ctip Search Results


91
Novus Biologicals anti ctip
Anti Ctip, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti ctip/product/Novus Biologicals
Average 91 stars, based on 1 article reviews
anti ctip - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology ctip
Ctip, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ctip/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
ctip - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

ctip  (Bethyl)
93
Bethyl ctip
Figure 7. HELQ functions in parallel to <t>CtIP</t> to preserve fork integrity. ( A ) Fork degradation assays were performed in HELQ KO #1 cells expressing the indicated shRNAs. ( B ) HU (2 mM, 4 h) <t>induced</t> <t>RPA2</t> phosphorylation assa y s w ere perf ormed in wild type (WT) and HELQ KO #1 cells expressing shCtIP or vector (Ctrl). ( C ) HCT116 cells (WT) and HCT116 CtIP KO cells (CtIP KO) expressing shHELQ or vector (Ctrl) were treated with 2 mM HU for 4 h and subjected to metaphase spread assay. The chromosomal aberrations per chromosome spread are plotted. ( D ) The HU (2 mM, 4 h) induced RAD51-nascent DNA (EdU) interaction w as analyz ed b y PLA in U2OS cells (WT) and HELQ KO #1 cells expressing shCtIP or v ector (Ctrl). R epresentativ e images and quantification of the a v erage number of PLA foci per nucleus are shown. Scale bar = 5 μm. ( E ) WT and HELQ KO #1 cells expressing shCtIP or vector (Ctrl) were treated with the indicated concentration of HU for 48 h, then a cell viability assay was performed. ( F ) The viability of WT and HELQ KO #1 cells expressing shCtIP or vector (Ctrl) was analyzed by colony formation assay. Representative images (left) and quantifications of the relative survival (right) relative to vector (Ctrl) infected wild type U2OS cells (WT), which was arbitrarily set to 100%, are shown. In panels A, C, D, E and F, the data represent the means ± SD from at least three independent experiments. * P < 0.05, *** P < 0.001, **** P < 0.0001, n.s.: not significant. Mann–Whitney test was used in A, C and D; Student’s t -test was used in E and F.
Ctip, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ctip/product/Bethyl
Average 93 stars, based on 1 article reviews
ctip - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Addgene inc attacaaataagagaagaaaatgctg reverse
Figure 7. HELQ functions in parallel to <t>CtIP</t> to preserve fork integrity. ( A ) Fork degradation assays were performed in HELQ KO #1 cells expressing the indicated shRNAs. ( B ) HU (2 mM, 4 h) <t>induced</t> <t>RPA2</t> phosphorylation assa y s w ere perf ormed in wild type (WT) and HELQ KO #1 cells expressing shCtIP or vector (Ctrl). ( C ) HCT116 cells (WT) and HCT116 CtIP KO cells (CtIP KO) expressing shHELQ or vector (Ctrl) were treated with 2 mM HU for 4 h and subjected to metaphase spread assay. The chromosomal aberrations per chromosome spread are plotted. ( D ) The HU (2 mM, 4 h) induced RAD51-nascent DNA (EdU) interaction w as analyz ed b y PLA in U2OS cells (WT) and HELQ KO #1 cells expressing shCtIP or v ector (Ctrl). R epresentativ e images and quantification of the a v erage number of PLA foci per nucleus are shown. Scale bar = 5 μm. ( E ) WT and HELQ KO #1 cells expressing shCtIP or vector (Ctrl) were treated with the indicated concentration of HU for 48 h, then a cell viability assay was performed. ( F ) The viability of WT and HELQ KO #1 cells expressing shCtIP or vector (Ctrl) was analyzed by colony formation assay. Representative images (left) and quantifications of the relative survival (right) relative to vector (Ctrl) infected wild type U2OS cells (WT), which was arbitrarily set to 100%, are shown. In panels A, C, D, E and F, the data represent the means ± SD from at least three independent experiments. * P < 0.05, *** P < 0.001, **** P < 0.0001, n.s.: not significant. Mann–Whitney test was used in A, C and D; Student’s t -test was used in E and F.
Attacaaataagagaagaaaatgctg Reverse, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/attacaaataagagaagaaaatgctg reverse/product/Addgene inc
Average 90 stars, based on 1 article reviews
attacaaataagagaagaaaatgctg reverse - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Proteintech 1 ap
Figure 7. HELQ functions in parallel to <t>CtIP</t> to preserve fork integrity. ( A ) Fork degradation assays were performed in HELQ KO #1 cells expressing the indicated shRNAs. ( B ) HU (2 mM, 4 h) <t>induced</t> <t>RPA2</t> phosphorylation assa y s w ere perf ormed in wild type (WT) and HELQ KO #1 cells expressing shCtIP or vector (Ctrl). ( C ) HCT116 cells (WT) and HCT116 CtIP KO cells (CtIP KO) expressing shHELQ or vector (Ctrl) were treated with 2 mM HU for 4 h and subjected to metaphase spread assay. The chromosomal aberrations per chromosome spread are plotted. ( D ) The HU (2 mM, 4 h) induced RAD51-nascent DNA (EdU) interaction w as analyz ed b y PLA in U2OS cells (WT) and HELQ KO #1 cells expressing shCtIP or v ector (Ctrl). R epresentativ e images and quantification of the a v erage number of PLA foci per nucleus are shown. Scale bar = 5 μm. ( E ) WT and HELQ KO #1 cells expressing shCtIP or vector (Ctrl) were treated with the indicated concentration of HU for 48 h, then a cell viability assay was performed. ( F ) The viability of WT and HELQ KO #1 cells expressing shCtIP or vector (Ctrl) was analyzed by colony formation assay. Representative images (left) and quantifications of the relative survival (right) relative to vector (Ctrl) infected wild type U2OS cells (WT), which was arbitrarily set to 100%, are shown. In panels A, C, D, E and F, the data represent the means ± SD from at least three independent experiments. * P < 0.05, *** P < 0.001, **** P < 0.0001, n.s.: not significant. Mann–Whitney test was used in A, C and D; Student’s t -test was used in E and F.
1 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1 ap/product/Proteintech
Average 93 stars, based on 1 article reviews
1 ap - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Addgene inc manuel serrano n a
Figure 7. HELQ functions in parallel to <t>CtIP</t> to preserve fork integrity. ( A ) Fork degradation assays were performed in HELQ KO #1 cells expressing the indicated shRNAs. ( B ) HU (2 mM, 4 h) <t>induced</t> <t>RPA2</t> phosphorylation assa y s w ere perf ormed in wild type (WT) and HELQ KO #1 cells expressing shCtIP or vector (Ctrl). ( C ) HCT116 cells (WT) and HCT116 CtIP KO cells (CtIP KO) expressing shHELQ or vector (Ctrl) were treated with 2 mM HU for 4 h and subjected to metaphase spread assay. The chromosomal aberrations per chromosome spread are plotted. ( D ) The HU (2 mM, 4 h) induced RAD51-nascent DNA (EdU) interaction w as analyz ed b y PLA in U2OS cells (WT) and HELQ KO #1 cells expressing shCtIP or v ector (Ctrl). R epresentativ e images and quantification of the a v erage number of PLA foci per nucleus are shown. Scale bar = 5 μm. ( E ) WT and HELQ KO #1 cells expressing shCtIP or vector (Ctrl) were treated with the indicated concentration of HU for 48 h, then a cell viability assay was performed. ( F ) The viability of WT and HELQ KO #1 cells expressing shCtIP or vector (Ctrl) was analyzed by colony formation assay. Representative images (left) and quantifications of the relative survival (right) relative to vector (Ctrl) infected wild type U2OS cells (WT), which was arbitrarily set to 100%, are shown. In panels A, C, D, E and F, the data represent the means ± SD from at least three independent experiments. * P < 0.05, *** P < 0.001, **** P < 0.0001, n.s.: not significant. Mann–Whitney test was used in A, C and D; Student’s t -test was used in E and F.
Manuel Serrano N A, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/manuel serrano n a/product/Addgene inc
Average 90 stars, based on 1 article reviews
manuel serrano n a - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

91
Addgene inc pcdna3 n flag nlrp3 711 1034
a, Co-immunoprecipitation (IP) of <t>NLRP3</t> and DDX3X in BMDMs treated with LPS with or without nigericin. Representative blots (n= 3). b, Immunoblot analysis of CASP1 cleavage in wild-type (WT), Ddx3xfl/fl, Ddx3xfl/flLysMcre and Nlrp3−/− BMDMs treated with LPS and nigericin. Representative blots (n > 3). c, Immunoblots of DDX3X expression and CASP1 cleavage after siRNA-mediated knockdown of Ddx3x in BMDMs treated with LPS with or without nigericin. Representative blots (n = 2). d, Confocal microscopy imaging of ASC specks in BMDMs treated with LPS with or without nigericin, to visualize the subcellular localization of DDX3X, NLRP3 and ASC. Scale bars, 10 μm. Representative images (n = 3). e, Schematic of N-terminal Flag-tagged NLRP3 expression constructs: full-length NLRP3 (Flag-NLRP3-FL), the pyrin domain of NLRP3 (Flag-PYD; amino acids 1–90 of NLRP3), the NACHT domain of NLRP3 (Flag-NACHT; amino acids 91–710 of NLRP3) and the LRR domain of NLRP3 (Flag-LRR; amino acids 711–1034 of NLRP3). f, Immunoblot (IB) analysis of input lysates used for co-immunoprecipitation of Flag-tagged NLRP3 constructs and DDX3X-mCherry. Representative blots (n > 3). g, Immunoblot analysis of immunoprecipitation of DDX3X-mCherry and the indicated NLRP3 constructs. Red asterisk indicates the antibody light chain. Representative blots (n > 3).
Pcdna3 N Flag Nlrp3 711 1034, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcdna3 n flag nlrp3 711 1034/product/Addgene inc
Average 91 stars, based on 1 article reviews
pcdna3 n flag nlrp3 711 1034 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

88
Atlas Antibodies primary anti rbbp8 antibody
<t>RBBP8</t> promoter methylation in bladder cancer of the TCGA data set. a Visualization of the promoter methylation of the RBBP8 gene as a scatterplot. The β values for each sample were jittered around the probe location and plotted as points. The per sample type 90% quantiles of methylation are shown as smoothed lines. The colors represent different sample groups (BLCA, bladder cancer; HNSC, head-neck squamous cell carcinoma). b The Pearson correlation coefficients ( ρ ) for probe pairs in the core region of the promoter are shown as heatmap demonstrating a high degree of correlation between probes ( ρ > 0.7). c The beta values of all probes of the promoter region were summarized by their median value, stratified by the sample as well as tissue type, and visualized as a box plot. For RBBP8 gene loci, a frequent hypermethylation ( β > 0.25 in > 5% of cases) was only observable in 37, 10, and 7% of bladder urothelial carcinoma (BLCA), head-neck squamous cell carcinoma (HNSC), and lung squamous cell carcinoma (LUSC), respectively. d Inverse correlation between RBBP8 methylation (defined CpG gene set) and RBBP8 mRNA expression in primary bladder cancer (BLCA), neck squamous cell carcinoma (HNSC), and lung squamous carcinoma (LUSC) samples of the TCGA data portal. Spearman correlation BLCA: − 0.32, p < 0.001; Spearman correlation HNSC: − 0.04, p = ns; Spearman correlation LUSC: 0.08, p = ns. e Box plot illustrates significant downregulation of RBBP8 methylation in primary tumors featuring increased RBBP8 promoter methylation ( β value > 0.4). Horizontal lines — grouped medians. Boxes — 25 to 75% quartiles. Vertical lines — range, peak, and minimum. * p < 0.05, ** p < 0.01, ns: not significant. f Box plot shows RBBP8 methylation in primary tumors classified by intrinsic subtypes. g Kaplan-Meier survival curves display overall survival (OS) of patients with high RBBP8 methylation ( β value > 0.4, dark gray curve) compared to low RBBP8 methylation ( β value ≤ 0.4, gray curve) based on TCGA datasets
Primary Anti Rbbp8 Antibody, supplied by Atlas Antibodies, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primary anti rbbp8 antibody/product/Atlas Antibodies
Average 88 stars, based on 1 article reviews
primary anti rbbp8 antibody - by Bioz Stars, 2026-03
88/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc ctip
<t>RBBP8</t> promoter methylation in bladder cancer of the TCGA data set. a Visualization of the promoter methylation of the RBBP8 gene as a scatterplot. The β values for each sample were jittered around the probe location and plotted as points. The per sample type 90% quantiles of methylation are shown as smoothed lines. The colors represent different sample groups (BLCA, bladder cancer; HNSC, head-neck squamous cell carcinoma). b The Pearson correlation coefficients ( ρ ) for probe pairs in the core region of the promoter are shown as heatmap demonstrating a high degree of correlation between probes ( ρ > 0.7). c The beta values of all probes of the promoter region were summarized by their median value, stratified by the sample as well as tissue type, and visualized as a box plot. For RBBP8 gene loci, a frequent hypermethylation ( β > 0.25 in > 5% of cases) was only observable in 37, 10, and 7% of bladder urothelial carcinoma (BLCA), head-neck squamous cell carcinoma (HNSC), and lung squamous cell carcinoma (LUSC), respectively. d Inverse correlation between RBBP8 methylation (defined CpG gene set) and RBBP8 mRNA expression in primary bladder cancer (BLCA), neck squamous cell carcinoma (HNSC), and lung squamous carcinoma (LUSC) samples of the TCGA data portal. Spearman correlation BLCA: − 0.32, p < 0.001; Spearman correlation HNSC: − 0.04, p = ns; Spearman correlation LUSC: 0.08, p = ns. e Box plot illustrates significant downregulation of RBBP8 methylation in primary tumors featuring increased RBBP8 promoter methylation ( β value > 0.4). Horizontal lines — grouped medians. Boxes — 25 to 75% quartiles. Vertical lines — range, peak, and minimum. * p < 0.05, ** p < 0.01, ns: not significant. f Box plot shows RBBP8 methylation in primary tumors classified by intrinsic subtypes. g Kaplan-Meier survival curves display overall survival (OS) of patients with high RBBP8 methylation ( β value > 0.4, dark gray curve) compared to low RBBP8 methylation ( β value ≤ 0.4, gray curve) based on TCGA datasets
Ctip, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ctip/product/Cell Signaling Technology Inc
Average 95 stars, based on 1 article reviews
ctip - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

92
Addgene inc pice ha ctip sir sa
<t>RBBP8</t> promoter methylation in bladder cancer of the TCGA data set. a Visualization of the promoter methylation of the RBBP8 gene as a scatterplot. The β values for each sample were jittered around the probe location and plotted as points. The per sample type 90% quantiles of methylation are shown as smoothed lines. The colors represent different sample groups (BLCA, bladder cancer; HNSC, head-neck squamous cell carcinoma). b The Pearson correlation coefficients ( ρ ) for probe pairs in the core region of the promoter are shown as heatmap demonstrating a high degree of correlation between probes ( ρ > 0.7). c The beta values of all probes of the promoter region were summarized by their median value, stratified by the sample as well as tissue type, and visualized as a box plot. For RBBP8 gene loci, a frequent hypermethylation ( β > 0.25 in > 5% of cases) was only observable in 37, 10, and 7% of bladder urothelial carcinoma (BLCA), head-neck squamous cell carcinoma (HNSC), and lung squamous cell carcinoma (LUSC), respectively. d Inverse correlation between RBBP8 methylation (defined CpG gene set) and RBBP8 mRNA expression in primary bladder cancer (BLCA), neck squamous cell carcinoma (HNSC), and lung squamous carcinoma (LUSC) samples of the TCGA data portal. Spearman correlation BLCA: − 0.32, p < 0.001; Spearman correlation HNSC: − 0.04, p = ns; Spearman correlation LUSC: 0.08, p = ns. e Box plot illustrates significant downregulation of RBBP8 methylation in primary tumors featuring increased RBBP8 promoter methylation ( β value > 0.4). Horizontal lines — grouped medians. Boxes — 25 to 75% quartiles. Vertical lines — range, peak, and minimum. * p < 0.05, ** p < 0.01, ns: not significant. f Box plot shows RBBP8 methylation in primary tumors classified by intrinsic subtypes. g Kaplan-Meier survival curves display overall survival (OS) of patients with high RBBP8 methylation ( β value > 0.4, dark gray curve) compared to low RBBP8 methylation ( β value ≤ 0.4, gray curve) based on TCGA datasets
Pice Ha Ctip Sir Sa, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pice ha ctip sir sa/product/Addgene inc
Average 92 stars, based on 1 article reviews
pice ha ctip sir sa - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

91
Addgene inc doxycycline inducible pcw57 1 gfp ctip
<t>RBBP8</t> promoter methylation in bladder cancer of the TCGA data set. a Visualization of the promoter methylation of the RBBP8 gene as a scatterplot. The β values for each sample were jittered around the probe location and plotted as points. The per sample type 90% quantiles of methylation are shown as smoothed lines. The colors represent different sample groups (BLCA, bladder cancer; HNSC, head-neck squamous cell carcinoma). b The Pearson correlation coefficients ( ρ ) for probe pairs in the core region of the promoter are shown as heatmap demonstrating a high degree of correlation between probes ( ρ > 0.7). c The beta values of all probes of the promoter region were summarized by their median value, stratified by the sample as well as tissue type, and visualized as a box plot. For RBBP8 gene loci, a frequent hypermethylation ( β > 0.25 in > 5% of cases) was only observable in 37, 10, and 7% of bladder urothelial carcinoma (BLCA), head-neck squamous cell carcinoma (HNSC), and lung squamous cell carcinoma (LUSC), respectively. d Inverse correlation between RBBP8 methylation (defined CpG gene set) and RBBP8 mRNA expression in primary bladder cancer (BLCA), neck squamous cell carcinoma (HNSC), and lung squamous carcinoma (LUSC) samples of the TCGA data portal. Spearman correlation BLCA: − 0.32, p < 0.001; Spearman correlation HNSC: − 0.04, p = ns; Spearman correlation LUSC: 0.08, p = ns. e Box plot illustrates significant downregulation of RBBP8 methylation in primary tumors featuring increased RBBP8 promoter methylation ( β value > 0.4). Horizontal lines — grouped medians. Boxes — 25 to 75% quartiles. Vertical lines — range, peak, and minimum. * p < 0.05, ** p < 0.01, ns: not significant. f Box plot shows RBBP8 methylation in primary tumors classified by intrinsic subtypes. g Kaplan-Meier survival curves display overall survival (OS) of patients with high RBBP8 methylation ( β value > 0.4, dark gray curve) compared to low RBBP8 methylation ( β value ≤ 0.4, gray curve) based on TCGA datasets
Doxycycline Inducible Pcw57 1 Gfp Ctip, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/doxycycline inducible pcw57 1 gfp ctip/product/Addgene inc
Average 91 stars, based on 1 article reviews
doxycycline inducible pcw57 1 gfp ctip - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

90
Novus Biologicals recombinant ctip proteins
And-1 forms complexes with HR repair proteins and is required for HR repair. ( A ) Identification of <t>CtIP-associated</t> proteins that are involved in HR repair by mass spectrometry. ( B ) CtIP interacts with And-1. Co-immunoprecipitation (co-IP) assays were performed using U2OS cell lines. Cell lysates were immunoprecipitated with control IgG, anti-CtIP or anti-And-1 antibodies and the IPs were then resolved by SDS-PAGE and immunoblotted for the indicated proteins. Left panel, immunoprecipitation with anti-CtIP antibody. Right panel, immunoprecipitation with anti-And-1 antibody. ( C ) And-1 depletion impairs HR repair. U2OS-DR-GFP cells treated with the indicated siRNAs were transfected with pCBASce plasmids 48 h post siRNA transfection. The percentage of GFP-positive cells was determined by flow cytometry 48 h after plasmid transfection. The data were normalized to those obtained from cells transfected with control siGl2 (set as 1.0). Data represent means ± SD from three independent experiments. * P ≤ 0.05. ( D ) U2OS cell survival after exposing cells transfected with indicated siRNAs to the indicated doses of camptothecin. Data represent means ± SD from three independent experiments. * P ≤ 0.05; ** P ≤ 0.01.
Recombinant Ctip Proteins, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant ctip proteins/product/Novus Biologicals
Average 90 stars, based on 1 article reviews
recombinant ctip proteins - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Figure 7. HELQ functions in parallel to CtIP to preserve fork integrity. ( A ) Fork degradation assays were performed in HELQ KO #1 cells expressing the indicated shRNAs. ( B ) HU (2 mM, 4 h) induced RPA2 phosphorylation assa y s w ere perf ormed in wild type (WT) and HELQ KO #1 cells expressing shCtIP or vector (Ctrl). ( C ) HCT116 cells (WT) and HCT116 CtIP KO cells (CtIP KO) expressing shHELQ or vector (Ctrl) were treated with 2 mM HU for 4 h and subjected to metaphase spread assay. The chromosomal aberrations per chromosome spread are plotted. ( D ) The HU (2 mM, 4 h) induced RAD51-nascent DNA (EdU) interaction w as analyz ed b y PLA in U2OS cells (WT) and HELQ KO #1 cells expressing shCtIP or v ector (Ctrl). R epresentativ e images and quantification of the a v erage number of PLA foci per nucleus are shown. Scale bar = 5 μm. ( E ) WT and HELQ KO #1 cells expressing shCtIP or vector (Ctrl) were treated with the indicated concentration of HU for 48 h, then a cell viability assay was performed. ( F ) The viability of WT and HELQ KO #1 cells expressing shCtIP or vector (Ctrl) was analyzed by colony formation assay. Representative images (left) and quantifications of the relative survival (right) relative to vector (Ctrl) infected wild type U2OS cells (WT), which was arbitrarily set to 100%, are shown. In panels A, C, D, E and F, the data represent the means ± SD from at least three independent experiments. * P < 0.05, *** P < 0.001, **** P < 0.0001, n.s.: not significant. Mann–Whitney test was used in A, C and D; Student’s t -test was used in E and F.

Journal: Nucleic acids research

Article Title: Human HELQ regulates DNA end resection at DNA double-strand breaks and stalled replication forks.

doi: 10.1093/nar/gkad940

Figure Lengend Snippet: Figure 7. HELQ functions in parallel to CtIP to preserve fork integrity. ( A ) Fork degradation assays were performed in HELQ KO #1 cells expressing the indicated shRNAs. ( B ) HU (2 mM, 4 h) induced RPA2 phosphorylation assa y s w ere perf ormed in wild type (WT) and HELQ KO #1 cells expressing shCtIP or vector (Ctrl). ( C ) HCT116 cells (WT) and HCT116 CtIP KO cells (CtIP KO) expressing shHELQ or vector (Ctrl) were treated with 2 mM HU for 4 h and subjected to metaphase spread assay. The chromosomal aberrations per chromosome spread are plotted. ( D ) The HU (2 mM, 4 h) induced RAD51-nascent DNA (EdU) interaction w as analyz ed b y PLA in U2OS cells (WT) and HELQ KO #1 cells expressing shCtIP or v ector (Ctrl). R epresentativ e images and quantification of the a v erage number of PLA foci per nucleus are shown. Scale bar = 5 μm. ( E ) WT and HELQ KO #1 cells expressing shCtIP or vector (Ctrl) were treated with the indicated concentration of HU for 48 h, then a cell viability assay was performed. ( F ) The viability of WT and HELQ KO #1 cells expressing shCtIP or vector (Ctrl) was analyzed by colony formation assay. Representative images (left) and quantifications of the relative survival (right) relative to vector (Ctrl) infected wild type U2OS cells (WT), which was arbitrarily set to 100%, are shown. In panels A, C, D, E and F, the data represent the means ± SD from at least three independent experiments. * P < 0.05, *** P < 0.001, **** P < 0.0001, n.s.: not significant. Mann–Whitney test was used in A, C and D; Student’s t -test was used in E and F.

Article Snippet: Antibodies used in this study included the following: FLAG (F1804, Sigma-Aldrich), HELQ (PA5-65181, Sigma-Aldrich and 19436s, Cell Signaling Technology), Biotin (200-002-211, Jackson Immunoresearch and A150-109A, Bethyl), γH2AX (05–636, Millipore), CtIP (A300-488A, Bethyl), RPA2 S4 / 8p (A300-245A, Bethyl), RPA2 (A300-244A, Bethyl), BRCA1 (9010s, Cell Signaling Technology), BRCA2 (10741S, Cell Signaling Technology), MRE11 (ab208020, Abcam), RAD51 (ab133534, Abcam), BrdU (ab6326, Abcam and 347580, BD), MUS81(ab247136, Abcam), BLM (ab2179, Abcam), DNA2 (18727-1-AP , Proteintech), EXO1 (16253-1-AP , Proteintech), HLTF (Ab17984, Abcam), SMARCAL1 (sc-376377, Santa Cruze), ZRANB3 (A303-033A, Bethyl).

Techniques: Expressing, Phospho-proteomics, Plasmid Preparation, Concentration Assay, Viability Assay, Colony Assay, Infection, MANN-WHITNEY

a, Co-immunoprecipitation (IP) of NLRP3 and DDX3X in BMDMs treated with LPS with or without nigericin. Representative blots (n= 3). b, Immunoblot analysis of CASP1 cleavage in wild-type (WT), Ddx3xfl/fl, Ddx3xfl/flLysMcre and Nlrp3−/− BMDMs treated with LPS and nigericin. Representative blots (n > 3). c, Immunoblots of DDX3X expression and CASP1 cleavage after siRNA-mediated knockdown of Ddx3x in BMDMs treated with LPS with or without nigericin. Representative blots (n = 2). d, Confocal microscopy imaging of ASC specks in BMDMs treated with LPS with or without nigericin, to visualize the subcellular localization of DDX3X, NLRP3 and ASC. Scale bars, 10 μm. Representative images (n = 3). e, Schematic of N-terminal Flag-tagged NLRP3 expression constructs: full-length NLRP3 (Flag-NLRP3-FL), the pyrin domain of NLRP3 (Flag-PYD; amino acids 1–90 of NLRP3), the NACHT domain of NLRP3 (Flag-NACHT; amino acids 91–710 of NLRP3) and the LRR domain of NLRP3 (Flag-LRR; amino acids 711–1034 of NLRP3). f, Immunoblot (IB) analysis of input lysates used for co-immunoprecipitation of Flag-tagged NLRP3 constructs and DDX3X-mCherry. Representative blots (n > 3). g, Immunoblot analysis of immunoprecipitation of DDX3X-mCherry and the indicated NLRP3 constructs. Red asterisk indicates the antibody light chain. Representative blots (n > 3).

Journal: Nature

Article Title: DDX3X acts as a live-or-die checkpoint in stressed cells by regulating NLRP3 inflammasome

doi: 10.1038/s41586-019-1551-2

Figure Lengend Snippet: a, Co-immunoprecipitation (IP) of NLRP3 and DDX3X in BMDMs treated with LPS with or without nigericin. Representative blots (n= 3). b, Immunoblot analysis of CASP1 cleavage in wild-type (WT), Ddx3xfl/fl, Ddx3xfl/flLysMcre and Nlrp3−/− BMDMs treated with LPS and nigericin. Representative blots (n > 3). c, Immunoblots of DDX3X expression and CASP1 cleavage after siRNA-mediated knockdown of Ddx3x in BMDMs treated with LPS with or without nigericin. Representative blots (n = 2). d, Confocal microscopy imaging of ASC specks in BMDMs treated with LPS with or without nigericin, to visualize the subcellular localization of DDX3X, NLRP3 and ASC. Scale bars, 10 μm. Representative images (n = 3). e, Schematic of N-terminal Flag-tagged NLRP3 expression constructs: full-length NLRP3 (Flag-NLRP3-FL), the pyrin domain of NLRP3 (Flag-PYD; amino acids 1–90 of NLRP3), the NACHT domain of NLRP3 (Flag-NACHT; amino acids 91–710 of NLRP3) and the LRR domain of NLRP3 (Flag-LRR; amino acids 711–1034 of NLRP3). f, Immunoblot (IB) analysis of input lysates used for co-immunoprecipitation of Flag-tagged NLRP3 constructs and DDX3X-mCherry. Representative blots (n > 3). g, Immunoblot analysis of immunoprecipitation of DDX3X-mCherry and the indicated NLRP3 constructs. Red asterisk indicates the antibody light chain. Representative blots (n > 3).

Article Snippet: NLRP3 expression constructs pCDNA3-N-Flag-NLRP3, pCDNA3-N-Flag-NLRP3 1–90, pCDNA3-N-Flag-NLRP3 91–710 and pCDNA3-N-Flag-NLRP3 711–1034 were purchased from AddGene.

Techniques: Immunoprecipitation, Western Blot, Expressing, Confocal Microscopy, Imaging, Construct

a, Immunoblot analysis of lysates fractionated by analytical ultra-centrifugation to test the oligomerization of NLRP3, DDX3X and ASC in BMDMs stimulated with LPS and treated either with nigericin or with arsenite and nigericin. Representative blots (n = 2). MW, molecular weight. b, Immunoblot analysis of ASC from the insoluble fraction of samples from a under non-reducing (without β-mercaptoethanol; – BME) and reducing (+BME) conditions. Representative blots (n = 2). c, STORM imaging of ASC speck assembly and its spatial organization with DDX3X over time. Scale bars, 5 μm (whole-cell images); 1 μm (magnified images). Representative images (n = 2). d, Plot of the r-index to show the extent of colocalization of ASC and DDX3X with the duration of nigericin treatment (n = 2). R2 was calculated using linear regression analysis; P = 0.0125 (for the significance of the slope being non-zero). Data are mean ± s.e.m. e, f, Immunoblot analysis of CASP1 cleavage in LPS-primed BMDMs to which arsenite was added at various time points (30 and 15 min before adding nigericin, simultaneously with nigericin and 15 and 30 min after adding nigericin), without (e) or with (f) pre-treatment with anisomycin. Representative blots (n = 3). g, h, Structured illumination microscopy of BMDMs to visualize the subcellular localization of DDX3X, G3BP1 and ASC in LPS-primed BMDMs treated with nigericin alone (g) or with arsenite and nigericin (h). Scale bars, 3 μm. Representative images (n = 3).

Journal: Nature

Article Title: DDX3X acts as a live-or-die checkpoint in stressed cells by regulating NLRP3 inflammasome

doi: 10.1038/s41586-019-1551-2

Figure Lengend Snippet: a, Immunoblot analysis of lysates fractionated by analytical ultra-centrifugation to test the oligomerization of NLRP3, DDX3X and ASC in BMDMs stimulated with LPS and treated either with nigericin or with arsenite and nigericin. Representative blots (n = 2). MW, molecular weight. b, Immunoblot analysis of ASC from the insoluble fraction of samples from a under non-reducing (without β-mercaptoethanol; – BME) and reducing (+BME) conditions. Representative blots (n = 2). c, STORM imaging of ASC speck assembly and its spatial organization with DDX3X over time. Scale bars, 5 μm (whole-cell images); 1 μm (magnified images). Representative images (n = 2). d, Plot of the r-index to show the extent of colocalization of ASC and DDX3X with the duration of nigericin treatment (n = 2). R2 was calculated using linear regression analysis; P = 0.0125 (for the significance of the slope being non-zero). Data are mean ± s.e.m. e, f, Immunoblot analysis of CASP1 cleavage in LPS-primed BMDMs to which arsenite was added at various time points (30 and 15 min before adding nigericin, simultaneously with nigericin and 15 and 30 min after adding nigericin), without (e) or with (f) pre-treatment with anisomycin. Representative blots (n = 3). g, h, Structured illumination microscopy of BMDMs to visualize the subcellular localization of DDX3X, G3BP1 and ASC in LPS-primed BMDMs treated with nigericin alone (g) or with arsenite and nigericin (h). Scale bars, 3 μm. Representative images (n = 3).

Article Snippet: NLRP3 expression constructs pCDNA3-N-Flag-NLRP3, pCDNA3-N-Flag-NLRP3 1–90, pCDNA3-N-Flag-NLRP3 91–710 and pCDNA3-N-Flag-NLRP3 711–1034 were purchased from AddGene.

Techniques: Western Blot, Centrifugation, Molecular Weight, Imaging, Microscopy

a, Confocal microscopy imaging of peritoneal CD45+ cells to visualize in vivo stress granules in Ddx3xfl/fl and Ddx3xfl/flLysMcre mice that were treated with PBS or arsenite. Scale bars, 10 μm. Representative images (n = 2). b, Quantification of CD45+ cells that contain stress granules, from the peritoneal cavity of Ddx3xfl/fl and Ddx3xfl/flLysMcre mice that were injected with arsenite or PBS. ****P < 0.0001 (unpaired two-sided t-test). Data represent two biologically independent experiments (n = 10 frames). c, Quantification of the numbers and percentage of CD11b+ myeloid cells in the peritoneal cavity. P values (from left to right): ***P = 0.0001, ***P = 0.0005 (unpaired two-sided t-test; n = 7). d, e, Levels of IL-1β in the serum (d) and peritoneal fluid (PF) (e) of mice that were injected with LPS with or without prior arsenite injection in the peritoneum. P values: **P = 0.0026 (d), P = 0.09 (e) (unpaired two-sided t-test; n = 7). f, Levels of IL-1β in the serum and peritoneal fluid of Ddx3xfl/fl and Ddx3xfl/flLysMcre mice that were injected with LPS in the peritoneum. P values (from top to bottom): **P = 0.0073, *P = 0.0123 (unpaired two-sided t-test; n ≥ 6). Data are mean ± s.e.m. (b-f). g, Schematic of the interplay between the inflammasome and stress granules that is involved in cell-fate decisions. DDX3X promotes NLRP3 inflammasome activation and the pro-death cell-fate decision probably by interacting with the NLRP3 NACHT domain through its helicase (Heli) domain. Induction of stress granules causes the sequestration of DDX3X (along with 40S ribosomal subunits and translation initiation factors (eIFs)), thus making it unavailable for NLRP3 inflammasome activation and thereby allowing the cells to make a pro-survival cell-fate choice.

Journal: Nature

Article Title: DDX3X acts as a live-or-die checkpoint in stressed cells by regulating NLRP3 inflammasome

doi: 10.1038/s41586-019-1551-2

Figure Lengend Snippet: a, Confocal microscopy imaging of peritoneal CD45+ cells to visualize in vivo stress granules in Ddx3xfl/fl and Ddx3xfl/flLysMcre mice that were treated with PBS or arsenite. Scale bars, 10 μm. Representative images (n = 2). b, Quantification of CD45+ cells that contain stress granules, from the peritoneal cavity of Ddx3xfl/fl and Ddx3xfl/flLysMcre mice that were injected with arsenite or PBS. ****P < 0.0001 (unpaired two-sided t-test). Data represent two biologically independent experiments (n = 10 frames). c, Quantification of the numbers and percentage of CD11b+ myeloid cells in the peritoneal cavity. P values (from left to right): ***P = 0.0001, ***P = 0.0005 (unpaired two-sided t-test; n = 7). d, e, Levels of IL-1β in the serum (d) and peritoneal fluid (PF) (e) of mice that were injected with LPS with or without prior arsenite injection in the peritoneum. P values: **P = 0.0026 (d), P = 0.09 (e) (unpaired two-sided t-test; n = 7). f, Levels of IL-1β in the serum and peritoneal fluid of Ddx3xfl/fl and Ddx3xfl/flLysMcre mice that were injected with LPS in the peritoneum. P values (from top to bottom): **P = 0.0073, *P = 0.0123 (unpaired two-sided t-test; n ≥ 6). Data are mean ± s.e.m. (b-f). g, Schematic of the interplay between the inflammasome and stress granules that is involved in cell-fate decisions. DDX3X promotes NLRP3 inflammasome activation and the pro-death cell-fate decision probably by interacting with the NLRP3 NACHT domain through its helicase (Heli) domain. Induction of stress granules causes the sequestration of DDX3X (along with 40S ribosomal subunits and translation initiation factors (eIFs)), thus making it unavailable for NLRP3 inflammasome activation and thereby allowing the cells to make a pro-survival cell-fate choice.

Article Snippet: NLRP3 expression constructs pCDNA3-N-Flag-NLRP3, pCDNA3-N-Flag-NLRP3 1–90, pCDNA3-N-Flag-NLRP3 91–710 and pCDNA3-N-Flag-NLRP3 711–1034 were purchased from AddGene.

Techniques: Confocal Microscopy, Imaging, In Vivo, Injection, Activation Assay

RBBP8 promoter methylation in bladder cancer of the TCGA data set. a Visualization of the promoter methylation of the RBBP8 gene as a scatterplot. The β values for each sample were jittered around the probe location and plotted as points. The per sample type 90% quantiles of methylation are shown as smoothed lines. The colors represent different sample groups (BLCA, bladder cancer; HNSC, head-neck squamous cell carcinoma). b The Pearson correlation coefficients ( ρ ) for probe pairs in the core region of the promoter are shown as heatmap demonstrating a high degree of correlation between probes ( ρ > 0.7). c The beta values of all probes of the promoter region were summarized by their median value, stratified by the sample as well as tissue type, and visualized as a box plot. For RBBP8 gene loci, a frequent hypermethylation ( β > 0.25 in > 5% of cases) was only observable in 37, 10, and 7% of bladder urothelial carcinoma (BLCA), head-neck squamous cell carcinoma (HNSC), and lung squamous cell carcinoma (LUSC), respectively. d Inverse correlation between RBBP8 methylation (defined CpG gene set) and RBBP8 mRNA expression in primary bladder cancer (BLCA), neck squamous cell carcinoma (HNSC), and lung squamous carcinoma (LUSC) samples of the TCGA data portal. Spearman correlation BLCA: − 0.32, p < 0.001; Spearman correlation HNSC: − 0.04, p = ns; Spearman correlation LUSC: 0.08, p = ns. e Box plot illustrates significant downregulation of RBBP8 methylation in primary tumors featuring increased RBBP8 promoter methylation ( β value > 0.4). Horizontal lines — grouped medians. Boxes — 25 to 75% quartiles. Vertical lines — range, peak, and minimum. * p < 0.05, ** p < 0.01, ns: not significant. f Box plot shows RBBP8 methylation in primary tumors classified by intrinsic subtypes. g Kaplan-Meier survival curves display overall survival (OS) of patients with high RBBP8 methylation ( β value > 0.4, dark gray curve) compared to low RBBP8 methylation ( β value ≤ 0.4, gray curve) based on TCGA datasets

Journal: Clinical Epigenetics

Article Title: Promoter methylation of DNA damage repair (DDR) genes in human tumor entities: RBBP8 / CtIP is almost exclusively methylated in bladder cancer

doi: 10.1186/s13148-018-0447-6

Figure Lengend Snippet: RBBP8 promoter methylation in bladder cancer of the TCGA data set. a Visualization of the promoter methylation of the RBBP8 gene as a scatterplot. The β values for each sample were jittered around the probe location and plotted as points. The per sample type 90% quantiles of methylation are shown as smoothed lines. The colors represent different sample groups (BLCA, bladder cancer; HNSC, head-neck squamous cell carcinoma). b The Pearson correlation coefficients ( ρ ) for probe pairs in the core region of the promoter are shown as heatmap demonstrating a high degree of correlation between probes ( ρ > 0.7). c The beta values of all probes of the promoter region were summarized by their median value, stratified by the sample as well as tissue type, and visualized as a box plot. For RBBP8 gene loci, a frequent hypermethylation ( β > 0.25 in > 5% of cases) was only observable in 37, 10, and 7% of bladder urothelial carcinoma (BLCA), head-neck squamous cell carcinoma (HNSC), and lung squamous cell carcinoma (LUSC), respectively. d Inverse correlation between RBBP8 methylation (defined CpG gene set) and RBBP8 mRNA expression in primary bladder cancer (BLCA), neck squamous cell carcinoma (HNSC), and lung squamous carcinoma (LUSC) samples of the TCGA data portal. Spearman correlation BLCA: − 0.32, p < 0.001; Spearman correlation HNSC: − 0.04, p = ns; Spearman correlation LUSC: 0.08, p = ns. e Box plot illustrates significant downregulation of RBBP8 methylation in primary tumors featuring increased RBBP8 promoter methylation ( β value > 0.4). Horizontal lines — grouped medians. Boxes — 25 to 75% quartiles. Vertical lines — range, peak, and minimum. * p < 0.05, ** p < 0.01, ns: not significant. f Box plot shows RBBP8 methylation in primary tumors classified by intrinsic subtypes. g Kaplan-Meier survival curves display overall survival (OS) of patients with high RBBP8 methylation ( β value > 0.4, dark gray curve) compared to low RBBP8 methylation ( β value ≤ 0.4, gray curve) based on TCGA datasets

Article Snippet: Primary anti-RBBP8 antibody (dilution 1:200) (Atlas Antibodies, HPA039890, Sigma-Aldrich, Germany) was linked with DAKO EnVisionTMFLEX system and visualized with DAKO Liquid DAB Substrate Chromogen System in a DAKO Autostainer plus (K8024, K3468, DAKO).

Techniques: Methylation, Expressing

Clinicopathological parameters in relation to  RBBP8  promoter methylation of the BLCA TCGA dataset

Journal: Clinical Epigenetics

Article Title: Promoter methylation of DNA damage repair (DDR) genes in human tumor entities: RBBP8 / CtIP is almost exclusively methylated in bladder cancer

doi: 10.1186/s13148-018-0447-6

Figure Lengend Snippet: Clinicopathological parameters in relation to RBBP8 promoter methylation of the BLCA TCGA dataset

Article Snippet: Primary anti-RBBP8 antibody (dilution 1:200) (Atlas Antibodies, HPA039890, Sigma-Aldrich, Germany) was linked with DAKO EnVisionTMFLEX system and visualized with DAKO Liquid DAB Substrate Chromogen System in a DAKO Autostainer plus (K8024, K3468, DAKO).

Techniques: Methylation

Univariate analysis of clinicopathological parameters influencing OS

Journal: Clinical Epigenetics

Article Title: Promoter methylation of DNA damage repair (DDR) genes in human tumor entities: RBBP8 / CtIP is almost exclusively methylated in bladder cancer

doi: 10.1186/s13148-018-0447-6

Figure Lengend Snippet: Univariate analysis of clinicopathological parameters influencing OS

Article Snippet: Primary anti-RBBP8 antibody (dilution 1:200) (Atlas Antibodies, HPA039890, Sigma-Aldrich, Germany) was linked with DAKO EnVisionTMFLEX system and visualized with DAKO Liquid DAB Substrate Chromogen System in a DAKO Autostainer plus (K8024, K3468, DAKO).

Techniques: Methylation

RBBP8 promoter methylation in human cancer cell lines. a Schematic map of the human RBBP8 gene including the relative positions and median β values of 17 CpG sites based on 450K methylation array profiling in bladder cancer (TCGA dataset) within a predicted CpG island (between base − 353 and + 648). Colored boxes present methylation level (mean ß -values for each CpG site) of the TCGA data set. Red, high methylation; blue, low methylation. + 1, RBBP8 transcription start site (TSS) of variant #1. The dots indicating the methylation sites closer to where they are depicted. CpG sites analyzed by MSP (black arrows) were indicated within the upstream promoter region close to the TSS. The relative position of the promoter area analyzed by bisulfite-pyrosequencing that comprises eight single CpG sites (gray dots) is shown as a black line. Orange boxes illustrate gene transcription-relevant regulatory core and ubiquitous elements statistically identified by using Genomatix software ( http://www.genomatix.de/ ). A — core promoter motif ten elements (− 200 to − 179); B — activator protein 2 (− 109 to − 94); C — activator-, mediator-, and TBP-dependent core promoter element for RNA polymerase II transcription from TATA-less promoters (+ 28 to + 39). b Representative MSP results of the RBBP8 promoter methylation status in cell lines of bladder, kidney, colon, lung, prostate, and breast cancer. Bands labeled with U and M reflect unmethylated and methylated DNA, respectively. Bisulfite-converted unmethylated, genomic (U-co), and polymethylated, genomic (M-co) DNA were used as positive controls. NTC, non-template control. c RBBP8 mean methylation values of analyzed CpG sites (1 to 8) using bisulfite-pyrosequencing of bladder cancer cell lines (RT4, RT112, and J82). d RBBP8 mRNA expression in normal urothelial cells (UROtsa) and bladder cancer cell lines (RT4, RT112, J82, and EJ28) arranged in relation to their RBBP8 promoter methylation status. U, unmethylated; M, methylated. Error bars: + s.e.m. e qPCR analysis for RBBP8 mRNA expression after in vitro demethylation analysis demonstrating a clear RBBP8 re-expression after treatment with both DAC (+) and TSA (+) only in RT4 with methylated RBBP8 promoter status (M) whereas in J82 cells without any RBBP8 methylation (U) RBBP8 expression was not further inducible. Non-treated cells served as controls and were set to 1. Error bars: + s.e.m.

Journal: Clinical Epigenetics

Article Title: Promoter methylation of DNA damage repair (DDR) genes in human tumor entities: RBBP8 / CtIP is almost exclusively methylated in bladder cancer

doi: 10.1186/s13148-018-0447-6

Figure Lengend Snippet: RBBP8 promoter methylation in human cancer cell lines. a Schematic map of the human RBBP8 gene including the relative positions and median β values of 17 CpG sites based on 450K methylation array profiling in bladder cancer (TCGA dataset) within a predicted CpG island (between base − 353 and + 648). Colored boxes present methylation level (mean ß -values for each CpG site) of the TCGA data set. Red, high methylation; blue, low methylation. + 1, RBBP8 transcription start site (TSS) of variant #1. The dots indicating the methylation sites closer to where they are depicted. CpG sites analyzed by MSP (black arrows) were indicated within the upstream promoter region close to the TSS. The relative position of the promoter area analyzed by bisulfite-pyrosequencing that comprises eight single CpG sites (gray dots) is shown as a black line. Orange boxes illustrate gene transcription-relevant regulatory core and ubiquitous elements statistically identified by using Genomatix software ( http://www.genomatix.de/ ). A — core promoter motif ten elements (− 200 to − 179); B — activator protein 2 (− 109 to − 94); C — activator-, mediator-, and TBP-dependent core promoter element for RNA polymerase II transcription from TATA-less promoters (+ 28 to + 39). b Representative MSP results of the RBBP8 promoter methylation status in cell lines of bladder, kidney, colon, lung, prostate, and breast cancer. Bands labeled with U and M reflect unmethylated and methylated DNA, respectively. Bisulfite-converted unmethylated, genomic (U-co), and polymethylated, genomic (M-co) DNA were used as positive controls. NTC, non-template control. c RBBP8 mean methylation values of analyzed CpG sites (1 to 8) using bisulfite-pyrosequencing of bladder cancer cell lines (RT4, RT112, and J82). d RBBP8 mRNA expression in normal urothelial cells (UROtsa) and bladder cancer cell lines (RT4, RT112, J82, and EJ28) arranged in relation to their RBBP8 promoter methylation status. U, unmethylated; M, methylated. Error bars: + s.e.m. e qPCR analysis for RBBP8 mRNA expression after in vitro demethylation analysis demonstrating a clear RBBP8 re-expression after treatment with both DAC (+) and TSA (+) only in RT4 with methylated RBBP8 promoter status (M) whereas in J82 cells without any RBBP8 methylation (U) RBBP8 expression was not further inducible. Non-treated cells served as controls and were set to 1. Error bars: + s.e.m.

Article Snippet: Primary anti-RBBP8 antibody (dilution 1:200) (Atlas Antibodies, HPA039890, Sigma-Aldrich, Germany) was linked with DAKO EnVisionTMFLEX system and visualized with DAKO Liquid DAB Substrate Chromogen System in a DAKO Autostainer plus (K8024, K3468, DAKO).

Techniques: Methylation, Variant Assay, Software, Labeling, Control, Expressing, In Vitro

Validation of RBBP8 promoter methylation in primary bladder tumors. a Representative MSP analysis shows the RBBP8 promoter methylation status of normal urothelium (NU) and both papillary (Pap) and invasive (Inv) primary bladder cancer tissues. Band labels with U and M represent an unmethylated and methylated DNA locus, respectively bisulfite-converted unmethylated, genomic (U-co) and polymethylated, genomic (M-co) DNA were used as positive controls. NTC: non-template control. b RBBP8 mean methylation values of analyzed CpG sites (1 to 8) of healthy controls and bladder tumors demonstrating tumors-specific hypermethylation. c to d Box plot analysis of RBBP8 methylation in primary bladder tumors is based on mean values of pyrosequenced CpG sites 1–8. c RBBP8 methylation shows no significant differences between the two bladder cancer pathways (papillary and invasive tumors). d Significant enrichment of RBBP8 methylation is demonstrated in high-grade bladder tumors. Horizontal lines—grouped medians. Boxes—25 to 75% quartiles. Vertical lines—range, peak, and minimum; * p < 0.05. Horizontal lines—grouped medians. Boxes—25 to 75% quartiles. Vertical lines—range, peak, and minimum; ns, not significant, * p < 0.05

Journal: Clinical Epigenetics

Article Title: Promoter methylation of DNA damage repair (DDR) genes in human tumor entities: RBBP8 / CtIP is almost exclusively methylated in bladder cancer

doi: 10.1186/s13148-018-0447-6

Figure Lengend Snippet: Validation of RBBP8 promoter methylation in primary bladder tumors. a Representative MSP analysis shows the RBBP8 promoter methylation status of normal urothelium (NU) and both papillary (Pap) and invasive (Inv) primary bladder cancer tissues. Band labels with U and M represent an unmethylated and methylated DNA locus, respectively bisulfite-converted unmethylated, genomic (U-co) and polymethylated, genomic (M-co) DNA were used as positive controls. NTC: non-template control. b RBBP8 mean methylation values of analyzed CpG sites (1 to 8) of healthy controls and bladder tumors demonstrating tumors-specific hypermethylation. c to d Box plot analysis of RBBP8 methylation in primary bladder tumors is based on mean values of pyrosequenced CpG sites 1–8. c RBBP8 methylation shows no significant differences between the two bladder cancer pathways (papillary and invasive tumors). d Significant enrichment of RBBP8 methylation is demonstrated in high-grade bladder tumors. Horizontal lines—grouped medians. Boxes—25 to 75% quartiles. Vertical lines—range, peak, and minimum; * p < 0.05. Horizontal lines—grouped medians. Boxes—25 to 75% quartiles. Vertical lines—range, peak, and minimum; ns, not significant, * p < 0.05

Article Snippet: Primary anti-RBBP8 antibody (dilution 1:200) (Atlas Antibodies, HPA039890, Sigma-Aldrich, Germany) was linked with DAKO EnVisionTMFLEX system and visualized with DAKO Liquid DAB Substrate Chromogen System in a DAKO Autostainer plus (K8024, K3468, DAKO).

Techniques: Biomarker Discovery, Methylation, Control

RBBP8 protein loss in nuclei of bladder tumors. Immunohistochemical RBBP8 protein staining of representative tissues are shown. a Strong RBBP8 immunoreactivity was detected in the cytoplasm and in the nuclei of a healthy urothelium, Scale bar: 100 μm. b Negative control of urothelial cell layers. The application of primary antibody was omitted. c Strong RBBP8 immunoreactivity in the cytoplasm of high grade, invasive tumor cells which completely lack nuclear staining. d Moderate cytoplasmatic and heterogeneously nuclear RBBP8 protein staining in invasive tumor cells. e Low RBBP8 protein expression in the cytoplasm of invasive bladder cancer showing strong RBBP8 staining in the nucleus. f Strong nuclear and cytoplasmic RBBP8 staining in non-invasive, papillary tumor cells. g Box plot demonstrating overall significant loss of RBBP8 protein only in the nucleus of bladder tumors. h Box plot graph illustrates the loss of RBBP8 protein within the nuclei of high-grade invasive bladder tumors. i Box plot shows a significant RBBP8 protein loss in tumors harboring RBBP8 promoter methylation. U, unmethylated; M, methylated. Horizontal lines — grouped medians. Boxes — 25 to 75% quartiles. Vertical lines — range, peak, and minimum; ns, not significant, * p < 0.05, *** p < 0.001

Journal: Clinical Epigenetics

Article Title: Promoter methylation of DNA damage repair (DDR) genes in human tumor entities: RBBP8 / CtIP is almost exclusively methylated in bladder cancer

doi: 10.1186/s13148-018-0447-6

Figure Lengend Snippet: RBBP8 protein loss in nuclei of bladder tumors. Immunohistochemical RBBP8 protein staining of representative tissues are shown. a Strong RBBP8 immunoreactivity was detected in the cytoplasm and in the nuclei of a healthy urothelium, Scale bar: 100 μm. b Negative control of urothelial cell layers. The application of primary antibody was omitted. c Strong RBBP8 immunoreactivity in the cytoplasm of high grade, invasive tumor cells which completely lack nuclear staining. d Moderate cytoplasmatic and heterogeneously nuclear RBBP8 protein staining in invasive tumor cells. e Low RBBP8 protein expression in the cytoplasm of invasive bladder cancer showing strong RBBP8 staining in the nucleus. f Strong nuclear and cytoplasmic RBBP8 staining in non-invasive, papillary tumor cells. g Box plot demonstrating overall significant loss of RBBP8 protein only in the nucleus of bladder tumors. h Box plot graph illustrates the loss of RBBP8 protein within the nuclei of high-grade invasive bladder tumors. i Box plot shows a significant RBBP8 protein loss in tumors harboring RBBP8 promoter methylation. U, unmethylated; M, methylated. Horizontal lines — grouped medians. Boxes — 25 to 75% quartiles. Vertical lines — range, peak, and minimum; ns, not significant, * p < 0.05, *** p < 0.001

Article Snippet: Primary anti-RBBP8 antibody (dilution 1:200) (Atlas Antibodies, HPA039890, Sigma-Aldrich, Germany) was linked with DAKO EnVisionTMFLEX system and visualized with DAKO Liquid DAB Substrate Chromogen System in a DAKO Autostainer plus (K8024, K3468, DAKO).

Techniques: Immunohistochemical staining, Staining, Negative Control, Expressing, Methylation

Clinicopathological parameters in relation to nuclear  RBBP8  protein expression

Journal: Clinical Epigenetics

Article Title: Promoter methylation of DNA damage repair (DDR) genes in human tumor entities: RBBP8 / CtIP is almost exclusively methylated in bladder cancer

doi: 10.1186/s13148-018-0447-6

Figure Lengend Snippet: Clinicopathological parameters in relation to nuclear RBBP8 protein expression

Article Snippet: Primary anti-RBBP8 antibody (dilution 1:200) (Atlas Antibodies, HPA039890, Sigma-Aldrich, Germany) was linked with DAKO EnVisionTMFLEX system and visualized with DAKO Liquid DAB Substrate Chromogen System in a DAKO Autostainer plus (K8024, K3468, DAKO).

Techniques: Biomarker Discovery, Methylation

RBBP8 promoter methylation is detectable in urines from bladder cancer patients. a Representative MSP analysis shows the RBBP8 promoter methylation status of human urine samples derived from healthy controls (Co) and bladder tumors (Ur-T). Band labels with U and M represent an unmethylated and methylated DNA locus. Bisulfite-converted unmethylated, genomic (U-co), and polymethylated, genomic (M-co) DNA were used as positive controls. NTC, non-template control. b Upper graph: RBBP8 mean methylation values of analyzed CpG sites (1 to 8) in cancerous bladder diseases (BLCA-derived) and two control cohorts (benign: control urines #1 and malignant: control urines #2) using pyrosequencing . Lower heatmap: Differences of RBBP8 methylation between BLCA-derived urines and both control conditions (benign and malignant) highlighting GpG sites (#7 and #8) with the strongest impact for discrimination (see green arrows). c Box plot demonstrating a significant increase of RBBP8 methylation in high-grade bladder tumors. Horizontal lines — grouped medians. Boxes — 25 to 75% quartiles. Vertical lines — range, peak, and minimum; * p < 0.05. d RBBP8 mean methylation values of analyzed CpG sites (1 to 8) of controls classified by diseases . BPH, begin prostate hyperplasia; TGCT, testicular germ cell tumors; PRAD, prostate adenocarcinoma

Journal: Clinical Epigenetics

Article Title: Promoter methylation of DNA damage repair (DDR) genes in human tumor entities: RBBP8 / CtIP is almost exclusively methylated in bladder cancer

doi: 10.1186/s13148-018-0447-6

Figure Lengend Snippet: RBBP8 promoter methylation is detectable in urines from bladder cancer patients. a Representative MSP analysis shows the RBBP8 promoter methylation status of human urine samples derived from healthy controls (Co) and bladder tumors (Ur-T). Band labels with U and M represent an unmethylated and methylated DNA locus. Bisulfite-converted unmethylated, genomic (U-co), and polymethylated, genomic (M-co) DNA were used as positive controls. NTC, non-template control. b Upper graph: RBBP8 mean methylation values of analyzed CpG sites (1 to 8) in cancerous bladder diseases (BLCA-derived) and two control cohorts (benign: control urines #1 and malignant: control urines #2) using pyrosequencing . Lower heatmap: Differences of RBBP8 methylation between BLCA-derived urines and both control conditions (benign and malignant) highlighting GpG sites (#7 and #8) with the strongest impact for discrimination (see green arrows). c Box plot demonstrating a significant increase of RBBP8 methylation in high-grade bladder tumors. Horizontal lines — grouped medians. Boxes — 25 to 75% quartiles. Vertical lines — range, peak, and minimum; * p < 0.05. d RBBP8 mean methylation values of analyzed CpG sites (1 to 8) of controls classified by diseases . BPH, begin prostate hyperplasia; TGCT, testicular germ cell tumors; PRAD, prostate adenocarcinoma

Article Snippet: Primary anti-RBBP8 antibody (dilution 1:200) (Atlas Antibodies, HPA039890, Sigma-Aldrich, Germany) was linked with DAKO EnVisionTMFLEX system and visualized with DAKO Liquid DAB Substrate Chromogen System in a DAKO Autostainer plus (K8024, K3468, DAKO).

Techniques: Methylation, Derivative Assay, Control

Clinicopathological parameters in relation to  RBBP8  promoter methylation in BLCA associated urine samples

Journal: Clinical Epigenetics

Article Title: Promoter methylation of DNA damage repair (DDR) genes in human tumor entities: RBBP8 / CtIP is almost exclusively methylated in bladder cancer

doi: 10.1186/s13148-018-0447-6

Figure Lengend Snippet: Clinicopathological parameters in relation to RBBP8 promoter methylation in BLCA associated urine samples

Article Snippet: Primary anti-RBBP8 antibody (dilution 1:200) (Atlas Antibodies, HPA039890, Sigma-Aldrich, Germany) was linked with DAKO EnVisionTMFLEX system and visualized with DAKO Liquid DAB Substrate Chromogen System in a DAKO Autostainer plus (K8024, K3468, DAKO).

Techniques: Methylation

Biomarker performance of RBBP8 methylation based on a non-invasive approach. a RBBP8 methylation enables significant discrimination of cancerous bladder diseases from two control conditions (benign and malignant) using urine samples. The scatterplot shows the mean methylation values of the CpG sites #7 and #8; ns, not significant; *** p < 0.0001. b to c ROC curve analysis illustrating RBBP8 single-biomarker performance based on all analyzed CpG sites (green curve) and CpG site #7 and #8 (red curve). b ROC curve in benign disease controls. Red curve (CpG #7 and #8): the cutoff value of 1.25% methylation was defined for positive detection of disease; in that case, RBBP8 methylation achieved a specificity of 90.9% and a sensitivity of 51.9%. Area under the curve (AUC) 0.730 (95% CI, 0.616 to 0.844), p = 0.002. c ROC curve in malignant (prostate and testicular cancer) disease controls. Red curve (CpG #7 and #8): the cutoff value of 4.00% methylation was defined for positive detection of disease; in that case, RBBP8 methylation achieved a specificity of 90.2% and a sensitivity of 40.4%. Area under the curve (AUC) 0.686 (95% CI, 0.583 to 0.789), p = 0.001

Journal: Clinical Epigenetics

Article Title: Promoter methylation of DNA damage repair (DDR) genes in human tumor entities: RBBP8 / CtIP is almost exclusively methylated in bladder cancer

doi: 10.1186/s13148-018-0447-6

Figure Lengend Snippet: Biomarker performance of RBBP8 methylation based on a non-invasive approach. a RBBP8 methylation enables significant discrimination of cancerous bladder diseases from two control conditions (benign and malignant) using urine samples. The scatterplot shows the mean methylation values of the CpG sites #7 and #8; ns, not significant; *** p < 0.0001. b to c ROC curve analysis illustrating RBBP8 single-biomarker performance based on all analyzed CpG sites (green curve) and CpG site #7 and #8 (red curve). b ROC curve in benign disease controls. Red curve (CpG #7 and #8): the cutoff value of 1.25% methylation was defined for positive detection of disease; in that case, RBBP8 methylation achieved a specificity of 90.9% and a sensitivity of 51.9%. Area under the curve (AUC) 0.730 (95% CI, 0.616 to 0.844), p = 0.002. c ROC curve in malignant (prostate and testicular cancer) disease controls. Red curve (CpG #7 and #8): the cutoff value of 4.00% methylation was defined for positive detection of disease; in that case, RBBP8 methylation achieved a specificity of 90.2% and a sensitivity of 40.4%. Area under the curve (AUC) 0.686 (95% CI, 0.583 to 0.789), p = 0.001

Article Snippet: Primary anti-RBBP8 antibody (dilution 1:200) (Atlas Antibodies, HPA039890, Sigma-Aldrich, Germany) was linked with DAKO EnVisionTMFLEX system and visualized with DAKO Liquid DAB Substrate Chromogen System in a DAKO Autostainer plus (K8024, K3468, DAKO).

Techniques: Biomarker Discovery, Methylation, Control

 RBBP8  biomarker performance

Journal: Clinical Epigenetics

Article Title: Promoter methylation of DNA damage repair (DDR) genes in human tumor entities: RBBP8 / CtIP is almost exclusively methylated in bladder cancer

doi: 10.1186/s13148-018-0447-6

Figure Lengend Snippet: RBBP8 biomarker performance

Article Snippet: Primary anti-RBBP8 antibody (dilution 1:200) (Atlas Antibodies, HPA039890, Sigma-Aldrich, Germany) was linked with DAKO EnVisionTMFLEX system and visualized with DAKO Liquid DAB Substrate Chromogen System in a DAKO Autostainer plus (K8024, K3468, DAKO).

Techniques: Biomarker Discovery, Control

And-1 forms complexes with HR repair proteins and is required for HR repair. ( A ) Identification of CtIP-associated proteins that are involved in HR repair by mass spectrometry. ( B ) CtIP interacts with And-1. Co-immunoprecipitation (co-IP) assays were performed using U2OS cell lines. Cell lysates were immunoprecipitated with control IgG, anti-CtIP or anti-And-1 antibodies and the IPs were then resolved by SDS-PAGE and immunoblotted for the indicated proteins. Left panel, immunoprecipitation with anti-CtIP antibody. Right panel, immunoprecipitation with anti-And-1 antibody. ( C ) And-1 depletion impairs HR repair. U2OS-DR-GFP cells treated with the indicated siRNAs were transfected with pCBASce plasmids 48 h post siRNA transfection. The percentage of GFP-positive cells was determined by flow cytometry 48 h after plasmid transfection. The data were normalized to those obtained from cells transfected with control siGl2 (set as 1.0). Data represent means ± SD from three independent experiments. * P ≤ 0.05. ( D ) U2OS cell survival after exposing cells transfected with indicated siRNAs to the indicated doses of camptothecin. Data represent means ± SD from three independent experiments. * P ≤ 0.05; ** P ≤ 0.01.

Journal: Nucleic Acids Research

Article Title: And-1 is required for homologous recombination repair by regulating DNA end resection

doi: 10.1093/nar/gkw1241

Figure Lengend Snippet: And-1 forms complexes with HR repair proteins and is required for HR repair. ( A ) Identification of CtIP-associated proteins that are involved in HR repair by mass spectrometry. ( B ) CtIP interacts with And-1. Co-immunoprecipitation (co-IP) assays were performed using U2OS cell lines. Cell lysates were immunoprecipitated with control IgG, anti-CtIP or anti-And-1 antibodies and the IPs were then resolved by SDS-PAGE and immunoblotted for the indicated proteins. Left panel, immunoprecipitation with anti-CtIP antibody. Right panel, immunoprecipitation with anti-And-1 antibody. ( C ) And-1 depletion impairs HR repair. U2OS-DR-GFP cells treated with the indicated siRNAs were transfected with pCBASce plasmids 48 h post siRNA transfection. The percentage of GFP-positive cells was determined by flow cytometry 48 h after plasmid transfection. The data were normalized to those obtained from cells transfected with control siGl2 (set as 1.0). Data represent means ± SD from three independent experiments. * P ≤ 0.05. ( D ) U2OS cell survival after exposing cells transfected with indicated siRNAs to the indicated doses of camptothecin. Data represent means ± SD from three independent experiments. * P ≤ 0.05; ** P ≤ 0.01.

Article Snippet: Recombinant CtIP proteins (H00005932-P01) were purchased from Novus Biologicals.

Techniques: Mass Spectrometry, Immunoprecipitation, Co-Immunoprecipitation Assay, Control, SDS Page, Transfection, Flow Cytometry, Plasmid Preparation

And-1 is recruited to DSB sites. ( A ) And-1 co-localizes with γ-H2AX at DSB sites induced by laser micro-irradiation. U2OS cells were micro-irradiated with laser and fixed for immunostaining using the indicated antibodies 10 min after irradiation. For each experiment, >50 cells were counted and the percentage of cells exhibiting γ-H2AX strips or both γ-H2AX and And-1 strips was determined. Data represent means ± SD from three independent experiments. *** P ≤ 0.001. ( B ) And-1 co-localizes with γ-H2AX at DSB sites induced by UVC light. U2OS cells labeled with or without 10 μM BrdU for 72 h were covered with a 5 μm polycarbonate isopore membrane filter and subjected to UVC irradiation (30J/m 2 ). 30 min after irradiation, cells were harvested and immunostained for the indicated proteins. For each experiment, >100 cells were counted and the percentage of cells exhibiting And-1 foci was determined. Data represent means ± SD from three independent experiments. *** P ≤ 0.001. ( C ) And-1 recruitment to laser-induced DSB sites at the indicated time points. U2OS cells were micro-irradiated with laser and then processed at indicated time points for immunostaining for indicated proteins. ( D ) CtIP recruitment to laser-induced DSB sites at indicated time points. U2OS cells were micro-irradiated with laser and then processed at the indicated time points for immunostaining for indicated proteins.

Journal: Nucleic Acids Research

Article Title: And-1 is required for homologous recombination repair by regulating DNA end resection

doi: 10.1093/nar/gkw1241

Figure Lengend Snippet: And-1 is recruited to DSB sites. ( A ) And-1 co-localizes with γ-H2AX at DSB sites induced by laser micro-irradiation. U2OS cells were micro-irradiated with laser and fixed for immunostaining using the indicated antibodies 10 min after irradiation. For each experiment, >50 cells were counted and the percentage of cells exhibiting γ-H2AX strips or both γ-H2AX and And-1 strips was determined. Data represent means ± SD from three independent experiments. *** P ≤ 0.001. ( B ) And-1 co-localizes with γ-H2AX at DSB sites induced by UVC light. U2OS cells labeled with or without 10 μM BrdU for 72 h were covered with a 5 μm polycarbonate isopore membrane filter and subjected to UVC irradiation (30J/m 2 ). 30 min after irradiation, cells were harvested and immunostained for the indicated proteins. For each experiment, >100 cells were counted and the percentage of cells exhibiting And-1 foci was determined. Data represent means ± SD from three independent experiments. *** P ≤ 0.001. ( C ) And-1 recruitment to laser-induced DSB sites at the indicated time points. U2OS cells were micro-irradiated with laser and then processed at indicated time points for immunostaining for indicated proteins. ( D ) CtIP recruitment to laser-induced DSB sites at indicated time points. U2OS cells were micro-irradiated with laser and then processed at the indicated time points for immunostaining for indicated proteins.

Article Snippet: Recombinant CtIP proteins (H00005932-P01) were purchased from Novus Biologicals.

Techniques: Irradiation, Immunostaining, Labeling, Membrane

And-1 is required for efficient recruitment of CtIP to DSB sites. ( A ) And-1 depletion impairs CtIP recruitment to DSB sites. U2OS cells treated with siGl2 or two independent siAnd-1s (siA-1 or siA-2) were micro-irradiated by laser and co-immunostained for γ-H2AX and CtIP 15 min post irradiation. For each experiment, >50 cells were counted and the percentage of γ-H2AX cells exhibiting CtIP strips was determined. Data represent means ± SD from three independent experiments. N.S., not significant; * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001. ( B ) Restoration of CtIP recruitment to DSB sites in cells expressing siRNA resistant And-1. U2OS cells expressing the mutant And-1 (330–1129) were transfected with the indicated siRNAs and subjected to treatment as described in Figure . For each experiment, >50 cells were counted and the percentage of γ-H2AX cells exhibiting CtIP strips was determined. Data represent means ± SD from three independent experiments. N.S., not significant; * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001.

Journal: Nucleic Acids Research

Article Title: And-1 is required for homologous recombination repair by regulating DNA end resection

doi: 10.1093/nar/gkw1241

Figure Lengend Snippet: And-1 is required for efficient recruitment of CtIP to DSB sites. ( A ) And-1 depletion impairs CtIP recruitment to DSB sites. U2OS cells treated with siGl2 or two independent siAnd-1s (siA-1 or siA-2) were micro-irradiated by laser and co-immunostained for γ-H2AX and CtIP 15 min post irradiation. For each experiment, >50 cells were counted and the percentage of γ-H2AX cells exhibiting CtIP strips was determined. Data represent means ± SD from three independent experiments. N.S., not significant; * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001. ( B ) Restoration of CtIP recruitment to DSB sites in cells expressing siRNA resistant And-1. U2OS cells expressing the mutant And-1 (330–1129) were transfected with the indicated siRNAs and subjected to treatment as described in Figure . For each experiment, >50 cells were counted and the percentage of γ-H2AX cells exhibiting CtIP strips was determined. Data represent means ± SD from three independent experiments. N.S., not significant; * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001.

Article Snippet: Recombinant CtIP proteins (H00005932-P01) were purchased from Novus Biologicals.

Techniques: Irradiation, Expressing, Mutagenesis, Transfection

And-1 depletion impairs DNA damage response induced by end resection. ( A and B ) Depletion of And-1 impairs Chk1 and RPA phophorylation but not Chk2 phosphorylation after camptothecin exposure. U2OS cells transfected with the indicated siRNAs were treated with camptothecin (1 μM) for 1 h. Cells were then harvested and immunoblotted for indicated proteins. Asterisks in A and B: hyper-phosphorylated RPA32. ( C ) Depletion of And-1 impairs Chk1 phosphorylation at both early and late time-points after continuous camptothecin exposure. U2OS cells transfected with the indicated siRNAs were treated with camptothecin (1 μM) and harvested at the indicated time-points and immunoblotted for the indicated proteins. ( D ) U2OS cells transfected with indicated siRNAs were synchronized by using a double-thymidine (2 mM) block and then released for 6h. Cells enriched in S/G2 phase were harvested for IP. CtIP or IgG IPs were immunoblotted for the indicated proteins.

Journal: Nucleic Acids Research

Article Title: And-1 is required for homologous recombination repair by regulating DNA end resection

doi: 10.1093/nar/gkw1241

Figure Lengend Snippet: And-1 depletion impairs DNA damage response induced by end resection. ( A and B ) Depletion of And-1 impairs Chk1 and RPA phophorylation but not Chk2 phosphorylation after camptothecin exposure. U2OS cells transfected with the indicated siRNAs were treated with camptothecin (1 μM) for 1 h. Cells were then harvested and immunoblotted for indicated proteins. Asterisks in A and B: hyper-phosphorylated RPA32. ( C ) Depletion of And-1 impairs Chk1 phosphorylation at both early and late time-points after continuous camptothecin exposure. U2OS cells transfected with the indicated siRNAs were treated with camptothecin (1 μM) and harvested at the indicated time-points and immunoblotted for the indicated proteins. ( D ) U2OS cells transfected with indicated siRNAs were synchronized by using a double-thymidine (2 mM) block and then released for 6h. Cells enriched in S/G2 phase were harvested for IP. CtIP or IgG IPs were immunoblotted for the indicated proteins.

Article Snippet: Recombinant CtIP proteins (H00005932-P01) were purchased from Novus Biologicals.

Techniques: Phospho-proteomics, Transfection, Blocking Assay

The C-terminus of And-1 is required for its interaction with CtIP and localization to DSB sites. ( A ) And-1 directly interacts with CtIP. Purified recombinant CtIP proteins (400 ng) were mixed with recombinant And-1protiens (200 ng) or BSA (200 ng) as described in Method. CtIP was immunoprecipitated with anti-CtIP antibody and IPs were then resolved by SDS-PAGE and immunoblotted for the indicated proteins. ( B ) The associations of And-1 or its mutants with CtIP. FLAG-And-1 and its mutants were expressed in 293T cells. FLAG-IPs were resolved by SDS-PAGE and immunoblotted for the indicated proteins. ( C ) The localization of And-1 and its mutants at DSB sites. U2OS cells expressing the indicated And-1 or it mutants were subjected to the treatment as in Figure . ( D ) The associations of CtIP or its mutants with And-1. FLAG-CtIP and its mutants were expressed in 293T cells. Left panel, schematic of the CtIP protein domains and deletion mutants used for protein–protein interactions; Right panel, FLAG-IPs were resolved on SDS-PAGE and immunoblotted for the indicated proteins.

Journal: Nucleic Acids Research

Article Title: And-1 is required for homologous recombination repair by regulating DNA end resection

doi: 10.1093/nar/gkw1241

Figure Lengend Snippet: The C-terminus of And-1 is required for its interaction with CtIP and localization to DSB sites. ( A ) And-1 directly interacts with CtIP. Purified recombinant CtIP proteins (400 ng) were mixed with recombinant And-1protiens (200 ng) or BSA (200 ng) as described in Method. CtIP was immunoprecipitated with anti-CtIP antibody and IPs were then resolved by SDS-PAGE and immunoblotted for the indicated proteins. ( B ) The associations of And-1 or its mutants with CtIP. FLAG-And-1 and its mutants were expressed in 293T cells. FLAG-IPs were resolved by SDS-PAGE and immunoblotted for the indicated proteins. ( C ) The localization of And-1 and its mutants at DSB sites. U2OS cells expressing the indicated And-1 or it mutants were subjected to the treatment as in Figure . ( D ) The associations of CtIP or its mutants with And-1. FLAG-CtIP and its mutants were expressed in 293T cells. Left panel, schematic of the CtIP protein domains and deletion mutants used for protein–protein interactions; Right panel, FLAG-IPs were resolved on SDS-PAGE and immunoblotted for the indicated proteins.

Article Snippet: Recombinant CtIP proteins (H00005932-P01) were purchased from Novus Biologicals.

Techniques: Purification, Recombinant, Immunoprecipitation, SDS Page, Expressing, Protein-Protein interactions