csf1 Search Results


93
Gold Biotechnology Inc recombinant mcsf
Cell surface differentiation marker characterization of polarized macrophages. M1 macrophages were polarized using indicated <t>stimuli:</t> <t>GMCSF</t> (20 ng/ml) for 5 days followed by LPS (10 ng/ml) and IFN-γ (20 ng/ml) for 2 days. M2 macrophages were polarized with: <t>MCSF</t> (10 ng/ml) for 5 days, IL-4 (20 ng/ml) and IL-13 (20 ng/ml) for 2 days. Polarized macrophages were stained with antibodies against the stated cell surface molecules and fluorescence was measured by flow cytometry. MFI values a were obtained using FlowJo software version 10.7.1 and histograms b from one representative experiment are shown. Bar graph represents mean ± SD, * p < 0.05, ** p < 0.005 with n = 4 for no apparent CAD, n = 3 for non-obstructive CAD and n = 7 for obstructive CAD
Recombinant Mcsf, supplied by Gold Biotechnology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant mcsf/product/Gold Biotechnology Inc
Average 93 stars, based on 1 article reviews
recombinant mcsf - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

95
Sino Biological recombinant mouse macrophage colony
Cell surface differentiation marker characterization of polarized macrophages. M1 macrophages were polarized using indicated <t>stimuli:</t> <t>GMCSF</t> (20 ng/ml) for 5 days followed by LPS (10 ng/ml) and IFN-γ (20 ng/ml) for 2 days. M2 macrophages were polarized with: <t>MCSF</t> (10 ng/ml) for 5 days, IL-4 (20 ng/ml) and IL-13 (20 ng/ml) for 2 days. Polarized macrophages were stained with antibodies against the stated cell surface molecules and fluorescence was measured by flow cytometry. MFI values a were obtained using FlowJo software version 10.7.1 and histograms b from one representative experiment are shown. Bar graph represents mean ± SD, * p < 0.05, ** p < 0.005 with n = 4 for no apparent CAD, n = 3 for non-obstructive CAD and n = 7 for obstructive CAD
Recombinant Mouse Macrophage Colony, supplied by Sino Biological, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant mouse macrophage colony/product/Sino Biological
Average 95 stars, based on 1 article reviews
recombinant mouse macrophage colony - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

93
Addgene inc full length human csf 1
Cell surface differentiation marker characterization of polarized macrophages. M1 macrophages were polarized using indicated <t>stimuli:</t> <t>GMCSF</t> (20 ng/ml) for 5 days followed by LPS (10 ng/ml) and IFN-γ (20 ng/ml) for 2 days. M2 macrophages were polarized with: <t>MCSF</t> (10 ng/ml) for 5 days, IL-4 (20 ng/ml) and IL-13 (20 ng/ml) for 2 days. Polarized macrophages were stained with antibodies against the stated cell surface molecules and fluorescence was measured by flow cytometry. MFI values a were obtained using FlowJo software version 10.7.1 and histograms b from one representative experiment are shown. Bar graph represents mean ± SD, * p < 0.05, ** p < 0.005 with n = 4 for no apparent CAD, n = 3 for non-obstructive CAD and n = 7 for obstructive CAD
Full Length Human Csf 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/full length human csf 1/product/Addgene inc
Average 93 stars, based on 1 article reviews
full length human csf 1 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

96
MedChemExpress hy p7085
Cell surface differentiation marker characterization of polarized macrophages. M1 macrophages were polarized using indicated <t>stimuli:</t> <t>GMCSF</t> (20 ng/ml) for 5 days followed by LPS (10 ng/ml) and IFN-γ (20 ng/ml) for 2 days. M2 macrophages were polarized with: <t>MCSF</t> (10 ng/ml) for 5 days, IL-4 (20 ng/ml) and IL-13 (20 ng/ml) for 2 days. Polarized macrophages were stained with antibodies against the stated cell surface molecules and fluorescence was measured by flow cytometry. MFI values a were obtained using FlowJo software version 10.7.1 and histograms b from one representative experiment are shown. Bar graph represents mean ± SD, * p < 0.05, ** p < 0.005 with n = 4 for no apparent CAD, n = 3 for non-obstructive CAD and n = 7 for obstructive CAD
Hy P7085, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hy p7085/product/MedChemExpress
Average 96 stars, based on 1 article reviews
hy p7085 - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

85
Thermo Fisher gene exp csf1 mm01200006 m1
Cell surface differentiation marker characterization of polarized macrophages. M1 macrophages were polarized using indicated <t>stimuli:</t> <t>GMCSF</t> (20 ng/ml) for 5 days followed by LPS (10 ng/ml) and IFN-γ (20 ng/ml) for 2 days. M2 macrophages were polarized with: <t>MCSF</t> (10 ng/ml) for 5 days, IL-4 (20 ng/ml) and IL-13 (20 ng/ml) for 2 days. Polarized macrophages were stained with antibodies against the stated cell surface molecules and fluorescence was measured by flow cytometry. MFI values a were obtained using FlowJo software version 10.7.1 and histograms b from one representative experiment are shown. Bar graph represents mean ± SD, * p < 0.05, ** p < 0.005 with n = 4 for no apparent CAD, n = 3 for non-obstructive CAD and n = 7 for obstructive CAD
Gene Exp Csf1 Mm01200006 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp csf1 mm01200006 m1/product/Thermo Fisher
Average 85 stars, based on 1 article reviews
gene exp csf1 mm01200006 m1 - by Bioz Stars, 2026-03
85/100 stars
  Buy from Supplier

89
Thermo Fisher gene exp csf1 mm00432688 m1
Cell surface differentiation marker characterization of polarized macrophages. M1 macrophages were polarized using indicated <t>stimuli:</t> <t>GMCSF</t> (20 ng/ml) for 5 days followed by LPS (10 ng/ml) and IFN-γ (20 ng/ml) for 2 days. M2 macrophages were polarized with: <t>MCSF</t> (10 ng/ml) for 5 days, IL-4 (20 ng/ml) and IL-13 (20 ng/ml) for 2 days. Polarized macrophages were stained with antibodies against the stated cell surface molecules and fluorescence was measured by flow cytometry. MFI values a were obtained using FlowJo software version 10.7.1 and histograms b from one representative experiment are shown. Bar graph represents mean ± SD, * p < 0.05, ** p < 0.005 with n = 4 for no apparent CAD, n = 3 for non-obstructive CAD and n = 7 for obstructive CAD
Gene Exp Csf1 Mm00432688 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp csf1 mm00432688 m1/product/Thermo Fisher
Average 89 stars, based on 1 article reviews
gene exp csf1 mm00432688 m1 - by Bioz Stars, 2026-03
89/100 stars
  Buy from Supplier

91
Thermo Fisher gene exp csf1 hs00174164 m1
Primers used for PCR amplifications and sequencing.
Gene Exp Csf1 Hs00174164 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp csf1 hs00174164 m1/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
gene exp csf1 hs00174164 m1 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

93
Proteintech csf1r antibody
Primers used for PCR amplifications and sequencing.
Csf1r Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/csf1r antibody/product/Proteintech
Average 93 stars, based on 1 article reviews
csf1r antibody - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

94
Sino Biological sino biological cat 11792 hnah
Primers used for PCR amplifications and sequencing.
Sino Biological Cat 11792 Hnah, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sino biological cat 11792 hnah/product/Sino Biological
Average 94 stars, based on 1 article reviews
sino biological cat 11792 hnah - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

94
MedChemExpress macrophage colony
Primers used for PCR amplifications and sequencing.
Macrophage Colony, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/macrophage colony/product/MedChemExpress
Average 94 stars, based on 1 article reviews
macrophage colony - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp csf1 mm00432686 m1
ATRA increased the expression of macrophage and osteoclast progenitor-related genes and Rank protein in periosteal bone cell cultures. The mRNA expression of Csf1r (mcsf-r) ( A ), Tnfrsf11a ( Rank ) ( B ), Irf8 ( C ) , Adgre1 (F4/80) ( D ), and Itgam ( CD11b ) ( E ) in periosteal bone cells cultured in control (CTRL) or ATRA-containing media(100 nM) for 7 and 11 days. The mRNA expression of Adgre1 (F4/80) ( F ) and Csf1r (mcsf-r) ( G ) in periosteal bone cell cultured in control (CTRL) media or with different doses of ATRA (0.01–100 nM) for 11 days. Lane view ( H ) and quantification ( I ) of RANK protein levels analyzed by capillary-based electrophoresis immunodetection (Simple Western) in cultures treated with CTRL or ATRA-containing media for 11 days (n = 4 replicate wells). Figures are displayed as scatter plots of replicate wells with mean ± SD. A , B , C , D , E , and I , unpaired, two-tailed Student’s t test at each time point, F and G , one-way ANOVA followed by Dunnett’s multiple comparison test versus control. ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. ATRA, all- trans retinoic acid; Csf1r , <t>CSF1</t> receptor; CSF1, colony-stimulating factor 1; M-CSF, macrophage colony-stimulating factor; Irf8 , interferon regulatory factor 8; RANK, receptor activator of nuclear factor kappa B.
Gene Exp Csf1 Mm00432686 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp csf1 mm00432686 m1/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
gene exp csf1 mm00432686 m1 - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

93
Sino Biological recombinant m csf
ATRA increased the expression of macrophage and osteoclast progenitor-related genes and Rank protein in periosteal bone cell cultures. The mRNA expression of Csf1r (mcsf-r) ( A ), Tnfrsf11a ( Rank ) ( B ), Irf8 ( C ) , Adgre1 (F4/80) ( D ), and Itgam ( CD11b ) ( E ) in periosteal bone cells cultured in control (CTRL) or ATRA-containing media(100 nM) for 7 and 11 days. The mRNA expression of Adgre1 (F4/80) ( F ) and Csf1r (mcsf-r) ( G ) in periosteal bone cell cultured in control (CTRL) media or with different doses of ATRA (0.01–100 nM) for 11 days. Lane view ( H ) and quantification ( I ) of RANK protein levels analyzed by capillary-based electrophoresis immunodetection (Simple Western) in cultures treated with CTRL or ATRA-containing media for 11 days (n = 4 replicate wells). Figures are displayed as scatter plots of replicate wells with mean ± SD. A , B , C , D , E , and I , unpaired, two-tailed Student’s t test at each time point, F and G , one-way ANOVA followed by Dunnett’s multiple comparison test versus control. ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. ATRA, all- trans retinoic acid; Csf1r , <t>CSF1</t> receptor; CSF1, colony-stimulating factor 1; M-CSF, macrophage colony-stimulating factor; Irf8 , interferon regulatory factor 8; RANK, receptor activator of nuclear factor kappa B.
Recombinant M Csf, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant m csf/product/Sino Biological
Average 93 stars, based on 1 article reviews
recombinant m csf - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


Cell surface differentiation marker characterization of polarized macrophages. M1 macrophages were polarized using indicated stimuli: GMCSF (20 ng/ml) for 5 days followed by LPS (10 ng/ml) and IFN-γ (20 ng/ml) for 2 days. M2 macrophages were polarized with: MCSF (10 ng/ml) for 5 days, IL-4 (20 ng/ml) and IL-13 (20 ng/ml) for 2 days. Polarized macrophages were stained with antibodies against the stated cell surface molecules and fluorescence was measured by flow cytometry. MFI values a were obtained using FlowJo software version 10.7.1 and histograms b from one representative experiment are shown. Bar graph represents mean ± SD, * p < 0.05, ** p < 0.005 with n = 4 for no apparent CAD, n = 3 for non-obstructive CAD and n = 7 for obstructive CAD

Journal: BMC Immunology

Article Title: Differential polarization and the expression of efferocytosis receptor MerTK on M1 and M2 macrophages isolated from coronary artery disease patients

doi: 10.1186/s12865-021-00410-2

Figure Lengend Snippet: Cell surface differentiation marker characterization of polarized macrophages. M1 macrophages were polarized using indicated stimuli: GMCSF (20 ng/ml) for 5 days followed by LPS (10 ng/ml) and IFN-γ (20 ng/ml) for 2 days. M2 macrophages were polarized with: MCSF (10 ng/ml) for 5 days, IL-4 (20 ng/ml) and IL-13 (20 ng/ml) for 2 days. Polarized macrophages were stained with antibodies against the stated cell surface molecules and fluorescence was measured by flow cytometry. MFI values a were obtained using FlowJo software version 10.7.1 and histograms b from one representative experiment are shown. Bar graph represents mean ± SD, * p < 0.05, ** p < 0.005 with n = 4 for no apparent CAD, n = 3 for non-obstructive CAD and n = 7 for obstructive CAD

Article Snippet: The adherent monocytes were cultured for 5 days in RPMI 1640 with stable glutamine media supplemented with 10% heat-inactivated fetal bovine serum (Capricorn Scientific, Germany), 1% penicillin-streptomycin (Nacalai Tesque, Japan), and 20 ng/ml recombinant GMCSF (Miltenyi Biotec, Germany) for M1 macrophage or 10 ng/ml recombinant MCSF (Gold Biotechnology, Missouri) to generate M2 macrophages.

Techniques: Marker, Staining, Fluorescence, Flow Cytometry, Software

Primers used for PCR amplifications and sequencing.

Journal: International Journal of Oncology

Article Title: Novel CSF1-S100A10 fusion gene and CSF1 transcript identified by RNA sequencing in tenosynovial giant cell tumors

doi: 10.3892/ijo.2014.2326

Figure Lengend Snippet: Primers used for PCR amplifications and sequencing.

Article Snippet: Assay Hs00174164_m1 was used for the expression of CSF1 .

Techniques: Sequencing

Standard curve analyses of the real-time PCR for the quantification of the expression of CSF1 transcripts 1, 4 and 5, and  CSF1-S100A10  .

Journal: International Journal of Oncology

Article Title: Novel CSF1-S100A10 fusion gene and CSF1 transcript identified by RNA sequencing in tenosynovial giant cell tumors

doi: 10.3892/ijo.2014.2326

Figure Lengend Snippet: Standard curve analyses of the real-time PCR for the quantification of the expression of CSF1 transcripts 1, 4 and 5, and CSF1-S100A10 .

Article Snippet: Assay Hs00174164_m1 was used for the expression of CSF1 .

Techniques: Real-time Polymerase Chain Reaction, Expressing, Purification

RT-PCR analysis of TSGCT. (A) cDNA fragment amplification using the primer set CSF1-1886F/S100A10-840R. (B) cDNA amplification of the wild-type S100A10 using the primer set S100A10-555F/S100A10-840R. (C) cDNA amplification of the CSF1 transcript 1 using the primer set CSF1-1886F/CSF1-2176R. (D) cDNA amplification of the CSF1 transcript 4 using the primer set CSF1-1886F/CSF1-trans42130R. Lane M, 1 kb Plus DNA ladder (GeneRuler, Fermentas); lane 1, cDNA from case 1; lane 2, cDNA from case 2; lane 3, cDNA from case 3; lane 4, cDNA synthesized from Human Universal Reference Total RNA (Takara); lane 5, blank, no RNA in cDNA synthesis. (E) Partial sequence chromatogram of the cDNA fragment amplified with the primer set CSF1-1886F/S100A10-840R showing the fusion of exon 8 of CSF1 with exon 3 of S100A10 . The stop codon TAG is in the box.

Journal: International Journal of Oncology

Article Title: Novel CSF1-S100A10 fusion gene and CSF1 transcript identified by RNA sequencing in tenosynovial giant cell tumors

doi: 10.3892/ijo.2014.2326

Figure Lengend Snippet: RT-PCR analysis of TSGCT. (A) cDNA fragment amplification using the primer set CSF1-1886F/S100A10-840R. (B) cDNA amplification of the wild-type S100A10 using the primer set S100A10-555F/S100A10-840R. (C) cDNA amplification of the CSF1 transcript 1 using the primer set CSF1-1886F/CSF1-2176R. (D) cDNA amplification of the CSF1 transcript 4 using the primer set CSF1-1886F/CSF1-trans42130R. Lane M, 1 kb Plus DNA ladder (GeneRuler, Fermentas); lane 1, cDNA from case 1; lane 2, cDNA from case 2; lane 3, cDNA from case 3; lane 4, cDNA synthesized from Human Universal Reference Total RNA (Takara); lane 5, blank, no RNA in cDNA synthesis. (E) Partial sequence chromatogram of the cDNA fragment amplified with the primer set CSF1-1886F/S100A10-840R showing the fusion of exon 8 of CSF1 with exon 3 of S100A10 . The stop codon TAG is in the box.

Article Snippet: Assay Hs00174164_m1 was used for the expression of CSF1 .

Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Synthesized, cDNA Synthesis, Sequencing

Analysis of the new CSF1 transcript 5 in TSGCT. (A) Localization of the BLAT results on the chromosome 1 as it is obtained from genome browser. (B) Results of the BLAT search with one of the reads (YourSeq) which contained the last 20 nt of exon 8 of CSF1 (agtgtagagggaattctaag; nt 2081–2091 in sequence with accession no. NM_000757) and extracted from the raw sequencing data. (C) The sequence of the YourSeq which was used for BLAT search. (D) 3′-RACE on the cases 1 and 2 amplified a single cDNA fragment. (E) Sequence of the 3′-RACE-amplified cDNA fragment. The stop codon TAG is in box. The vertical line is the junction between exon 8 of CSF1 and the new sequence on 1p13 which is 41 kb downstream from the currently known CSF1 locus. The red letters are the polyadenylation signals. The primer CSF1-3end-R1out is underlined. (F) RT-PCR amplification using CSF1-1886F/CSF1-3 end-R1out primer combination. In case 1 (lane 1) and case 2 (lane 2), a single cDNA fragment is amplified. In case 3 (lane 3), the control cDNA (lane 4) and blank (no RNA in cDNA) (lane 5), no fragments are amplified. M is 1 kb Plus DNA ladder (GeneRuler, Fermentas). (G) Partial sequence chromatogram of the cDNA fragment amplified with primers CSF1-1886F/CSF1-3end-R1out showing the fusion of exon 8 of CSF1 with the new 3′-end.

Journal: International Journal of Oncology

Article Title: Novel CSF1-S100A10 fusion gene and CSF1 transcript identified by RNA sequencing in tenosynovial giant cell tumors

doi: 10.3892/ijo.2014.2326

Figure Lengend Snippet: Analysis of the new CSF1 transcript 5 in TSGCT. (A) Localization of the BLAT results on the chromosome 1 as it is obtained from genome browser. (B) Results of the BLAT search with one of the reads (YourSeq) which contained the last 20 nt of exon 8 of CSF1 (agtgtagagggaattctaag; nt 2081–2091 in sequence with accession no. NM_000757) and extracted from the raw sequencing data. (C) The sequence of the YourSeq which was used for BLAT search. (D) 3′-RACE on the cases 1 and 2 amplified a single cDNA fragment. (E) Sequence of the 3′-RACE-amplified cDNA fragment. The stop codon TAG is in box. The vertical line is the junction between exon 8 of CSF1 and the new sequence on 1p13 which is 41 kb downstream from the currently known CSF1 locus. The red letters are the polyadenylation signals. The primer CSF1-3end-R1out is underlined. (F) RT-PCR amplification using CSF1-1886F/CSF1-3 end-R1out primer combination. In case 1 (lane 1) and case 2 (lane 2), a single cDNA fragment is amplified. In case 3 (lane 3), the control cDNA (lane 4) and blank (no RNA in cDNA) (lane 5), no fragments are amplified. M is 1 kb Plus DNA ladder (GeneRuler, Fermentas). (G) Partial sequence chromatogram of the cDNA fragment amplified with primers CSF1-1886F/CSF1-3end-R1out showing the fusion of exon 8 of CSF1 with the new 3′-end.

Article Snippet: Assay Hs00174164_m1 was used for the expression of CSF1 .

Techniques: Sequencing, Amplification, Reverse Transcription Polymerase Chain Reaction, Control

Expression analysis of the various CSF1 transcripts in a cDNA panel of eight cell lines. (A) Expression of CSF1 transcript 5. (B) Expression of CSF1 transcript 1. (C) Expression of CSF1 transcript 4. Expression analysis was performed using the human cell line MTC cDNA panel (Clontech). Lane 1, Ad5 cell line; lane 2, SKOV-3; lane 3, Saos2; lane 4, A431; lane 5, Du145; lane 6, H1299; lane 7, HeLa; lane 8, MCF7; lane 9, case 1 which was used as positive control; lane 10, blank (no RNA in cDNA). Lane M is 1 kb Plus DNA ladder (GeneRuler, Fermentas).

Journal: International Journal of Oncology

Article Title: Novel CSF1-S100A10 fusion gene and CSF1 transcript identified by RNA sequencing in tenosynovial giant cell tumors

doi: 10.3892/ijo.2014.2326

Figure Lengend Snippet: Expression analysis of the various CSF1 transcripts in a cDNA panel of eight cell lines. (A) Expression of CSF1 transcript 5. (B) Expression of CSF1 transcript 1. (C) Expression of CSF1 transcript 4. Expression analysis was performed using the human cell line MTC cDNA panel (Clontech). Lane 1, Ad5 cell line; lane 2, SKOV-3; lane 3, Saos2; lane 4, A431; lane 5, Du145; lane 6, H1299; lane 7, HeLa; lane 8, MCF7; lane 9, case 1 which was used as positive control; lane 10, blank (no RNA in cDNA). Lane M is 1 kb Plus DNA ladder (GeneRuler, Fermentas).

Article Snippet: Assay Hs00174164_m1 was used for the expression of CSF1 .

Techniques: Expressing, Positive Control

Real-time PCR to quantify the transcripts 1, 4 and 5 of CSF1 , CSF1-S100A10 and CSF1R in TSGCT. (A) Quantification of the CSF1 transcripts 5, 1 and 4 in cases 1 and 2, and CSF1-S100A10 , and CSF1 transcripts 1 and 4 in case 3. (B) Quantification of the expression of the CSF1 gene (all transcripts together) and its receptor CSF1R . The expression is presented as quantification cycle (Cq mean).

Journal: International Journal of Oncology

Article Title: Novel CSF1-S100A10 fusion gene and CSF1 transcript identified by RNA sequencing in tenosynovial giant cell tumors

doi: 10.3892/ijo.2014.2326

Figure Lengend Snippet: Real-time PCR to quantify the transcripts 1, 4 and 5 of CSF1 , CSF1-S100A10 and CSF1R in TSGCT. (A) Quantification of the CSF1 transcripts 5, 1 and 4 in cases 1 and 2, and CSF1-S100A10 , and CSF1 transcripts 1 and 4 in case 3. (B) Quantification of the expression of the CSF1 gene (all transcripts together) and its receptor CSF1R . The expression is presented as quantification cycle (Cq mean).

Article Snippet: Assay Hs00174164_m1 was used for the expression of CSF1 .

Techniques: Real-time Polymerase Chain Reaction, Expressing

ATRA increased the expression of macrophage and osteoclast progenitor-related genes and Rank protein in periosteal bone cell cultures. The mRNA expression of Csf1r (mcsf-r) ( A ), Tnfrsf11a ( Rank ) ( B ), Irf8 ( C ) , Adgre1 (F4/80) ( D ), and Itgam ( CD11b ) ( E ) in periosteal bone cells cultured in control (CTRL) or ATRA-containing media(100 nM) for 7 and 11 days. The mRNA expression of Adgre1 (F4/80) ( F ) and Csf1r (mcsf-r) ( G ) in periosteal bone cell cultured in control (CTRL) media or with different doses of ATRA (0.01–100 nM) for 11 days. Lane view ( H ) and quantification ( I ) of RANK protein levels analyzed by capillary-based electrophoresis immunodetection (Simple Western) in cultures treated with CTRL or ATRA-containing media for 11 days (n = 4 replicate wells). Figures are displayed as scatter plots of replicate wells with mean ± SD. A , B , C , D , E , and I , unpaired, two-tailed Student’s t test at each time point, F and G , one-way ANOVA followed by Dunnett’s multiple comparison test versus control. ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. ATRA, all- trans retinoic acid; Csf1r , CSF1 receptor; CSF1, colony-stimulating factor 1; M-CSF, macrophage colony-stimulating factor; Irf8 , interferon regulatory factor 8; RANK, receptor activator of nuclear factor kappa B.

Journal: The Journal of Biological Chemistry

Article Title: Vitamin A enhanced periosteal osteoclastogenesis is associated with increased number of tissue-derived macrophages/osteoclast progenitors

doi: 10.1016/j.jbc.2024.107308

Figure Lengend Snippet: ATRA increased the expression of macrophage and osteoclast progenitor-related genes and Rank protein in periosteal bone cell cultures. The mRNA expression of Csf1r (mcsf-r) ( A ), Tnfrsf11a ( Rank ) ( B ), Irf8 ( C ) , Adgre1 (F4/80) ( D ), and Itgam ( CD11b ) ( E ) in periosteal bone cells cultured in control (CTRL) or ATRA-containing media(100 nM) for 7 and 11 days. The mRNA expression of Adgre1 (F4/80) ( F ) and Csf1r (mcsf-r) ( G ) in periosteal bone cell cultured in control (CTRL) media or with different doses of ATRA (0.01–100 nM) for 11 days. Lane view ( H ) and quantification ( I ) of RANK protein levels analyzed by capillary-based electrophoresis immunodetection (Simple Western) in cultures treated with CTRL or ATRA-containing media for 11 days (n = 4 replicate wells). Figures are displayed as scatter plots of replicate wells with mean ± SD. A , B , C , D , E , and I , unpaired, two-tailed Student’s t test at each time point, F and G , one-way ANOVA followed by Dunnett’s multiple comparison test versus control. ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. ATRA, all- trans retinoic acid; Csf1r , CSF1 receptor; CSF1, colony-stimulating factor 1; M-CSF, macrophage colony-stimulating factor; Irf8 , interferon regulatory factor 8; RANK, receptor activator of nuclear factor kappa B.

Article Snippet: The following predesigned real-time PCR assays from Applied Biosystems were used for gene expression analysis: Acp5 ( Trap ; Mm00475698_m1), Ctsk (Mm00484036_m1), Calcr (Mm00432252_m1), Tnfrsf11a ( Rank ; Mm00437135_m1), Tnfsf11 (Rankl ; Mm00441908_m1), Tnfrsf11b ( Opg ; Mm00435452_m1), Csf1 ( Mcsf ; Mm00432686_m1), Csf1r ( M-csf-r; Mm01266652_m1), Nfatc1 (Mm00479445_m1), Adgre1 ( F4/80 ; Mm00802529_m1), Itgam ( CD11b ; Mm00434455_m1), Irf8 (Mm00492567_m1), Cd68 (Mm03047343_m1), and Il34 (Mm01243248_m1).

Techniques: Expressing, Cell Culture, Control, Electrophoresis, Immunodetection, Simple Western, Two Tailed Test, Comparison

ATRA did not alter the expression of macrophage and osteoclast progenitor-related genes in whole bone marrow cell cultures. The mRNA expression of Csf1r ( A ), Adgre1 (F4/80) ( B ), and Tnfrsf11a ( Rank ) ( C ) in bone marrow cells cultured in control (CTRL) or ATRA-containing media (100 nM) for 7 or 11 days. Figures are displayed as scatter plots of replicate wells with mean ± SD. No significant differences detected by unpaired, two-tailed student’s t test at each time point. Alkaline phosphatase and TRAP staining of bone marrow cells cultured in CTRL or ATRA-containing media for 7 or 11 days ( D ). The scale bars represent 200 μm. ATRA, all- trans retinoic acid; Csf1r , CSF1 receptor; RANK, receptor activator of nuclear factor kappa B; TRAP, tartrate resistant acid phosphatase.

Journal: The Journal of Biological Chemistry

Article Title: Vitamin A enhanced periosteal osteoclastogenesis is associated with increased number of tissue-derived macrophages/osteoclast progenitors

doi: 10.1016/j.jbc.2024.107308

Figure Lengend Snippet: ATRA did not alter the expression of macrophage and osteoclast progenitor-related genes in whole bone marrow cell cultures. The mRNA expression of Csf1r ( A ), Adgre1 (F4/80) ( B ), and Tnfrsf11a ( Rank ) ( C ) in bone marrow cells cultured in control (CTRL) or ATRA-containing media (100 nM) for 7 or 11 days. Figures are displayed as scatter plots of replicate wells with mean ± SD. No significant differences detected by unpaired, two-tailed student’s t test at each time point. Alkaline phosphatase and TRAP staining of bone marrow cells cultured in CTRL or ATRA-containing media for 7 or 11 days ( D ). The scale bars represent 200 μm. ATRA, all- trans retinoic acid; Csf1r , CSF1 receptor; RANK, receptor activator of nuclear factor kappa B; TRAP, tartrate resistant acid phosphatase.

Article Snippet: The following predesigned real-time PCR assays from Applied Biosystems were used for gene expression analysis: Acp5 ( Trap ; Mm00475698_m1), Ctsk (Mm00484036_m1), Calcr (Mm00432252_m1), Tnfrsf11a ( Rank ; Mm00437135_m1), Tnfsf11 (Rankl ; Mm00441908_m1), Tnfrsf11b ( Opg ; Mm00435452_m1), Csf1 ( Mcsf ; Mm00432686_m1), Csf1r ( M-csf-r; Mm01266652_m1), Nfatc1 (Mm00479445_m1), Adgre1 ( F4/80 ; Mm00802529_m1), Itgam ( CD11b ; Mm00434455_m1), Irf8 (Mm00492567_m1), Cd68 (Mm03047343_m1), and Il34 (Mm01243248_m1).

Techniques: Expressing, Cell Culture, Control, Two Tailed Test, Staining

Enhanced osteoclastogenesis by ATRA is not associated with enhanced CSF1 or IL-34. Periosteal cells cultured in control (CTRL), ATRA (100 nM), M-CSF (30 ng/ml), and/or anti-M-CSF–containing media (4 μg/ml). The expression of Csf1 (m-csf) mRNA ( A ) and Csf1/M-CSF protein in culture media ( B ) and periosteal bone cell lysates ( C ). The expression of Adgre1 (F4/80), Csf1r (mcsf-r), and Tnfrsf11a (Rank) mRNA in periosteal cell treated with CTRL, ATRA, or M-CSF for 10 days ( D ). The expression of Adgre1 (F4/80) ( E ) , Csf1r (mcsf-r) ( F ), and Tnfrsf11a (Rank) ( G ) mRNA in periosteal cell treated with CTRL, ATRA, anti-M-CSF or anti-M-CSF + ATRA for 10 days. Il34 mRNA ( H ) and IL34 protein in culture media ( I ) and periosteal bone cell lysates ( J ). The expression of Adgre1 (F4/80), Csf1r (mcsf-r), and Tnfrsf11a (Rank) mRNA in periosteal cell treated with CTRL, ATRA, or IL-34 for 10 days ( K ). Figures are displayed as scatter plots of replicate wells with mean ± SD. A , B , C , H , I , and J , unpaired, two-tailed Student’s t test at each time point, ( D and K ), one-way ANOVA followed by Dunnett’s multiple comparison test versus control for each gene. E – G , two-way ANOVA followed by Sidak’s multiple comparison test for the effect of ATRA in the presence and absence of anti-M-CSF. ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. ATRA, all- trans retinoic acid; CSF-1, colony-stimulating factor 1; Csf1r , CSF1 receptor; IL, interleukin; M-CSF, macrophage colony-stimulating factor; RANK, receptor activator of nuclear factor kappa B.

Journal: The Journal of Biological Chemistry

Article Title: Vitamin A enhanced periosteal osteoclastogenesis is associated with increased number of tissue-derived macrophages/osteoclast progenitors

doi: 10.1016/j.jbc.2024.107308

Figure Lengend Snippet: Enhanced osteoclastogenesis by ATRA is not associated with enhanced CSF1 or IL-34. Periosteal cells cultured in control (CTRL), ATRA (100 nM), M-CSF (30 ng/ml), and/or anti-M-CSF–containing media (4 μg/ml). The expression of Csf1 (m-csf) mRNA ( A ) and Csf1/M-CSF protein in culture media ( B ) and periosteal bone cell lysates ( C ). The expression of Adgre1 (F4/80), Csf1r (mcsf-r), and Tnfrsf11a (Rank) mRNA in periosteal cell treated with CTRL, ATRA, or M-CSF for 10 days ( D ). The expression of Adgre1 (F4/80) ( E ) , Csf1r (mcsf-r) ( F ), and Tnfrsf11a (Rank) ( G ) mRNA in periosteal cell treated with CTRL, ATRA, anti-M-CSF or anti-M-CSF + ATRA for 10 days. Il34 mRNA ( H ) and IL34 protein in culture media ( I ) and periosteal bone cell lysates ( J ). The expression of Adgre1 (F4/80), Csf1r (mcsf-r), and Tnfrsf11a (Rank) mRNA in periosteal cell treated with CTRL, ATRA, or IL-34 for 10 days ( K ). Figures are displayed as scatter plots of replicate wells with mean ± SD. A , B , C , H , I , and J , unpaired, two-tailed Student’s t test at each time point, ( D and K ), one-way ANOVA followed by Dunnett’s multiple comparison test versus control for each gene. E – G , two-way ANOVA followed by Sidak’s multiple comparison test for the effect of ATRA in the presence and absence of anti-M-CSF. ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. ATRA, all- trans retinoic acid; CSF-1, colony-stimulating factor 1; Csf1r , CSF1 receptor; IL, interleukin; M-CSF, macrophage colony-stimulating factor; RANK, receptor activator of nuclear factor kappa B.

Article Snippet: The following predesigned real-time PCR assays from Applied Biosystems were used for gene expression analysis: Acp5 ( Trap ; Mm00475698_m1), Ctsk (Mm00484036_m1), Calcr (Mm00432252_m1), Tnfrsf11a ( Rank ; Mm00437135_m1), Tnfsf11 (Rankl ; Mm00441908_m1), Tnfrsf11b ( Opg ; Mm00435452_m1), Csf1 ( Mcsf ; Mm00432686_m1), Csf1r ( M-csf-r; Mm01266652_m1), Nfatc1 (Mm00479445_m1), Adgre1 ( F4/80 ; Mm00802529_m1), Itgam ( CD11b ; Mm00434455_m1), Irf8 (Mm00492567_m1), Cd68 (Mm03047343_m1), and Il34 (Mm01243248_m1).

Techniques: Cell Culture, Control, Expressing, Two Tailed Test, Comparison

Oral treatment with ATRA increased the expression of macrophage and osteoclast progenitor related genes in periosteum in vivo . Mice were treated with ATRA (110 mg/kg/day) orally for three consecutive days and gene expression in tibia periosteum was analysed the day after the last treatment. The mRNA expression of Csf1r (mcsf-r) ( A ), Tnfrsf11a ( Rank ) ( B ), Irf8 ( C ) , Adgre1 (F4/80) ( D ) , Itgam ( CD11b ) ( E ), and CD68 ( F ) in the periosteum from ATRA and vehicle-treated mice. Figures are displayed as scatter plots of individual mice with mean ± SD. Unpaired, two-tailed Student’s t test. ∗ p < 0.05, ∗∗∗ p < 0.001. ATRA, all- trans retinoic acid; Csf1r , CSF1 receptor; Irf8 , interferon regulatory factor 8; M-CSF, macrophage colony-stimulating factor; RANK, receptor activator of nuclear factor kappa B.

Journal: The Journal of Biological Chemistry

Article Title: Vitamin A enhanced periosteal osteoclastogenesis is associated with increased number of tissue-derived macrophages/osteoclast progenitors

doi: 10.1016/j.jbc.2024.107308

Figure Lengend Snippet: Oral treatment with ATRA increased the expression of macrophage and osteoclast progenitor related genes in periosteum in vivo . Mice were treated with ATRA (110 mg/kg/day) orally for three consecutive days and gene expression in tibia periosteum was analysed the day after the last treatment. The mRNA expression of Csf1r (mcsf-r) ( A ), Tnfrsf11a ( Rank ) ( B ), Irf8 ( C ) , Adgre1 (F4/80) ( D ) , Itgam ( CD11b ) ( E ), and CD68 ( F ) in the periosteum from ATRA and vehicle-treated mice. Figures are displayed as scatter plots of individual mice with mean ± SD. Unpaired, two-tailed Student’s t test. ∗ p < 0.05, ∗∗∗ p < 0.001. ATRA, all- trans retinoic acid; Csf1r , CSF1 receptor; Irf8 , interferon regulatory factor 8; M-CSF, macrophage colony-stimulating factor; RANK, receptor activator of nuclear factor kappa B.

Article Snippet: The following predesigned real-time PCR assays from Applied Biosystems were used for gene expression analysis: Acp5 ( Trap ; Mm00475698_m1), Ctsk (Mm00484036_m1), Calcr (Mm00432252_m1), Tnfrsf11a ( Rank ; Mm00437135_m1), Tnfsf11 (Rankl ; Mm00441908_m1), Tnfrsf11b ( Opg ; Mm00435452_m1), Csf1 ( Mcsf ; Mm00432686_m1), Csf1r ( M-csf-r; Mm01266652_m1), Nfatc1 (Mm00479445_m1), Adgre1 ( F4/80 ; Mm00802529_m1), Itgam ( CD11b ; Mm00434455_m1), Irf8 (Mm00492567_m1), Cd68 (Mm03047343_m1), and Il34 (Mm01243248_m1).

Techniques: Expressing, In Vivo, Gene Expression, Two Tailed Test