control strain mruby2 Search Results


control strain mruby2  (Addgene inc)
92
Addgene inc control strain mruby2
List of yeast strains used in this study.
Control Strain Mruby2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/control strain mruby2/product/Addgene inc
Average 92 stars, based on 1 article reviews
control strain mruby2 - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

Image Search Results


List of yeast strains used in this study.

Journal: FEMS Yeast Research

Article Title: Development of an Haa1-based biosensor for acetic acid sensing in Saccharomyces cerevisiae

doi: 10.1093/femsyr/foab049

Figure Lengend Snippet: List of yeast strains used in this study.

Article Snippet: The control strain mRuby2+ containing the mRuby2 reporter directly fused to the C-termini of RPL13A encoding a ribosomal protein was constructed using the CRISPR/Cas9 technology, transforming a cut EC2_5 vector (Cámara, Lenitz and Nygård ) with an sgRNA targeting the RPL13A locus (GAAGGAAAATACAAAAATTG) and a dDNA containing the mRuby2 ORF amplified from pYTK034 (Addgene #65141) using primers with 40-bp sequences for in vivo homologous recombination.

Techniques:

Schematic presentation of the biosensor and control constructs. For strain details, see Table . Haa1 with fusion proteins is expected to relocate to the nucleus upon acetic acid exposure. The biosensor output is the expression of the reporter ( mRuby2 or mCherry ), expressed under various synthetic promoters. Sizes of promoters and genes are scaled to represent their actual sizes and added BSs for the sTFs are indicated with black bars inside the promoters. Red arrows labeled with R and C refer to the mRuby2 or mCherry reporter genes. Cyan arrows labeled with T and BHT refer to mTurquoise2 or BM3R1-HAA1-mTurquoise2 .

Journal: FEMS Yeast Research

Article Title: Development of an Haa1-based biosensor for acetic acid sensing in Saccharomyces cerevisiae

doi: 10.1093/femsyr/foab049

Figure Lengend Snippet: Schematic presentation of the biosensor and control constructs. For strain details, see Table . Haa1 with fusion proteins is expected to relocate to the nucleus upon acetic acid exposure. The biosensor output is the expression of the reporter ( mRuby2 or mCherry ), expressed under various synthetic promoters. Sizes of promoters and genes are scaled to represent their actual sizes and added BSs for the sTFs are indicated with black bars inside the promoters. Red arrows labeled with R and C refer to the mRuby2 or mCherry reporter genes. Cyan arrows labeled with T and BHT refer to mTurquoise2 or BM3R1-HAA1-mTurquoise2 .

Article Snippet: The control strain mRuby2+ containing the mRuby2 reporter directly fused to the C-termini of RPL13A encoding a ribosomal protein was constructed using the CRISPR/Cas9 technology, transforming a cut EC2_5 vector (Cámara, Lenitz and Nygård ) with an sgRNA targeting the RPL13A locus (GAAGGAAAATACAAAAATTG) and a dDNA containing the mRuby2 ORF amplified from pYTK034 (Addgene #65141) using primers with 40-bp sequences for in vivo homologous recombination.

Techniques: Construct, Expressing, Labeling