expressed in the murine mammary gland during involution. A. Examination of the UCSC genome browser (genome.ucsc.edu) and the Retroviral Tagged Cancer Gene Database (http://variation.osu. edu/rtcgd/index.html) shows that multiple retroviral insertions have been cloned from within the transcribed Fbxw4 locus. Arrows indicate the directionality of the inserted provirus. The exons are indicated at the bottom and the position and scale of murine chromosome 19 is shown on top. Names given to the cloned proviral insertions are indicated on the left. Insertion sites beginning with ‘mmt’ were cloned from mouse mammary tumor virus induced mammary carcinomas. Insertion sites beginning with ‘Dkm’, ‘248’ and ‘B5’ were cloned from leukemias from murine leukemia virus accelerated hematopoietic cancers. B. FBXW4 is variably expressed in normal murine tissues. Oligos specific for murine Fbxw4 were used to perform quantitative rt-PCR on the ‘mouse normal cDNA TissueScan array’. Values were normalized to quantitative rt-PCR for GAPDH. C. Schematic of the Fbxw4 protein. Numbers represent the amino acids of the protein. Domains contained within Fbxw4 are indicated. doi:10.1371/journal.pone.0063610.g001
Speed Mixer Flacktek Dac 600.1 Vac P, supplied by FlackTek Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dac/10__1021_slash_acsapm__3c00465____ap3c00465_si_001-6-19-21?v=FlackTek+Inc
Average 90 stars, based on 1 article reviews
speed mixer flacktek dac 600.1 vac-p - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
FlackTek Inc speed mixer dac 400 mixer range
Figure 1. The <t>Fbxw4</t> locus is a common site of proviral insertion and is highly expressed in the murine mammary gland during involution. A. Examination of the UCSC genome browser (genome.ucsc.edu) and the Retroviral Tagged Cancer Gene Database (http://variation.osu. edu/rtcgd/index.html) shows that multiple retroviral insertions have been cloned from within the transcribed Fbxw4 locus. Arrows indicate the directionality of the inserted provirus. The exons are indicated at the bottom and the position and scale of murine chromosome 19 is shown on top. Names given to the cloned proviral insertions are indicated on the left. Insertion sites beginning with ‘mmt’ were cloned from mouse mammary tumor virus induced mammary carcinomas. Insertion sites beginning with ‘Dkm’, ‘248’ and ‘B5’ were cloned from leukemias from murine leukemia virus accelerated hematopoietic cancers. B. FBXW4 is variably expressed in normal murine tissues. Oligos specific for murine Fbxw4 were used to perform quantitative rt-PCR on the ‘mouse normal cDNA TissueScan array’. Values were normalized to quantitative rt-PCR for GAPDH. C. Schematic of the Fbxw4 protein. Numbers represent the amino acids of the protein. Domains contained within Fbxw4 are indicated. doi:10.1371/journal.pone.0063610.g001
Speed Mixer Dac 400 Mixer Range, supplied by FlackTek Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dac/pm33921179-111-6-12?v=FlackTek+Inc
Average 90 stars, based on 1 article reviews
speed mixer dac 400 mixer range - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


Figure 1. The Fbxw4 locus is a common site of proviral insertion and is highly expressed in the murine mammary gland during involution. A. Examination of the UCSC genome browser (genome.ucsc.edu) and the Retroviral Tagged Cancer Gene Database (http://variation.osu. edu/rtcgd/index.html) shows that multiple retroviral insertions have been cloned from within the transcribed Fbxw4 locus. Arrows indicate the directionality of the inserted provirus. The exons are indicated at the bottom and the position and scale of murine chromosome 19 is shown on top. Names given to the cloned proviral insertions are indicated on the left. Insertion sites beginning with ‘mmt’ were cloned from mouse mammary tumor virus induced mammary carcinomas. Insertion sites beginning with ‘Dkm’, ‘248’ and ‘B5’ were cloned from leukemias from murine leukemia virus accelerated hematopoietic cancers. B. FBXW4 is variably expressed in normal murine tissues. Oligos specific for murine Fbxw4 were used to perform quantitative rt-PCR on the ‘mouse normal cDNA TissueScan array’. Values were normalized to quantitative rt-PCR for GAPDH. C. Schematic of the Fbxw4 protein. Numbers represent the amino acids of the protein. Domains contained within Fbxw4 are indicated. doi:10.1371/journal.pone.0063610.g001

Journal: PloS one

Article Title: The novel ubiquitin ligase complex, SCF(Fbxw4), interacts with the COP9 signalosome in an F-box dependent manner, is mutated, lost and under-expressed in human cancers.

doi: 10.1371/journal.pone.0063610

Figure Lengend Snippet: Figure 1. The Fbxw4 locus is a common site of proviral insertion and is highly expressed in the murine mammary gland during involution. A. Examination of the UCSC genome browser (genome.ucsc.edu) and the Retroviral Tagged Cancer Gene Database (http://variation.osu. edu/rtcgd/index.html) shows that multiple retroviral insertions have been cloned from within the transcribed Fbxw4 locus. Arrows indicate the directionality of the inserted provirus. The exons are indicated at the bottom and the position and scale of murine chromosome 19 is shown on top. Names given to the cloned proviral insertions are indicated on the left. Insertion sites beginning with ‘mmt’ were cloned from mouse mammary tumor virus induced mammary carcinomas. Insertion sites beginning with ‘Dkm’, ‘248’ and ‘B5’ were cloned from leukemias from murine leukemia virus accelerated hematopoietic cancers. B. FBXW4 is variably expressed in normal murine tissues. Oligos specific for murine Fbxw4 were used to perform quantitative rt-PCR on the ‘mouse normal cDNA TissueScan array’. Values were normalized to quantitative rt-PCR for GAPDH. C. Schematic of the Fbxw4 protein. Numbers represent the amino acids of the protein. Domains contained within Fbxw4 are indicated. doi:10.1371/journal.pone.0063610.g001

Article Snippet: Fbxw4 was amplified from the origene clone with Vent DNA polymerase with the following oligos: mus Fbxw4 atg RI, 59- GCGCGAATTCACCATGGCGGAGGACGCGGCGGAGGATG-39; mus Fbxw4 flag stop xhoI, 59- GCGCCTCGAGTTACTTATCGTCGTCATCCTTATAATCCATTGGGTTCTGAAAGTCTAAG-39.

Techniques: Retroviral, Clone Assay, Virus, Quantitative RT-PCR

Figure 2. Fbxw4 interacts with components of an E3 ubiquitin ligase complex and the COP9 signalosome. A. Table representing the number of unique peptides identified from one representative mass spectrometry experiment following FLAG immunoprecipitation from lysates of control cells expressing FLAG only ‘‘contr.’’, or cells expressing FLAG-Fbxw4 or FLAG-Fbxo46. Column on left indicates the size of the interacting protein, in kilo-daltons (kDa). Gene names of proteins that contain the identified peptides are shown in the right column. Components of an E3 ubiquitin ligase complex are shaded in light gray; components of the COP9 signalosome are shaded dark gray. B. Validation of data mass spectrometry data by immunoprecipitation followed by western blot. 293 T cells were transfected with plasmids containing FLAG- Fbxw4, FLAG- Fbxo46 or an empty vector (v). 48 hours post-transfection cell lysates were prepared and immunoprecipitations were performed with mono-clonal anti-FLAG antibodies (M2) (to immunoprecipitate Fbxw4- or Fbxo46-interacting complexes). Western blots were performed to detect Fbxw4 or Fbxo46 (FLAG rb; polyclonal FLAG antibody; top panel), SKP1, COPS5, or COPS2. C. Expression of Fbxw4 alters the migration of endogenous SKP1 by gel filtration chromatography. 293 T cells were transfected with an empty vector (left panels) or a cplasmid containing FLAG-Fbxw4 (right panels). 48 hours post-transfection cell lysates were prepared and separated on a superpose6 gel filtration column. Western blots were performed on every other fraction to detect Fbxw4 (top panels) or SKP1 (bottom panels). In the absence of Fbxw4 SKP1 elutes with a peak at fraction 23, whereas when Fbxw4 is expressed there is co-elution of Fbxw4 with peaks at fraction 15 and in the void volume. Size standards that elute from given fractions are shown. doi:10.1371/journal.pone.0063610.g002

Journal: PloS one

Article Title: The novel ubiquitin ligase complex, SCF(Fbxw4), interacts with the COP9 signalosome in an F-box dependent manner, is mutated, lost and under-expressed in human cancers.

doi: 10.1371/journal.pone.0063610

Figure Lengend Snippet: Figure 2. Fbxw4 interacts with components of an E3 ubiquitin ligase complex and the COP9 signalosome. A. Table representing the number of unique peptides identified from one representative mass spectrometry experiment following FLAG immunoprecipitation from lysates of control cells expressing FLAG only ‘‘contr.’’, or cells expressing FLAG-Fbxw4 or FLAG-Fbxo46. Column on left indicates the size of the interacting protein, in kilo-daltons (kDa). Gene names of proteins that contain the identified peptides are shown in the right column. Components of an E3 ubiquitin ligase complex are shaded in light gray; components of the COP9 signalosome are shaded dark gray. B. Validation of data mass spectrometry data by immunoprecipitation followed by western blot. 293 T cells were transfected with plasmids containing FLAG- Fbxw4, FLAG- Fbxo46 or an empty vector (v). 48 hours post-transfection cell lysates were prepared and immunoprecipitations were performed with mono-clonal anti-FLAG antibodies (M2) (to immunoprecipitate Fbxw4- or Fbxo46-interacting complexes). Western blots were performed to detect Fbxw4 or Fbxo46 (FLAG rb; polyclonal FLAG antibody; top panel), SKP1, COPS5, or COPS2. C. Expression of Fbxw4 alters the migration of endogenous SKP1 by gel filtration chromatography. 293 T cells were transfected with an empty vector (left panels) or a cplasmid containing FLAG-Fbxw4 (right panels). 48 hours post-transfection cell lysates were prepared and separated on a superpose6 gel filtration column. Western blots were performed on every other fraction to detect Fbxw4 (top panels) or SKP1 (bottom panels). In the absence of Fbxw4 SKP1 elutes with a peak at fraction 23, whereas when Fbxw4 is expressed there is co-elution of Fbxw4 with peaks at fraction 15 and in the void volume. Size standards that elute from given fractions are shown. doi:10.1371/journal.pone.0063610.g002

Article Snippet: Fbxw4 was amplified from the origene clone with Vent DNA polymerase with the following oligos: mus Fbxw4 atg RI, 59- GCGCGAATTCACCATGGCGGAGGACGCGGCGGAGGATG-39; mus Fbxw4 flag stop xhoI, 59- GCGCCTCGAGTTACTTATCGTCGTCATCCTTATAATCCATTGGGTTCTGAAAGTCTAAG-39.

Techniques: Ubiquitin Proteomics, Mass Spectrometry, Immunoprecipitation, Control, Expressing, Biomarker Discovery, Western Blot, Transfection, Plasmid Preparation, Migration, Filtration, Chromatography, Co-Elution Assay

Figure 3. Fbxw4 interacts with E3 ubiquitin ligase components and with the COP9 signalosome in an F-box dependent manner. A. Schematic of the Fbxw42fbox protein. Numbers represent the amino acids of the protein. Domains contained within Fbxw42fbox are indicated. B. Table representing the number of unique peptides identified from one representative mass spectrometry experiment following FLAG immunoprecipitation from lysates of control cells expressing FLAG only ‘‘contr.’’, or cells expressing FLAG- Fbxw4 or FLAG- Fbxw42fbox. Column on left indicates the size of the interacting protein, in kilo-daltons (kDa). Gene names of proteins that contain the identified peptides are shown in the right column. Components of an E3 ubiquitin ligase complex are shaded in light gray; components of the COP9 signalosome are shaded dark gray. C. Validation of data mass spectrometry data by immunoprecipitation followed by western blot. 293 T cells were transfected with plasmids containing FLAG-Fbxw4, FLAG-Fbxw42fbox, FLAG-Fbxo46 or an empty vector (v). 48 hours post-transfection cell lysates were prepared and immunoprecip- itations were performed with mono-clonal anti-FLAG antibodies (M2) (to immunoprecipitate Fbxw4-, Fbxw42fbox-, or Fbxo46-interacting complexes). Western blots were performed to detect Fbxw4, Fbxw42fbox or Fbxo46 (FLAG rb; polyclonal FLAG antibody; top panel) or SKP1. doi:10.1371/journal.pone.0063610.g003

Journal: PloS one

Article Title: The novel ubiquitin ligase complex, SCF(Fbxw4), interacts with the COP9 signalosome in an F-box dependent manner, is mutated, lost and under-expressed in human cancers.

doi: 10.1371/journal.pone.0063610

Figure Lengend Snippet: Figure 3. Fbxw4 interacts with E3 ubiquitin ligase components and with the COP9 signalosome in an F-box dependent manner. A. Schematic of the Fbxw42fbox protein. Numbers represent the amino acids of the protein. Domains contained within Fbxw42fbox are indicated. B. Table representing the number of unique peptides identified from one representative mass spectrometry experiment following FLAG immunoprecipitation from lysates of control cells expressing FLAG only ‘‘contr.’’, or cells expressing FLAG- Fbxw4 or FLAG- Fbxw42fbox. Column on left indicates the size of the interacting protein, in kilo-daltons (kDa). Gene names of proteins that contain the identified peptides are shown in the right column. Components of an E3 ubiquitin ligase complex are shaded in light gray; components of the COP9 signalosome are shaded dark gray. C. Validation of data mass spectrometry data by immunoprecipitation followed by western blot. 293 T cells were transfected with plasmids containing FLAG-Fbxw4, FLAG-Fbxw42fbox, FLAG-Fbxo46 or an empty vector (v). 48 hours post-transfection cell lysates were prepared and immunoprecip- itations were performed with mono-clonal anti-FLAG antibodies (M2) (to immunoprecipitate Fbxw4-, Fbxw42fbox-, or Fbxo46-interacting complexes). Western blots were performed to detect Fbxw4, Fbxw42fbox or Fbxo46 (FLAG rb; polyclonal FLAG antibody; top panel) or SKP1. doi:10.1371/journal.pone.0063610.g003

Article Snippet: Fbxw4 was amplified from the origene clone with Vent DNA polymerase with the following oligos: mus Fbxw4 atg RI, 59- GCGCGAATTCACCATGGCGGAGGACGCGGCGGAGGATG-39; mus Fbxw4 flag stop xhoI, 59- GCGCCTCGAGTTACTTATCGTCGTCATCCTTATAATCCATTGGGTTCTGAAAGTCTAAG-39.

Techniques: Ubiquitin Proteomics, Mass Spectrometry, Immunoprecipitation, Control, Expressing, Biomarker Discovery, Western Blot, Transfection, Plasmid Preparation

Figure 4. FBXW4 associates with ubiquitinated cellular proteins. A. Fbxw4 can be immunoprecipitated by ubiquitinated proteins and Fbxw4 can immunoprecipitate ubiquitinated proteins. 293 T cells were transfected with empty vector (v), HA-Ubiquitin, or HA-Ubiquitin and FLAG-Fbxw4. 36 hours post-transfection cells were treated with MG132 (+) or left untreated (2) for six hours. Cell lysates were prepared and immunoprecipitations were performed with either anti-HA antibodies (top two panels) or mono-clonal anti-FLAG antibodies (M2) (bottom two panels). Western blots were performed on both sets of immunoprecipitations with anti-FLAG and anti-HA antibodies. B. FBXW4 associates with cellular proteins that are endogenously ubiquitinated. 293 T cells were transfected with plasmids containing FLAG-Fbxw4, FLAG- Fbxw42fbox, FLAG-Fbxo46 or an empty vector (v). 36 hours post-transfection cells were treated with MG132 (+) or left untreated (2) for six hours. Cell lysates were prepared and immunoprecipitations were performed with mono-clonal anti-FLAG antibodies (M2) (to immunoprecipitate Fbxw4-, Fbxw42fbox-, or FBXO46- interacting complexes). Western blots were performed to detect Fbxw4, Fbxw42fbox or Fbxo46 (FLAG rb; polyclonal FLAG antibody; top panel) or Ubiquitin. doi:10.1371/journal.pone.0063610.g004

Journal: PloS one

Article Title: The novel ubiquitin ligase complex, SCF(Fbxw4), interacts with the COP9 signalosome in an F-box dependent manner, is mutated, lost and under-expressed in human cancers.

doi: 10.1371/journal.pone.0063610

Figure Lengend Snippet: Figure 4. FBXW4 associates with ubiquitinated cellular proteins. A. Fbxw4 can be immunoprecipitated by ubiquitinated proteins and Fbxw4 can immunoprecipitate ubiquitinated proteins. 293 T cells were transfected with empty vector (v), HA-Ubiquitin, or HA-Ubiquitin and FLAG-Fbxw4. 36 hours post-transfection cells were treated with MG132 (+) or left untreated (2) for six hours. Cell lysates were prepared and immunoprecipitations were performed with either anti-HA antibodies (top two panels) or mono-clonal anti-FLAG antibodies (M2) (bottom two panels). Western blots were performed on both sets of immunoprecipitations with anti-FLAG and anti-HA antibodies. B. FBXW4 associates with cellular proteins that are endogenously ubiquitinated. 293 T cells were transfected with plasmids containing FLAG-Fbxw4, FLAG- Fbxw42fbox, FLAG-Fbxo46 or an empty vector (v). 36 hours post-transfection cells were treated with MG132 (+) or left untreated (2) for six hours. Cell lysates were prepared and immunoprecipitations were performed with mono-clonal anti-FLAG antibodies (M2) (to immunoprecipitate Fbxw4-, Fbxw42fbox-, or FBXO46- interacting complexes). Western blots were performed to detect Fbxw4, Fbxw42fbox or Fbxo46 (FLAG rb; polyclonal FLAG antibody; top panel) or Ubiquitin. doi:10.1371/journal.pone.0063610.g004

Article Snippet: Fbxw4 was amplified from the origene clone with Vent DNA polymerase with the following oligos: mus Fbxw4 atg RI, 59- GCGCGAATTCACCATGGCGGAGGACGCGGCGGAGGATG-39; mus Fbxw4 flag stop xhoI, 59- GCGCCTCGAGTTACTTATCGTCGTCATCCTTATAATCCATTGGGTTCTGAAAGTCTAAG-39.

Techniques: Immunoprecipitation, Transfection, Plasmid Preparation, Ubiquitin Proteomics, Western Blot

Figure 5. FBXW4 is mutated, lost and under-expressed in human cancers and associated with poor survival in lung adenocarcinoma. A. FBXW4 is somatically mutated in human cancers. The Cancer Genome Atlas (TCGA) project and the Catalogue of Somatic Mutations in Cancer (COSMIC) from the Sanger Institute were queried for somatic mutations in FBXW4. Of ,470 tumors that were analyzed for mutation in FBXW4, five somatic mutations were observed at the amino acids indicated on the schematic. Interestingly, the four single amino acids that are targets of mutations (R96, G106, R145 and R367) are evolutionarily conserved in Drosophila. R96L, G106W and R367C are predicted to disrupt protein function (significance p = ,.0003, using ProPhylER algorithm) and the E245fs* mutation produces a protein that lacks the last two and a half WD-49 motifs. B. FBXW4 is frequently lost in human cancers. The frequency of DNA copy number loss/deletion across 719 human cancer cell lines representing diverse tissues of origin from the Sanger Institutes Cancer Genome Project are presented along with the frequency in the individual cancer types with n $ 5. C. FBXW4 is underexpressed in cancer cell lines with copy number loss. Box plots illustrating the mRNA expression levels for cell lines with loss/deletion and those without loss/deletion for all cancer cell lines from B. with corresponding gene expression microarray profiles are presented along with expression in the four individual cancer types with the highest frequency of loss/deletion (skin, breast, central nervous system (CNS) and lung cancer). Expression levels were compared between the two groups using the Mann-Whitney U-test and a p,0.01 was considered significant. Whiskers represent the 10–90 percentiles with dots displaying the outliers. D. FBXW4 is lost and under-expressed in clinical lung adenocarcinoma tumors from TCGA project. The expression of FBXW4 (RNA-seq RPKM values) is plotted for tumors with loss/deletion vs those without loss/deletion (left panel) as well as tumors and normal lung cancer tissue (right panel). Expression levels were compared between the groups and presented as in C. with a p,0.01 considered significant. E. Low FBXW4 expression is associated with poor survival in lung adenocarcinoma patients. Lung adenocarcinoma patients from the Directors Challenge dataset were stratified into tertiles based on their FBXW4 expression levels and the survival times between the bottom and top tertiles were compared using the Log-rank (Mantel-Cox) Test. doi:10.1371/journal.pone.0063610.g005

Journal: PloS one

Article Title: The novel ubiquitin ligase complex, SCF(Fbxw4), interacts with the COP9 signalosome in an F-box dependent manner, is mutated, lost and under-expressed in human cancers.

doi: 10.1371/journal.pone.0063610

Figure Lengend Snippet: Figure 5. FBXW4 is mutated, lost and under-expressed in human cancers and associated with poor survival in lung adenocarcinoma. A. FBXW4 is somatically mutated in human cancers. The Cancer Genome Atlas (TCGA) project and the Catalogue of Somatic Mutations in Cancer (COSMIC) from the Sanger Institute were queried for somatic mutations in FBXW4. Of ,470 tumors that were analyzed for mutation in FBXW4, five somatic mutations were observed at the amino acids indicated on the schematic. Interestingly, the four single amino acids that are targets of mutations (R96, G106, R145 and R367) are evolutionarily conserved in Drosophila. R96L, G106W and R367C are predicted to disrupt protein function (significance p = ,.0003, using ProPhylER algorithm) and the E245fs* mutation produces a protein that lacks the last two and a half WD-49 motifs. B. FBXW4 is frequently lost in human cancers. The frequency of DNA copy number loss/deletion across 719 human cancer cell lines representing diverse tissues of origin from the Sanger Institutes Cancer Genome Project are presented along with the frequency in the individual cancer types with n $ 5. C. FBXW4 is underexpressed in cancer cell lines with copy number loss. Box plots illustrating the mRNA expression levels for cell lines with loss/deletion and those without loss/deletion for all cancer cell lines from B. with corresponding gene expression microarray profiles are presented along with expression in the four individual cancer types with the highest frequency of loss/deletion (skin, breast, central nervous system (CNS) and lung cancer). Expression levels were compared between the two groups using the Mann-Whitney U-test and a p,0.01 was considered significant. Whiskers represent the 10–90 percentiles with dots displaying the outliers. D. FBXW4 is lost and under-expressed in clinical lung adenocarcinoma tumors from TCGA project. The expression of FBXW4 (RNA-seq RPKM values) is plotted for tumors with loss/deletion vs those without loss/deletion (left panel) as well as tumors and normal lung cancer tissue (right panel). Expression levels were compared between the groups and presented as in C. with a p,0.01 considered significant. E. Low FBXW4 expression is associated with poor survival in lung adenocarcinoma patients. Lung adenocarcinoma patients from the Directors Challenge dataset were stratified into tertiles based on their FBXW4 expression levels and the survival times between the bottom and top tertiles were compared using the Log-rank (Mantel-Cox) Test. doi:10.1371/journal.pone.0063610.g005

Article Snippet: Fbxw4 was amplified from the origene clone with Vent DNA polymerase with the following oligos: mus Fbxw4 atg RI, 59- GCGCGAATTCACCATGGCGGAGGACGCGGCGGAGGATG-39; mus Fbxw4 flag stop xhoI, 59- GCGCCTCGAGTTACTTATCGTCGTCATCCTTATAATCCATTGGGTTCTGAAAGTCTAAG-39.

Techniques: Mutagenesis, Expressing, Gene Expression, Microarray, MANN-WHITNEY, RNA Sequencing