Journal: Oncotarget

Article Title: Src is the primary target of aripiprazole, an atypical antipsychotic drug, in its anti-tumor action.

doi: 10.18632/oncotarget.23192

Figure Lengend Snippet: Figure 1: In vitro and in vivo anti-cancer effects of aripiprazole (ARP). (A) Chemical structure of ARP, an antipsychotic to treat schizophrenia and bipolar disorder. (B, C, D, and E) Cytotoxic effect of ARP evaluated by conventional MTT assays. Viability of glioma U251 (B left) and LN428 (B right) cell lines, human gastric cancer cell line MKN-1 (C left), breast cancer line MDA-MB-231 (C right), mouse CT21 colon cancer cell line (D), and noncancerous HEK293 (E) cell line following ARP treatment for 24 and 48 h. (F) In vivo ARP anti-cancer activity evaluated using xenograft mice bearing CT26 cell-derived cancers. Mice were subcutaneously injected with 10,000 CT26 cells in 0.1 ml. Photograph of mice with CT26 cell-derived cancers by digital camera (upper). Tumor volumes were determined using digital calipers every 1, 2, or 3 days for 18 days (middle). Body weight was measured for 18 days at 3-day intervals (lower). *P < 0.05 and **P <0.01 compared with normal group. Data are presented as the mean ± standard error of the mean (SEM) of three independent experiments conducted in triplicate. *:p < 0.05 and **:p < 0.01 compared to normal or control groups.

Article Snippet: Cell lines and cell culture conditions The human glioma cell lines U251 and LN428, the human gastric adenosquamous carcinoma cancer cell Table 2: List of PCR primers used in this study Name Sequence (5′ to 3′) Real-time PCR Bcl-2 F GAAACCCCTAGTGCCATCAA R GGGACGTCAGGTCACTGAAT GAPDH F GGAAGGTGAAGGTCGGAGTCA R GTCATTGATGGCAACAATATCCACT RT-PCR Bcl-2 F TGTGGCCTTCTTTGAGTTCG R TCACTTGTGGCTCAGATAGG MMP-2 F CCCACTGAGGAGTCCAACAT R CATTTACACGTCGGATCT MMP-9 F TCCCTGGAGACCTGAGAACC R GGCAAGTCTTCCGAGTAGTTT GAPDH F GCACCGTCAAGGCTGAGAAC R ATGGTGGTGAAGACGCCAGT Oncotarget5986www.impactjournals.com/oncotarget Oncotarget5987www.impactjournals.com/oncotarget line MKN-1, the human breast cancer cell line MDAMB-231, the mouse colon carcinoma cell line CT26, and the human embryonic kidney cell line HEK293 were from the American Type Culture Collection (Manassas, VA, USA).

Techniques: In Vitro, In Vivo, Activity Assay, Derivative Assay, Injection, Control

Journal: Pharmaceutics

Article Title: Overcoming Resistance to Immune Checkpoint Inhibitor Therapy Using Calreticulin-Inducing Nanoparticle

doi: 10.3390/pharmaceutics15061693

Figure Lengend Snippet: CRT-NPs showed efficient plasmid encapsulation, stability, and transfection efficiency. ( A ) CRT-NPs showed an increased hydrodynamic diameter and a reduced zeta potential compared to blank liposomes, with excellent stability in the physiological buffer for 3 days. ( B ) TEM images (scale bar—500 nm) of CRT-NPs stored in physiological buffer and obtained over four consecutive days demonstrated excellent morphological stability. ( C ). Agarose gel imaging showed that the CRT plasmid (pCRT) remained bound to the NPs, as no free pCRT was observed in the unlysed CRT-NP lane. In contrast, the released plasmid from triton-lysed CRT-NPs (~2.6 µg) exhibited a band corresponding to a 2.5 µg free pCRT band. ( D ) The transfection efficiency of CRT-NPs was confirmed using EGFP as a model plasmid. Significant GFP expression (green) was observed with transfected EGFP-NP CT26 cells at 48 h compared to the untreated control, unencapsulated NP, and free EGFP plasmid groups. ( E ) CRT-NPs induced cell death in transfected CT26 cells in a dose-dependent manner. ( F ) Transfected CRT-NP cells showed significant increase in CRT gene expression when compared to other groups in qRT-PCR. ( G ) CRT-NP-induced apoptosis was significant different compared to untreated control and comparable to positive controls such as DOX and LF™2000 + pCRT-treated cells. The statistical significance was indicated as * p < 0.05, ** p < 0.005, **** p < 0.0001.

Article Snippet: To visualize the transfection efficacy of NPs, CT26 cells were transfected with EGFP-NP lipoplexes (CLs/pDNA) ( D).

Techniques: Plasmid Preparation, Encapsulation, Transfection, Zeta Potential Analyzer, Liposomes, Agarose Gel Electrophoresis, Imaging, Expressing, Control, Gene Expression, Quantitative RT-PCR

Journal: Cell reports

Article Title: Thymidine rescues ATR kinase inhibitor-induced deoxyuridine contamination in genomic DNA, cell death, and interferon-α/β expression

doi: 10.1016/j.celrep.2022.111371

Figure Lengend Snippet: (A–D) Tissues were harvested on day 4 from CT26 tumor-bearing mice treated with 75 mg/kg AZD6738 (ATRi) or vehicle on days 1–3 and immunoprofiled. (A) Quantitation of TIL CD8 + T cells (per mg of tumor) and spleen and tumor-draining lymph node (DLN) CD8 + T cells (percentage of total CD45 + cells). (B) Representative contour plots of Ki67 + expression in CD8 + T cells in the TILs, spleen, and DLNs. (C) Quantitation of proliferating (Ki67 + ) CD8 + T cells in the TILs, spleen, and DLNs. (D) Quantitation of CD69 + CD8 + T cells in the TILs, spleen, and DLNs. (A–D) n = 7 mice (biological replicates) total (six DLNs for ATRi) from two independent experiments, each with 3–4 mice per arm. (A, C, and D) Mean and SD bars are shown. *p < 0.05, **p < 0.01, ****p < 0.0001, by two-tailed, unpaired t test.

Article Snippet: B16-F10 (ATCC CRL-6475) and CT26 (ATCC CRL-2638) were cultured in DMEM and RPMI, respectively (both Lonza), containing 10% FBS (GEMINI Bioproducts), 100 U/mL penicillin and 100 mg/mL streptomycin (Gibco).

Techniques: Quantitation Assay, Expressing, Two Tailed Test

Journal: Cell reports

Article Title: Thymidine rescues ATR kinase inhibitor-induced deoxyuridine contamination in genomic DNA, cell death, and interferon-α/β expression

doi: 10.1016/j.celrep.2022.111371

Figure Lengend Snippet: (A) CD8 + T cells were treated with either 15 μM A, C, and G or 6 μM dT, or high N at 22 h and 5 μM AZD6738 (ATRi) at 24 h. At 48 h, live CD8 + T cells (eFluor 780 − CD8 + TCRβ + ) were quantitated. (B) CTV histograms of live (eFluor 780 − CD44 hi CD8 + ) cells at 24 (gray) or 48 h (color) treated with nucleosides and ATRi as described in (A). Number of divisions is indicated. (C) CT26 cells were treated with 6 μM dT and 5 or 10 μM AZD6738 (ATRi) for 72 h, and cell viability was determined using CellTiter-Glo. (D and E) B16 cells were treated with 6 μM dT and 10 μM AZD6738 (ATRi) for (D) 72 or (E) 96 h, and cell viability was determined using CellTiter-Glo. (A and B) Three biological replicates; two technical replicates. (C and D) Two biological replicates; five technical replicates. (E) Three biological replicates; five technical replicates. (A and C–E) Mean and SD bars are shown. (A) **p < 0.01, ***p < 0.001, ****p < 0.0001, by one-way ANOVA with Tukey’s multiple comparisons. (C–E) Data from two (C and D) or three (E) independent experiments, each with five biological replicates. **p < 0.01, ****p < 0.0001, by one-way ANOVA with Sidak’s multiple comparisons (bars shown for all comparisons tested). ns, not significant.

Article Snippet: B16-F10 (ATCC CRL-6475) and CT26 (ATCC CRL-2638) were cultured in DMEM and RPMI, respectively (both Lonza), containing 10% FBS (GEMINI Bioproducts), 100 U/mL penicillin and 100 mg/mL streptomycin (Gibco).

Techniques:

Journal: Cell reports

Article Title: Thymidine rescues ATR kinase inhibitor-induced deoxyuridine contamination in genomic DNA, cell death, and interferon-α/β expression

doi: 10.1016/j.celrep.2022.111371

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: B16-F10 (ATCC CRL-6475) and CT26 (ATCC CRL-2638) were cultured in DMEM and RPMI, respectively (both Lonza), containing 10% FBS (GEMINI Bioproducts), 100 U/mL penicillin and 100 mg/mL streptomycin (Gibco).

Techniques: Recombinant, Protease Inhibitor, Saline, Staining, Membrane, Cell Isolation, Flow Cytometry, Purification, Fluorescence, Software

Journal: Frontiers in Pharmacology

Article Title: Natural Polysaccharides and Their Derivates: A Promising Natural Adjuvant for Tumor Immunotherapy

doi: 10.3389/fphar.2021.621813

Figure Lengend Snippet: The immunoregulatory activity of natural polysaccharides and their derivates on immune cells.

Article Snippet: , C57BL/6 (6 weeks old), BALB/c, OT-I and OT-II TCR transgenic mice and C57BL/6-Ly5.1 (CD45.1) congenic mice; TLR2, TLR4 and SR-A-KO mice; the murine melanoma cell line B16F10 (ATCC, CRL-6475) expressing OVA (B16-OVA) and murine carcinoma cell line CT26 (ATCC, CRL-2639) , Increase levels of co-stimulatory molecule expression and pro-inflammatory cytokine production in spleen DCs dependent on TLR4; enhance ovalbumin (OVA) antigen (Ag)-specific immune activation in tumor-bearing mice , .

Techniques: Activity Assay, Functional Assay, Expressing, Activation Assay, Membrane, Gene Expression, In Vivo, Protein-Protein interactions, Concentration Assay, Transgenic Assay, In Vitro, Phospho-proteomics, Isolation, Cell Culture, Modification, Control, Algae

Journal: Signal Transduction and Targeted Therapy

Article Title: XBP1 regulates the protumoral function of tumor-associated macrophages in human colorectal cancer

doi: 10.1038/s41392-021-00761-7

Figure Lengend Snippet: Effect of XBP1 activation on the pro-tumor function of TAMs. a Western blot analysis of XBP1s expression in indicated macrophages. b Representative micrograph showing tumor formation in NOD/SCID mice injected subcutaneously (s.c.) with luciferase tumor cells (CT26-luciferase) and two groups of macrophages: CT26 + BMDMs (black arrows) and CT26 + miTAMs (magenta arrows). c Growth curves of the two groups in b . d Western blot analysis of XBP1 expression in sgCon or sgXbp1 TAMs. e Representative photograph showing tumor formation in NOD/SCID mice injected s.c. with luciferase tumor cells (CT26-luciferase) and two groups of miTAMs: CT26 + sgCon miTAMs (black arrows); and CT26 + sgXbp1 miTAMs (blue arrows). f Growth curves of the two groups in e . **** P < 0.0001; Repeated measurement and analysis. g CT26 cells, mixed with: Con TAMs; Xbp1s TAMs; sgCon TAMs; and sgXbp1 TAMs, were orthotopically injected into the wall of the cecum ( n = 5 mice per group). Macroscopic appearance of the CRC orthotopic tumors with each indicated treatment. Black arrows indicate macroscopic polyps. Scale bar, 1 cm. h Representative HE staining of liver metastasis in mice xenografted of the four groups in g . Scale bar, 100 μm. i , j Statistical analysis of the orthotopic CRC tumor weight ( i ) and the clone number of liver metastasis ( j ). * P < 0.05, *** P < 0.001; t -test. k Incidence of orthotopic CRC tumor formation and liver metastasis analysis. l Representative images of CT26 pulmonary metastases induced by tail vein injection in NOD/SCID. CT26 cells were mixed with: Con miTAMs; Xbp1s miTAMs; sgCon miTAMs; and sgXbp1 miTAMs. HE staining demonstrating the histology of tumors formed in the lungs; scale bar, 500 μm. m Pulmonary metastatic nodule numbers in i . ( n = 4 mice per group); ** P < 0.01, *** P < 0.001; t -test

Article Snippet: Ana-1 (EP-CL-0023, RRID:CVCL_0142) and CT26 cells (EP-CL-0071, RRID:CVCL_7254) were from Elabscience (Texas, USA).

Techniques: Activation Assay, Western Blot, Expressing, Injection, Luciferase, Staining

Journal: Signal Transduction and Targeted Therapy

Article Title: XBP1 regulates the protumoral function of tumor-associated macrophages in human colorectal cancer

doi: 10.1038/s41392-021-00761-7

Figure Lengend Snippet: Effect of XBP1 on macrophages phagocytosis. a Representative images of phagocytosis assays using RFP-labeled human CRC cell, DLD1cells (DLD1-RFP) and sgCon or sgXBP1 hiTAMs ( n = 3). Yellow arrows denote phagocytic events. Scale bar = 200 μm. b Representative images of phagocytosis assays using RFP-labeled mouse CT26 cells (CT26-RFP) and sgCon or sgXbp1 miTAMs ( n = 3). Yellow arrows denote phagocytic events. Scale bar = 200 μm. c Results of phagocytosis assays of the two groups in a , b . ** P < 0.01; t -test. d Relative mRNA levels of XBP1 and phagocytosis-associated genes in BMDM, sgCon miTAMs and sgXbp1 miTAMs, validated by RT-qPCR. Bars represent mean ± SD of three experimental replicates. * P < 0.05, ** P < 0.01, *** P < 0.001; t -test. e Expression of THBS1 and SIRPα versus XBP1 in TAMs sorted from CRC patients ( n = 27 total). r , Spearman’s rank correlation test. f Correlation of XBP1 with THBS1 and SIRPα in CRC patients. The association was analyzed using coefficient measures of the linear relationships in the public GEO database (GSE68468). g Track view of Erdj4 , Thbs1 , and Sipra ChIP-seq density upon silencing of Xbp1 in the ChIP-seq online database (GSE86048). h ChIP-qPCR experiments measuring XBP1 binding on Erdj4 , Thbs1 , and Sipra segments. Bars represent mean ± SD of three experimental replicates. * P < 0.05, ** P < 0.01. P -values were determined using t -test

Article Snippet: Ana-1 (EP-CL-0023, RRID:CVCL_0142) and CT26 cells (EP-CL-0071, RRID:CVCL_7254) were from Elabscience (Texas, USA).

Techniques: Labeling, Quantitative RT-PCR, Expressing, ChIP-sequencing, ChIP-qPCR, Binding Assay

Journal: International Journal of Molecular Sciences

Article Title: Regulated Mesenchymal Stem Cells Mediated Colon Cancer Therapy Assessed by Reporter Gene Based Optical Imaging

doi: 10.3390/ijms19041002

Figure Lengend Snippet: Bystander effect of MSC-Tet-TK and MSC-TK cells. ( A ) Rluc activity in co-cultures (1:1) of naive MSCs and CT26/Rluc cells treated with the indicated concentrations of GCV for 48 h. ( B ) BLI images of the Rluc activity and quantitation data of CT26/Rluc in co-cultures (1:1) of MSC-TK or MSC-Tet-TK cells in the absence or presence of doxycycline (DOX(−) and DOX 2 μg/mL respectively). Three individual experiment values are expressed as the mean ± standard deviation (SD), * p < 0.05, ** p < 0.01, *** p < 0.001 (by Student’s t test). p/s, photons/second.

Article Snippet: CT26 cells were transduced with lentiviral particles expressing mCherry-Rluc (Renilla luciferase) under the control of the cytomegalovirus (CMV) promoter (Genecopoeia, Rockville, MD, USA).

Techniques: Activity Assay, Quantitation Assay, Standard Deviation

Journal: International Journal of Molecular Sciences

Article Title: Regulated Mesenchymal Stem Cells Mediated Colon Cancer Therapy Assessed by Reporter Gene Based Optical Imaging

doi: 10.3390/ijms19041002

Figure Lengend Snippet: In vivo therapeutic effect of MSC-Tet-TK and MSC-TK cells on inhibiting colon tumor growth. ( A ) Renilla luciferase (Rluc) imaging of colon cancer cells (CT26/Rluc) in mice treated with either MSC-TK or MSC-Tet-TK cells with or without concurrent GCV treatment. BLI images were taken on days 0, 6, and 13 in five individual mice; ( B ) Quantitative analysis of the data shown in ( A ). ( C ) Tumor weights assessed at study end. Bioluminescence activity is shown in photons/second (p/s). * p < 0.05 compared separately to MSC-Tet-TK (GCV−) and MSC-TK (GCV−).

Article Snippet: CT26 cells were transduced with lentiviral particles expressing mCherry-Rluc (Renilla luciferase) under the control of the cytomegalovirus (CMV) promoter (Genecopoeia, Rockville, MD, USA).

Techniques: In Vivo, Luciferase, Imaging, Activity Assay

Journal: Frontiers in Veterinary Science

Article Title: Detection of bimodal survivin expressions in canine cancer types by flow cytometry compared to immunohistochemistry

doi: 10.3389/fvets.2025.1552415

Figure Lengend Snippet: Analysis of survivin expression sites by IHC and WB. (A) Images of HE staining and survivin expression via IHC in canine melanoma cell lines (CMM2, CMeC, and LMeC) are shown. (B) Images of HE staining and survivin expression via IHC in murine cell lines (p815, CT26, and B16F10) are shown. (C) The cytosol and total survivin expression patterns via WB are indicated. (D) The expression levels of total survivin (blue bar) and cytosolic survivin (orange bar) corrected on the basis of β-actin expression are shown via density of plot analysis via ImageJ software.

Article Snippet: A total of six cell lines were used: canine malignant melanoma lines [CMM2, CMeC2, LMeC; provided by Dr. Takayuki Nakagawa, Department of Veterinary Surgery, University of Tokyo; ( )], the murine malignant melanoma line B16F10, the murine mast cell tumor line p815, and the murine colon cancer line CT26 (distributed for a fee by the JCRB Cell Bank).

Techniques: Expressing, Staining, Software