|
Proteintech
anti cul4a Anti Cul4a, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cul4a/bio_rxiv__64898__2026__03__24__713854-239-94-99?v=Proteintech Average 93 stars, based on 1 article reviews
anti cul4a - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Rockland Immunochemicals
rabbit anti cul4a antiserum Rabbit Anti Cul4a Antiserum, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cul4a/pmc01895787-94-1-5?v=Rockland+Immunochemicals Average 92 stars, based on 1 article reviews
rabbit anti cul4a antiserum - by Bioz Stars,
2026-06
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pnl4 3 luc r e Pnl4 3 Luc R E, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cul4a/pm31778897-204-14-30?v=Addgene+inc Average 90 stars, based on 1 article reviews
pnl4 3 luc r e - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Bethyl
cullin 4a Cullin 4a, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cul4a/stotland_aleksandr_borisovich__2012__use_of_retroviral_peptide_libraries_for_the_identification_of_novel_cellular_targets_of_hiv-145-15-20?v=Bethyl Average 93 stars, based on 1 article reviews
cullin 4a - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
plasmid myc cullin4a addgene Plasmid Myc Cullin4a Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cul4a/pmc06955312__pnas__1909879116__sapp-103-36-38?v=Addgene+inc Average 93 stars, based on 1 article reviews
plasmid myc cullin4a addgene - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Boster Bio
anti cul4a Anti Cul4a, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cul4a/pmc12913832-225-38-45?v=Boster+Bio Average 94 stars, based on 1 article reviews
anti cul4a - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
|
R&D Systems
human 26s proteasome protein r d systems Human 26s Proteasome Protein R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cul4a/pm34384544-302-11-15?v=R%26D+Systems Average 92 stars, based on 1 article reviews
human 26s proteasome protein r d systems - by Bioz Stars,
2026-06
92/100 stars
|
Buy from Supplier |
|
R&D Systems
crbn ![]() Crbn, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cul4a/pm40244695-476-23-36?v=R%26D+Systems Average 93 stars, based on 1 article reviews
crbn - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Proteintech
anti cul4a antibody ![]() Anti Cul4a Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cul4a/us10106853-420-8-6?v=Proteintech Average 93 stars, based on 1 article reviews
anti cul4a antibody - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
OriGene
lentivirus vectors carrying cul4a ![]() Lentivirus Vectors Carrying Cul4a, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cul4a/pmc08262180-80-1-8?v=OriGene Average 90 stars, based on 1 article reviews
lentivirus vectors carrying cul4a - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
OriGene
cul4a ![]() Cul4a, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cul4a/pmc09012827-108-13-28?v=OriGene Average 90 stars, based on 1 article reviews
cul4a - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
si rna sequence aagaagauuaacacgugcugg ![]() Si Rna Sequence Aagaagauuaacacgugcugg, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cul4a/pmc06102737-40-4-10?v=Santa+Cruz+Biotechnology Average 93 stars, based on 1 article reviews
si rna sequence aagaagauuaacacgugcugg - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Journal of medicinal chemistry
Article Title: Structure-Guided Design of ISOX-DUAL-Based Degraders Targeting BRD4 and CBP/EP300: A Case of Degrader Collapse.
doi: 10.1021/acs.jmedchem.5c00395
Figure Lengend Snippet: Figure 3. In vitro ubiquitination assays for CRBN-recruiting degraders 34−36 with BRD4 (left panel) and CBP (right panel). FLAG-BRD4 and GST- CREBBP were detected using capillary electrophoresis (Simple Western, Wes) and anti-FLAG and anti-GST antibodies.
Article Snippet: 50 μL in vitro reactions included the following components and concentrations: UBE1 (E-304−050, R&D Systems), 100 nM; UBE2D1 (E2−616, R&D Systems), 1 μM;
Techniques: In Vitro, Ubiquitin Proteomics, Electrophoresis, Simple Western
Journal: Pathology and Oncology Research
Article Title: Autophagy Plays a Role in the CUL4A-Related Poor Prognosis of Intrahepatic Cholangiocarcinoma
doi: 10.3389/pore.2021.602714
Figure Lengend Snippet: Clinicopathological characteristics and association with autophagy of patients with intrahepatic cholangiocarcinoma.
Article Snippet: The
Techniques: Over Expression
Journal: Pathology and Oncology Research
Article Title: Autophagy Plays a Role in the CUL4A-Related Poor Prognosis of Intrahepatic Cholangiocarcinoma
doi: 10.3389/pore.2021.602714
Figure Lengend Snippet: Comparisons of autophagic flux between iCCA cells with or without CUL4A overexpression. Cells with CUL4A overexpression showed a much greater accumulation of LC3II in CUL4A overexpression cells after bafilomycin A1 treatment. (A) The iCCA cells were treated with the presence or absence of 100 nm bafilomycin A1 and examined LC3 expression in the course of the indicated time point. The levels of LC3II expression are examined by Immunoblotting followed by quantitative analysis using Image J . Data are normalized to GAPDH level. (B) Values indicative of autophagic flux are quantitatively determined by expression difference of LC3II amount between cells treated with DMSO and cells treated with bafilomycin A1. The scale represents ratio of LC3II following bafilomycin A1 treatment/untreated. Data represent means ± standard deviation from three independent experiments. **, p < 0.01.
Article Snippet: The
Techniques: Over Expression, Expressing, Western Blot, Standard Deviation
Journal: Cell Death & Disease
Article Title: Targeted CUL4A inhibition synergizes with cisplatin to yield long-term survival in models of head and neck squamous cell carcinoma through a DDB2-mediated mechanism
doi: 10.1038/s41419-022-04798-6
Figure Lengend Snippet: A Lentiviral shRNA knockdown of CUL4A decreases DDB2 expression. FaDu cells were transfected with lentiviral shRNA particles targeting CUL4A, CUL4B or a scramble control. The levels of CUL4A, CUL4B, and DDB2 were determined by immunoblotting. B Knockdown of CUL4A leads to increased γH2AX expression. FaDu cells were transfected with lentiviral shRNA targeting CUL4A, CUL4B, or a scramble control. Cells were then treated with 3 μM cisplatin for 24 h. γH2AX levels were determined and quantified by ImageJ software. DAPI was used as a counterstain. Representative images are shown. Mean signal intensity ±SEM, n = 20 cells per condition. **Indicates a significant difference from other treated groups, p < 0.01. C FaDu cells were transfected with lentiviral particles containing a functional CUL4A expression vector. Overexpression of CUL4A was confirmed by immunoblotting following puromycin selection. D Overexpression of CUL4A decreases cisplatin-mediated DNA damage. FaDu cells transfected with CUL4A overexpression and control plasmid were incubated with 5 μM cisplatin for 24 h. γH2AX expression was observed and quantified using ImageJ software. DAPI was used as a nuclear counterstain. Representative images are shown. Mean signal intensity ±SEM, n = 66 cells per condition. Scale bar = 20 μm. **Indicates a significant difference between samples, p < 0.01.
Article Snippet: FaDu cells were infected with lentiviral particles containing a puromycin resistance gene, a
Techniques: shRNA, Knockdown, Expressing, Transfection, Control, Western Blot, Software, Functional Assay, Plasmid Preparation, Over Expression, Selection, Incubation