Journal: Nature communications

Article Title: An unexpected protein interaction promotes drug resistance in leukemia.

doi: 10.1038/s41467-017-01678-y

Figure Lengend Snippet: Fig. 3 Peptides that block the ABCC4–MPP1 protein interaction reduce ABCC4 membrane localization and MPP1-driven hematopoietic progenitor replating in methylcellulose. a Representative image of ABCC4 membrane localization in cells transfected with ABCC4-GFP and MPP1 treated with either a cell penetrating peptide harboring the ABCC4-PDZ motif or lacking the PDZ motif (ABCC4ΔC). Blue-wheat germ agglutinin conjugated with Alexa Fluor 647, Red = Calreticuin-RFP, and Green = ABCC4-GFP. b Quantification of ABCC4 localization (n = 20 fields of view; bars represent SEM). c HPC were transduced with retroviral plasmid containing cDNAs for MPP1-ires-CFP or the empty vector, purified by FAC sorting and plated in methycellulose medium containing IL3, IL6, SCF, EPO and supplemented with cell penetrating peptide harboring the ABCC4-PDZ motif or lacking the PDZ-motif (ABCC4ΔC). Colonies were counted after 7 days growth and serially replated. Fresh peptide was added at each replating step (n = 3, bars represent SEM)

Article Snippet: HEK293 cells were seeded on chambered coverglass slides (LAB-TEK) 48 h before transfection with plasmid DNA (250 ng) encoding pAc-GFP-ABCC4 or ABCC4ΔC and pCal plasmid encoding the ER resident protein calreticulin conjugated to RFP (Origene).

Techniques: Blocking Assay, Membrane, Transfection, Transduction, Retroviral, Plasmid Preparation

Journal: Applied microbiology and biotechnology

Article Title: Α-synuclein and β-synuclein enhance secretion protein production in baculovirus expression vector system.

doi: 10.1007/s00253-012-4679-7

Figure Lengend Snippet: Fig. 1 Schematic construction of SEFP-based bi-cistronic recombi- nant virus vectors. These bi-cistronic vectors were used to identify potential genes which can enhance or reduce the protein production of the model protein, SEFP in BEVS. a The negative control recombinant virus vAc-HLJ1-Rhir-SE, b vAc-αsyn-Rhir-SE, c vAc-βsyn-Rhir-SE, and d a positive control, vAc-CALR-Rhir-SE. All expression cassettes are driven by the baculovirus polyhedrin promoter (Polh) and the candidate gene(s) and the target protein SEFP are separated by the RhPV 5′UTR IRES. STOP indicates the stop codon

Article Snippet: The H. sapiens calreticulin (CALR) gene was bought from Origene (item no. TC107910) and amplified by PCR with forward primer 5′ ATAGCTAGCCCACCATGCT GCTATCCGTGCCG 3′ and reverse primer 5′ CGCG AATTCCTACAGCTCGTCCTTGGC 3′ (NheI and EcoRI cutting sites are underlined), and was inserted in a similar way into pBac-Rhir-SEFP to generate pCALR-Rhir-SEFP.

Techniques: Virus, Negative Control, Recombinant, Positive Control, Expressing

Journal: Journal of Biological Chemistry

Article Title: Crucial Role for Phylogenetically Conserved Cytoplasmic Loop 3 in ABCC4 Protein Expression

doi: 10.1074/jbc.m113.476218

Figure Lengend Snippet: FIGURE 2. Mutation in the cytoplasmic loop3 region results in an unstable human and zebrafish ABCC4/Abcc4. A, immunoblots of whole cell lysates (100 g of protein per lane) prepared from NIH3T3 cells transfected with ZF Abcc4 WT and Abcc4 T804M mutant. Blots are probed with anti-GFP antibody. B, immunoblotofwholecelllysates(100gofproteinperlane)preparedfromNIH3T3cellstransfectedwithZFAbcc4WTtreatedwithPNGaseFandprobedwith anti-AcGFP antibody. C, in vitro translation products (35S-labeled) from TNT (coupled transcription and translation) (20 l/well) were run on 10% SDS-polyacryl- amide gel and detected using phosphorimager. D, confocal microscopy; E, quantification of NIH3T3-transfected cells with GFP-tagged Abcc4, Abcc4 T804M mutant, and RFP-tagged ER marker (calreticulin). Cells were analyzed by Leica spin disc confocal microscopy (63 magnification). Plasma membrane was stained with Alexa 646 wheat germ agglutinin (blue). Signals from the three channels were acquired independently, and the merged images are presented. Co-localization of Abcc4 WT and PM is indicated by a reddish blue and co-localization of GFP Abcc4 T804M and RFP-ER are indicated by a reddish yellow color. F, immunoblots of whole cell lysates (100 g of protein per lane) prepared from NIH3T3 cells transfected with human ABCC4 WT and ABCC4 T796M mutant. G, immunoblots of whole cell lysates (100 g of protein per lane) prepared from NIH3T3 cells transfected with human ABCC4 WT treated with PNGase F. H, in vitro translation products from TNT (coupled transcription and translation) (20 l/well) were run on 10% SDS-polyacrylamide gel and detected using phospho- rimager. I, confocal microscopy. J, quantification of HEK293 transfected cells with GFP-tagged human ABCC4 WT, ABCC T796M mutant, and RFP-tagged ER marker (calreticulin). Plasma membrane was stained with Alexa 646 wheat germ agglutinin (blue). Signals from the three channels were acquired indepen- dently, and the merged images are presented. Co-localization of ABCC4 WT and PM is indicated by a reddish blue, and co-localization of GFP ABCC4 T796M and RFP-ER is indicated by a yellow color. K, NIH3T3 cells were transfected with ABCC4 WT, T796M, and cycloheximide (final concentration, 50 g/ml) was added 24 h post-transfection. Cells were harvested at the indicated times and analyzed for ABCC4 proteins using anti-GFP antibody. Intensity of the bands (c or b) was analyzed using densitometry and expressed as percentage of ABCC4 protein at 0 h for each construct. Values shown are the mean from two independent experiments with the range indicated by the error bars.

Article Snippet: ConfocalMicroscopy—NIH3T3 orHEK293 cells were seeded on coverslips and chamber slides 24 h before transfection with the plasmid DNAs (250 ng) encoding pAcGFP ZF Abcc4, ZF Abcc4 T804M, ABCC4, ABCC4 T796M, and pCAL plasmid encoding RFP-tagged endoplasmic reticulum resident protein calreticulin encoding plasmid (pCAL (Origene) by using Lipofectamine LTX Plus reagent (Invitrogen))according to the manufacturer’s protocols.

Techniques: Mutagenesis, Western Blot, Transfection, In Vitro, Labeling, Confocal Microscopy, Marker, Clinical Proteomics, Membrane, Staining, Concentration Assay, Construct

Journal: Journal of Biological Chemistry

Article Title: Crucial Role for Phylogenetically Conserved Cytoplasmic Loop 3 in ABCC4 Protein Expression

doi: 10.1074/jbc.m113.476218

Figure Lengend Snippet: FIGURE 4. T804M peptide forms unstable helix compared with the ZF Abcc4 WT peptide. A, percentage of -helix is plotted versus temperature (K) from the data derived from in silico molecular dynamics analysis of WT ZF Abcc4 and T804M mutant peptide. B, immunoblot of whole cell lysates (100 g of protein/lane) prepared from NIH3T3 cells incubated at 28 °C for 24 h, 24 h after transfection with WT ZFAbcc4 and Abcc4 T804M, and blots were probed with anti-GFP antibody. C, zebrafish Abcc4 structural model was derived by homology based on the nucleotide-bound bacterial transporter Sav1866. D, Thr-804 at wild type zebrafish ABCC4 displays good contacts with Leu-717, Leu-720, and Arg-808; moreover, the hydroxyl group at the side chain of Thr-804 can form a hydrogen bond with the carbonyl group at Ser-800, which provides extra interaction for stabilizing the helical structure. E, side chain of Met-804 in ZF Abcc4 T804M, especially the position of Sulfur atom, seems highly solvent-accessible. The surrounding residues (Leu-719 and Arg-808) cannot effectively protect the sulfur atom in Met-804. E–G, three mutations of T804S, T804V, and T804D were modeled and analyzed. E, side chain of serine is shorter than methionine so that three hydrophobic residues (Ile-306, Leu-719, and Leu-720) and Arg-808 may protect it from the interruptions of the solvent molecules in T804S mutant. F, because of its hydrophobicity and relatively smaller size, the side chain of Val-804 in the T804V mutant shows good hydrophobic contacts with Arg-808, Leu-719, and Leu-720, and this may increase the stability of the protein structure. G, in T804D mutant, the side chain of Asp-804 can form a salt bridge with Arg-808,andthissaltbridgeisfurtherstabilizedbythecontactsofLeu-719.H,moleculardynamicanalysisofWTzebrafishAbcc4andT804M,T804S,T804V,and T804D mutant predicted that valine or aspartic acid can restore the stability of the helix region of CL3. I and J, immunoblots of whole cell lysates (100 g of protein/lane) prepared from NIH3T3 cells incubated at 37 °C 24 h after the transfection with WT ZF Abcc4 or its variants Abcc4 T804M, T804S, T804V, and T804D and probed with anti-GFP; as predicted by molecular dynamic analysis, T804V or T804D restores the expression almost equal to the WT. K, immunoblots of whole cell lysates (100 g of protein/lane) prepared from NIH3T3 cells incubated at 37 °C 24 h after the transfection with WT zebrafish Abcc4 or T804G. L, confocal microscopy of NIH3T3 transfected cells with GFP-tagged Abcc4 and Abcc4 mutants, and RFP-tagged ER marker (calreticulin). Cells were analyzed by confocal microscopy. Plasma membrane was stained with Alexa 646 wheat germ agglutinin (blue). Signals from the three channels were acquired independ- ently, and the merged images are presented. Co-localization of Abcc4 WT or its variants with plasma membrane is indicated by a reddish blue, and co-local- ization of GFP Abcc4 T804M and RFP-ER is indicated by a reddish yellow color.

Article Snippet: ConfocalMicroscopy—NIH3T3 orHEK293 cells were seeded on coverslips and chamber slides 24 h before transfection with the plasmid DNAs (250 ng) encoding pAcGFP ZF Abcc4, ZF Abcc4 T804M, ABCC4, ABCC4 T796M, and pCAL plasmid encoding RFP-tagged endoplasmic reticulum resident protein calreticulin encoding plasmid (pCAL (Origene) by using Lipofectamine LTX Plus reagent (Invitrogen))according to the manufacturer’s protocols.

Techniques: Derivative Assay, In Silico, Mutagenesis, Western Blot, Incubation, Transfection, Solvent, Expressing, Confocal Microscopy, Marker, Clinical Proteomics, Membrane, Staining

Journal: The Journal of Biological Chemistry

Article Title: Inhibition of Deoxyhypusine Synthase Enhances Islet ? Cell Function and Survival in the Setting of Endoplasmic Reticulum Stress and Type 2 Diabetes *

doi: 10.1074/jbc.M110.170142

Figure Lengend Snippet: Intracellular localization of eIF5A and DHS in response to Tg-induced ER stress. A, INS-1 (832/13) β cells were transfected with expression vectors encoding GFP-eIF5A, GFP-eIF5A(K50A), or GFP-DHS, and 24 h later were treated with Tg (1 μm) for 4 h. Images shown are representative live cell images (original magnification, ×400) taken in the green channel (488 nm excitation). Numbers in the lower left corner of each panel represent the cytoplasmic:nuclear ratio of green intensity from at least 10 cells, and an asterisk indicates that the number is statistically different (p < 0.05) from untreated cells. B, results of hypusination assays in vitro using recombinant eIF5A protein, [3H]spermidine, and cytoplasmic (C) or nuclear (N) extracts from INS-1 (832/13) cells. Labeling on the right indicates the positions of [3H]eIF5AHyp and unincorporated [3H]spermidine. C, representative images (original magnification, ×630) of INS-1 (832/13) β cells transfected with RFP-calreticulin and either GFP-eIF5A or GFP-eIF5A(K50A) and then counterstained with DAPI (upper row only). 24 h after transfection, cells were imaged in the green (488 nm excitation), red (580 nm excitation), and blue (DAPI, 365 nm excitation) channels and then merged. Upper and lower rows in C represent different cells viewed from separate transfections.

Article Snippet: A red fluorescent protein (RFP)-tagged calreticulin expression vector (Origene) was used to mark the endoplasmic reticulum. pEGFP-eIF5A, pEGFP-eIF5A(K50A) ( 13 ), pEGFP-DHPS, and RFP-calreticulin vector were transfected into INS-1 (832/13) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol.

Techniques: Transfection, Expressing, In Vitro, Recombinant, Labeling