control vector (aav-gfp Search Results


95
Vector Biolabs aav8
Aav8, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector+%28aav-gfp/pmc07470898-14-11-13?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
aav8 - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

93
Addgene inc aav gfap gfp cre vector
Aav Gfap Gfp Cre Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector+%28aav-gfp/bio_rxiv__2022__12__01__518727-99-10-36?v=Addgene+inc
Average 93 stars, based on 1 article reviews
aav gfap gfp cre vector - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
VectorBuilder GmbH aav5-gfp
<t>AAV5-mediated</t> overexpression of DUSP6 in dorsal hippocampus (dHc) of 5-month-old 5xFAD and WT mice. (A) Boxplot shows expression of hippocampal DUSP6 mRNA [Log 2 (counts per million reads)] in AD postmortem brain samples from the Mount Sinai Brain Bank (MSBB) stratified by clinical dementia rating CDR; r , Spearman’s correlation coefficient. n = 82–133/sex. (B) Boxplots compare the expression of hippocampal Dusp6 mRNA among female and male 5xFAD and WT mice at different ages using RNAseq data obtained from the AMP-AD portal (see 2 Materials and methods). n = 4–16/sex/age. (C) RT-PCR and (D) western blot analyses of DUSP6 overexpression in 5xFAD and WT, n = 9–10 mice/group. (E) Graph shows percentage of colocalization using Mander’s correlation coefficient, and the thresholded Mander’s M -values corresponding to the fraction of DUSP6 in NeuN (neurons), IBA1 (microglia), or GFAP (astrocytes) analyzed by the JACoP plugin from ImageJ, n = 6–9 mice/group. (F) Co-staining NeuN (left), GFAP (middle), or IBA1 (right) with DAPI and DUSP6 in hippocampi of WT-DUSP6 mice. (G) RNA scope images of IBA1 protein and Dusp6 mRNA in hippocampi of WT-DUSP6. Scale bars = 20, 50, or 200 μm. Error bars represent means ± SEM. Statistical analyses were performed using a one-way ANOVA followed by a Tukey’s post-hoc test, * p < 0.05, ** p < 0.01, **** p < 0.0001.
Aav5 Gfp, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector+%28aav-gfp/pmc11239576-38-0-4?v=VectorBuilder+GmbH
Average 90 stars, based on 1 article reviews
aav5-gfp - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Neurostar GmbH motorized stereotaxic system

Motorized Stereotaxic System, supplied by Neurostar GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector+%28aav-gfp/pmc10028007-389-17-52?v=Neurostar+GmbH
Average 90 stars, based on 1 article reviews
motorized stereotaxic system - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

95
Vector Biolabs aav fzd3 shrna gfp

Aav Fzd3 Shrna Gfp, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector+%28aav-gfp/pm24991956-221-13-14?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
aav fzd3 shrna gfp - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

93
Addgene inc chronos gfp wpre bgh

Chronos Gfp Wpre Bgh, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector+%28aav-gfp/pm39322037-61-0-5?v=Addgene+inc
Average 93 stars, based on 1 article reviews
chronos gfp wpre bgh - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

95
Vector Biolabs aav5 cmv egfp u6 shrna

Aav5 Cmv Egfp U6 Shrna, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector+%28aav-gfp/pmc08473726-119-16-20?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
aav5 cmv egfp u6 shrna - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

95
Vector Biolabs gfp 2a cre aavs

Gfp 2a Cre Aavs, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector+%28aav-gfp/pm36997609-117-25-28?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
gfp 2a cre aavs - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

95
Vector Biolabs control viruses carrying gfp

Control Viruses Carrying Gfp, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector+%28aav-gfp/pmc10028007-389-17-22?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
control viruses carrying gfp - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

95
Vector Biolabs ca v 3 1shrna

Ca V 3 1shrna, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector+%28aav-gfp/pmc12123693-38-6-19?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
ca v 3 1shrna - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

95
Vector Biolabs control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa

Control Virus Aav5 Gfp U6 Scrmb Shrna Caacaagatgaagagcaccaa, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector+%28aav-gfp/10__1523_slash_jneurosci__0406___21__2021-79-11-17?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

95
Vector Biolabs shrna sequence
Infusion of virus expressing Nrxn3 <t>shRNA</t> reduced the number of Nrxn3α positive cells. The central amygdala of Long Evans rats was infused with <t>AAV1</t> virus containing the construct AAV1-GFP-mNRXN3-shRNA or a scrambled shRNA. Four weeks after infusion the whisker pad was injected with MeWo cells without varicella zoster virus (no VZV) or MeWo cells containing varicella zoster virus. Six weeks after infusion the brain was isolated and the sections imaged. ( A ) is a low magnification image of a brain slice indicating green GFP fluorescence from expression of the virus construct in the central amygdala region (white oval). A high magnification image of the GFP positive cells (green) within the central amygdala is shown in ( B ). Bar = 20 micrometers. ( C ) shows a histogram for Nrxn3 expression within the central amygdala after infusion of AAV1 and injection of the whisker pad. Each point is from an individual animal. An asterisk indicates a significant difference of α=0.05.
Shrna Sequence, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector+%28aav-gfp/pmc11227312-49-26-29?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
shrna sequence - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

Image Search Results


AAV5-mediated overexpression of DUSP6 in dorsal hippocampus (dHc) of 5-month-old 5xFAD and WT mice. (A) Boxplot shows expression of hippocampal DUSP6 mRNA [Log 2 (counts per million reads)] in AD postmortem brain samples from the Mount Sinai Brain Bank (MSBB) stratified by clinical dementia rating CDR; r , Spearman’s correlation coefficient. n = 82–133/sex. (B) Boxplots compare the expression of hippocampal Dusp6 mRNA among female and male 5xFAD and WT mice at different ages using RNAseq data obtained from the AMP-AD portal (see 2 Materials and methods). n = 4–16/sex/age. (C) RT-PCR and (D) western blot analyses of DUSP6 overexpression in 5xFAD and WT, n = 9–10 mice/group. (E) Graph shows percentage of colocalization using Mander’s correlation coefficient, and the thresholded Mander’s M -values corresponding to the fraction of DUSP6 in NeuN (neurons), IBA1 (microglia), or GFAP (astrocytes) analyzed by the JACoP plugin from ImageJ, n = 6–9 mice/group. (F) Co-staining NeuN (left), GFAP (middle), or IBA1 (right) with DAPI and DUSP6 in hippocampi of WT-DUSP6 mice. (G) RNA scope images of IBA1 protein and Dusp6 mRNA in hippocampi of WT-DUSP6. Scale bars = 20, 50, or 200 μm. Error bars represent means ± SEM. Statistical analyses were performed using a one-way ANOVA followed by a Tukey’s post-hoc test, * p < 0.05, ** p < 0.01, **** p < 0.0001.

Journal: Frontiers in Aging Neuroscience

Article Title: Dual-specificity protein phosphatase 6 (DUSP6) overexpression reduces amyloid load and improves memory deficits in male 5xFAD mice

doi: 10.3389/fnagi.2024.1400447

Figure Lengend Snippet: AAV5-mediated overexpression of DUSP6 in dorsal hippocampus (dHc) of 5-month-old 5xFAD and WT mice. (A) Boxplot shows expression of hippocampal DUSP6 mRNA [Log 2 (counts per million reads)] in AD postmortem brain samples from the Mount Sinai Brain Bank (MSBB) stratified by clinical dementia rating CDR; r , Spearman’s correlation coefficient. n = 82–133/sex. (B) Boxplots compare the expression of hippocampal Dusp6 mRNA among female and male 5xFAD and WT mice at different ages using RNAseq data obtained from the AMP-AD portal (see 2 Materials and methods). n = 4–16/sex/age. (C) RT-PCR and (D) western blot analyses of DUSP6 overexpression in 5xFAD and WT, n = 9–10 mice/group. (E) Graph shows percentage of colocalization using Mander’s correlation coefficient, and the thresholded Mander’s M -values corresponding to the fraction of DUSP6 in NeuN (neurons), IBA1 (microglia), or GFAP (astrocytes) analyzed by the JACoP plugin from ImageJ, n = 6–9 mice/group. (F) Co-staining NeuN (left), GFAP (middle), or IBA1 (right) with DAPI and DUSP6 in hippocampi of WT-DUSP6 mice. (G) RNA scope images of IBA1 protein and Dusp6 mRNA in hippocampi of WT-DUSP6. Scale bars = 20, 50, or 200 μm. Error bars represent means ± SEM. Statistical analyses were performed using a one-way ANOVA followed by a Tukey’s post-hoc test, * p < 0.05, ** p < 0.01, **** p < 0.0001.

Article Snippet: AAV5-GFP (control), and AAV5-DUSP6 (VectorBuilder Inc., Chicago, IL; AAV-5′ITR-CAG-mDUSP6-WPRE-BGHpA-3′ITR) (AAV5 serotype/AAV2 genotype) were prepared by the Vector Core at the University of North Carolina at Chapel Hill.

Techniques: Over Expression, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Staining, RNAscope

Journal: Cell Metabolism

Article Title: Estradiol regulates leptin sensitivity to control feeding via hypothalamic Cited1

doi: 10.1016/j.cmet.2023.02.004

Figure Lengend Snippet:

Article Snippet: To ablate Cited1 , adeno-associated viruses carrying the Cre recombinase (AAV2/1-EF1a-EGFP-T2A-iCre, Vector Biolabs, Cat. No. VB2069) or control viruses carrying GFP (AAV2/1-EF1a-EGFP, Vector Biolabs, Cat. No. VB2084) were injected bilaterally (0.5 μl/side; 1x10 13 viral genomes/ml) into the MBH of Cited1 loxP/loxP mice (8-wk-old), as specified, using a motorized stereotaxic system from Neurostar (Tubingen, Germany).

Techniques: Virus, Plasmid Preparation, Recombinant, Enzyme-linked Immunosorbent Assay, RNAscope, Multiplex Assay, Diagnostic Assay, Gene Expression, Software

Journal: Cell Metabolism

Article Title: Estradiol regulates leptin sensitivity to control feeding via hypothalamic Cited1

doi: 10.1016/j.cmet.2023.02.004

Figure Lengend Snippet:

Article Snippet: To ablate Cited1 , adeno-associated viruses carrying the Cre recombinase (AAV2/1-EF1a-EGFP-T2A-iCre, Vector Biolabs, Cat. No. VB2069) or control viruses carrying GFP (AAV2/1-EF1a-EGFP, Vector Biolabs, Cat. No. VB2084) were injected bilaterally (0.5 μl/side; 1x10 13 viral genomes/ml) into the MBH of Cited1 loxP/loxP mice (8-wk-old), as specified, using a motorized stereotaxic system from Neurostar (Tubingen, Germany).

Techniques: Virus, Plasmid Preparation, Recombinant, Enzyme-linked Immunosorbent Assay, RNAscope, Multiplex Assay, Diagnostic Assay, Gene Expression, Software

Infusion of virus expressing Nrxn3 shRNA reduced the number of Nrxn3α positive cells. The central amygdala of Long Evans rats was infused with AAV1 virus containing the construct AAV1-GFP-mNRXN3-shRNA or a scrambled shRNA. Four weeks after infusion the whisker pad was injected with MeWo cells without varicella zoster virus (no VZV) or MeWo cells containing varicella zoster virus. Six weeks after infusion the brain was isolated and the sections imaged. ( A ) is a low magnification image of a brain slice indicating green GFP fluorescence from expression of the virus construct in the central amygdala region (white oval). A high magnification image of the GFP positive cells (green) within the central amygdala is shown in ( B ). Bar = 20 micrometers. ( C ) shows a histogram for Nrxn3 expression within the central amygdala after infusion of AAV1 and injection of the whisker pad. Each point is from an individual animal. An asterisk indicates a significant difference of α=0.05.

Journal: Journal of Pain Research

Article Title: Neurexin 3 Regulates Synaptic Connections Between Central Amygdala Neurons and Excitable Cells of the Lateral Parabrachial Nucleus in Rats with Varicella Zoster Induced Orofacial Pain

doi: 10.2147/JPR.S441706

Figure Lengend Snippet: Infusion of virus expressing Nrxn3 shRNA reduced the number of Nrxn3α positive cells. The central amygdala of Long Evans rats was infused with AAV1 virus containing the construct AAV1-GFP-mNRXN3-shRNA or a scrambled shRNA. Four weeks after infusion the whisker pad was injected with MeWo cells without varicella zoster virus (no VZV) or MeWo cells containing varicella zoster virus. Six weeks after infusion the brain was isolated and the sections imaged. ( A ) is a low magnification image of a brain slice indicating green GFP fluorescence from expression of the virus construct in the central amygdala region (white oval). A high magnification image of the GFP positive cells (green) within the central amygdala is shown in ( B ). Bar = 20 micrometers. ( C ) shows a histogram for Nrxn3 expression within the central amygdala after infusion of AAV1 and injection of the whisker pad. Each point is from an individual animal. An asterisk indicates a significant difference of α=0.05.

Article Snippet: In a separate group of Long Evans rats, the central amygdala was infused with 1 µL of 1 × 10 13 TU/mL AAV1 containing a scrambled shRNA sequence (AAV1-GFP-U6-shRNA, Vector Biolabs) mixed 1 to 1 with the synaptophysin construct.

Techniques: Virus, Expressing, shRNA, Construct, Whisker Assay, Injection, Isolation, Slice Preparation, Fluorescence

Synaptophysin was expressed in GABAergic cells of the central amygdala. The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby. During this same surgery the central amygdala was infused with the shRNA viral construct. Image is from a representative rat infused with control shRNA and injected with no VZV. ( A ) Six weeks after infusion mRuby fluorescent signal (red) was detected within the central amygdala (CeA). White dotted line shows the borders of the central amygdala. Arrow points to the injection site ( A and B ). Enlarged image of synaptophysin positive cell (red, arrow) within the central amygdala is shown in ( C ). Hoechst 33342 stain of the nuclei from the same cell (arrow) is shown in blue ( D ). Bar= 100 µm.

Journal: Journal of Pain Research

Article Title: Neurexin 3 Regulates Synaptic Connections Between Central Amygdala Neurons and Excitable Cells of the Lateral Parabrachial Nucleus in Rats with Varicella Zoster Induced Orofacial Pain

doi: 10.2147/JPR.S441706

Figure Lengend Snippet: Synaptophysin was expressed in GABAergic cells of the central amygdala. The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby. During this same surgery the central amygdala was infused with the shRNA viral construct. Image is from a representative rat infused with control shRNA and injected with no VZV. ( A ) Six weeks after infusion mRuby fluorescent signal (red) was detected within the central amygdala (CeA). White dotted line shows the borders of the central amygdala. Arrow points to the injection site ( A and B ). Enlarged image of synaptophysin positive cell (red, arrow) within the central amygdala is shown in ( C ). Hoechst 33342 stain of the nuclei from the same cell (arrow) is shown in blue ( D ). Bar= 100 µm.

Article Snippet: In a separate group of Long Evans rats, the central amygdala was infused with 1 µL of 1 × 10 13 TU/mL AAV1 containing a scrambled shRNA sequence (AAV1-GFP-U6-shRNA, Vector Biolabs) mixed 1 to 1 with the synaptophysin construct.

Techniques: shRNA, Construct, Control, Injection, Staining

Synaptophysin positive terminals colocalize with excitable cells in the lateral parabrachial nucleus. Atlas image of coronal brain section from a rat with the lateral parabrachial region outlined with a black dotted line in ( A ). The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby. Excitable cells within the lateral parabrachial nucleus were labeled by infusing the lateral parabrachial nucleus with AAV5 virus containing pAAV-CaMKIIa-EGFP. Six weeks after infusion EGFP positive cells (green, ( B ) were present within the lateral parabrachial region (white dotted line). In ( B ), a low magnification image is shown on the left and a higher magnification image is shown on the right. EGFP positive cells (green) are shown in ( C, F, I and L ) and synaptophysin (red) is shown in ( C (through ( N )). Cell nuclei are labeled blue with Hoechst 33342 stain in ( B–D, F, G, I, J, L and M ). ( F ) through ( N ) are images through the z plane of the lateral parabrachial tissue. ( F, I and L ) are three different z plane cross sections, respectively, through the cell in ( C ) (open arrow). ( F–H ) show one z plane slice through the cell, ( I–K ) show the second slice and ( L–N ) are the third slice through the cell. Synaptophysin labeled puncta on the CaMKII positive cell was indicated by small white arrows in ( I–N ). Bar = 50 µm in ( B ) and 5 µm in ( C ).

Journal: Journal of Pain Research

Article Title: Neurexin 3 Regulates Synaptic Connections Between Central Amygdala Neurons and Excitable Cells of the Lateral Parabrachial Nucleus in Rats with Varicella Zoster Induced Orofacial Pain

doi: 10.2147/JPR.S441706

Figure Lengend Snippet: Synaptophysin positive terminals colocalize with excitable cells in the lateral parabrachial nucleus. Atlas image of coronal brain section from a rat with the lateral parabrachial region outlined with a black dotted line in ( A ). The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby. Excitable cells within the lateral parabrachial nucleus were labeled by infusing the lateral parabrachial nucleus with AAV5 virus containing pAAV-CaMKIIa-EGFP. Six weeks after infusion EGFP positive cells (green, ( B ) were present within the lateral parabrachial region (white dotted line). In ( B ), a low magnification image is shown on the left and a higher magnification image is shown on the right. EGFP positive cells (green) are shown in ( C, F, I and L ) and synaptophysin (red) is shown in ( C (through ( N )). Cell nuclei are labeled blue with Hoechst 33342 stain in ( B–D, F, G, I, J, L and M ). ( F ) through ( N ) are images through the z plane of the lateral parabrachial tissue. ( F, I and L ) are three different z plane cross sections, respectively, through the cell in ( C ) (open arrow). ( F–H ) show one z plane slice through the cell, ( I–K ) show the second slice and ( L–N ) are the third slice through the cell. Synaptophysin labeled puncta on the CaMKII positive cell was indicated by small white arrows in ( I–N ). Bar = 50 µm in ( B ) and 5 µm in ( C ).

Article Snippet: In a separate group of Long Evans rats, the central amygdala was infused with 1 µL of 1 × 10 13 TU/mL AAV1 containing a scrambled shRNA sequence (AAV1-GFP-U6-shRNA, Vector Biolabs) mixed 1 to 1 with the synaptophysin construct.

Techniques: Labeling, Virus, Staining

Synaptophysin and CaMKII expression in the lateral parabrachial nucleus. In these rats the central amygdala was infused with virus expressing a scrambled shRNA or a Nrxn3 shRNA. The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby. Excitable cells within the lateral parabrachial nucleus were labeled by infusing this nucleus with AAV5 virus containing pAAV-CaMKIIa-EGFP. After four weeks post-surgery the whisker pad of the infused rats were injected with MeWo cells without varicella zoster virus (no VZV) or MeWo cells containing VZV. Two weeks after injection the brain was isolated and imaged. ( A ) shows the average number of synaptophysin terminals or puncta localized to each CaMKII positive cell within the lateral parabrachial nucleus. Representative images of rats treated with control shRNA/no VZV ( B–E ) or control shRNA/VZV ( F–I ) or Nrxn3 shRNA/no VZV ( J–M ) or Nrxn3 shRNA/VZV ( N–Q ) are shown. Hoechst 33342 nuclear stain ( B, F, J and N ) and CaMKII stain ( C, G, K and O ) and synaptophysin stain ( D, H, L and P ) is represented in several cells . Individual CaMKII positive cells (green) are outlined with a white dotted line. Arrows point to synaptophysin positive puncta (red, D, H, L and P ) colocalizing with CaMKII staining ( E, I, M and Q ). Bar = 10 µm. Panel R shows the number of CaMKII positive cells in the lateral parabrachial nucleus that colocalized with synaptophysin. Each point is from an individual animal in panels A and R. An asterisk indicates a significant difference of α=0.05. Representative images of rats treated with control shRNA/no VZV ( S ) or control shRNA/VZV ( T ) or Nrxn3 shRNA/no VZV ( U ) or Nrxn3 shRNA/VZV ( V ) show cells with synaptophysin stain colocalizing with CaMKII stain (yellow, arrows). Bar = 50 µm.

Journal: Journal of Pain Research

Article Title: Neurexin 3 Regulates Synaptic Connections Between Central Amygdala Neurons and Excitable Cells of the Lateral Parabrachial Nucleus in Rats with Varicella Zoster Induced Orofacial Pain

doi: 10.2147/JPR.S441706

Figure Lengend Snippet: Synaptophysin and CaMKII expression in the lateral parabrachial nucleus. In these rats the central amygdala was infused with virus expressing a scrambled shRNA or a Nrxn3 shRNA. The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby. Excitable cells within the lateral parabrachial nucleus were labeled by infusing this nucleus with AAV5 virus containing pAAV-CaMKIIa-EGFP. After four weeks post-surgery the whisker pad of the infused rats were injected with MeWo cells without varicella zoster virus (no VZV) or MeWo cells containing VZV. Two weeks after injection the brain was isolated and imaged. ( A ) shows the average number of synaptophysin terminals or puncta localized to each CaMKII positive cell within the lateral parabrachial nucleus. Representative images of rats treated with control shRNA/no VZV ( B–E ) or control shRNA/VZV ( F–I ) or Nrxn3 shRNA/no VZV ( J–M ) or Nrxn3 shRNA/VZV ( N–Q ) are shown. Hoechst 33342 nuclear stain ( B, F, J and N ) and CaMKII stain ( C, G, K and O ) and synaptophysin stain ( D, H, L and P ) is represented in several cells . Individual CaMKII positive cells (green) are outlined with a white dotted line. Arrows point to synaptophysin positive puncta (red, D, H, L and P ) colocalizing with CaMKII staining ( E, I, M and Q ). Bar = 10 µm. Panel R shows the number of CaMKII positive cells in the lateral parabrachial nucleus that colocalized with synaptophysin. Each point is from an individual animal in panels A and R. An asterisk indicates a significant difference of α=0.05. Representative images of rats treated with control shRNA/no VZV ( S ) or control shRNA/VZV ( T ) or Nrxn3 shRNA/no VZV ( U ) or Nrxn3 shRNA/VZV ( V ) show cells with synaptophysin stain colocalizing with CaMKII stain (yellow, arrows). Bar = 50 µm.

Article Snippet: In a separate group of Long Evans rats, the central amygdala was infused with 1 µL of 1 × 10 13 TU/mL AAV1 containing a scrambled shRNA sequence (AAV1-GFP-U6-shRNA, Vector Biolabs) mixed 1 to 1 with the synaptophysin construct.

Techniques: Expressing, Virus, shRNA, Labeling, Whisker Assay, Injection, Isolation, Control, Staining

Prodynorphin cells within the lateral parabrachial nucleus. The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby. Excitable cells within the lateral parabrachial nucleus were labeled by infusing this nucleus with AAV5 virus containing pAAV-CaMKIIa-EGFP. Four weeks after infusion the whisker pad was injected with either no VZV or VZV. Six weeks after infusion brain sections of the treated rats were immunostained for prodynorphin. In ( A and B ) multiple prodynorphin positive (red) cells were imaged in the lateral parabrachial nucleus (LPB). Prodynorphin is a marker for neurons involved in pain. Cell nuclei are labeled blue with Hoechst 33342 in ( A – C ). ( B ) shows only the prodynorphin cells (red) from the same region and ( C ) shows only the EGFP positive cells (green). A higher magnification image of the LPB is shown in ( D ) and cells that colocalize prodynorphin and EGFP are yellow. Insert in ( D ) is an image through the z plane of the lateral parabrachial nucleus after staining for prodynorphin. Prodynorphin is red, EGFP is green and synaptophysin terminals are in yellow for the insert image in ( D ). Images are from a representative rat that was treated with Nrxn3 shRNA and VZV. scp = superior cerebellar peduncle. Bar= 20 µm. The histogram in ( E ) shows the number of EGFP/prodynorphin positive cells that colocalized with synaptophysin in the lateral parabrachial nucleus after knockdown of Nrxn3α in the central amygdala. Each point is from an individual animal. An asterisk indicates a significant difference of α=0.05. Representative images of rats treated with control shRNA/no VZV ( F ) or control shRNA/VZV ( G ) or Nrxn3 shRNA/no VZV ( H ) or Nrxn3 shRNA/VZV ( I ) show cells with synaptophysin stain colocalizing with prodynorphin stain (yellow, arrows). Bar = 50 µm.

Journal: Journal of Pain Research

Article Title: Neurexin 3 Regulates Synaptic Connections Between Central Amygdala Neurons and Excitable Cells of the Lateral Parabrachial Nucleus in Rats with Varicella Zoster Induced Orofacial Pain

doi: 10.2147/JPR.S441706

Figure Lengend Snippet: Prodynorphin cells within the lateral parabrachial nucleus. The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby. Excitable cells within the lateral parabrachial nucleus were labeled by infusing this nucleus with AAV5 virus containing pAAV-CaMKIIa-EGFP. Four weeks after infusion the whisker pad was injected with either no VZV or VZV. Six weeks after infusion brain sections of the treated rats were immunostained for prodynorphin. In ( A and B ) multiple prodynorphin positive (red) cells were imaged in the lateral parabrachial nucleus (LPB). Prodynorphin is a marker for neurons involved in pain. Cell nuclei are labeled blue with Hoechst 33342 in ( A – C ). ( B ) shows only the prodynorphin cells (red) from the same region and ( C ) shows only the EGFP positive cells (green). A higher magnification image of the LPB is shown in ( D ) and cells that colocalize prodynorphin and EGFP are yellow. Insert in ( D ) is an image through the z plane of the lateral parabrachial nucleus after staining for prodynorphin. Prodynorphin is red, EGFP is green and synaptophysin terminals are in yellow for the insert image in ( D ). Images are from a representative rat that was treated with Nrxn3 shRNA and VZV. scp = superior cerebellar peduncle. Bar= 20 µm. The histogram in ( E ) shows the number of EGFP/prodynorphin positive cells that colocalized with synaptophysin in the lateral parabrachial nucleus after knockdown of Nrxn3α in the central amygdala. Each point is from an individual animal. An asterisk indicates a significant difference of α=0.05. Representative images of rats treated with control shRNA/no VZV ( F ) or control shRNA/VZV ( G ) or Nrxn3 shRNA/no VZV ( H ) or Nrxn3 shRNA/VZV ( I ) show cells with synaptophysin stain colocalizing with prodynorphin stain (yellow, arrows). Bar = 50 µm.

Article Snippet: In a separate group of Long Evans rats, the central amygdala was infused with 1 µL of 1 × 10 13 TU/mL AAV1 containing a scrambled shRNA sequence (AAV1-GFP-U6-shRNA, Vector Biolabs) mixed 1 to 1 with the synaptophysin construct.

Techniques: Labeling, Virus, Whisker Assay, Injection, Marker, Staining, shRNA, Knockdown, Control