Journal: Biomedicines

Article Title: Whole Exome Sequencing Identifies PHF14 Mutations in Neurocytoma and Predicts Responsivity to the PDGFR Inhibitor Sunitinib

doi: 10.3390/biomedicines10112842

Figure Lengend Snippet: PHF14 Depletion Enhances Cell Proliferation and Anchorage Independent Cell Growth. ( A ) A conserved 19-bp region in the human, mouse and rat PHF14 gene in Exon 10 (CGC ATG ATT CAA ATT CAG GAA) was selected as shRNA target to knockdown PHF14 expression. Five cell lines originating from human, mouse and rat were used to evaluate the biological effect of PHF14 depletion. PHF14 knockdown stable transfectants were established by puromycin selection, and the knockdown efficiency was determined by Western Blot using anti-PHF14 antibody. The densitometric analyses of the protein bands vs. the individual loading controls were shown under individual blot using the ImageQuant 5.2 software (GE Healthcare, Pittsburgh, PA). ( B ) Cell proliferation rate was enhanced in shRNA PHF4 knockdown transfectants compared to Nonsense controls as measured by CellTiter-Glo ® luminescent cell viability assay in a variety of cell lines. ( C ) Soft agar assay demonstrated that PHF14 knockdown induced an increase in colony size in human neuroblastoma SHSY-5Y cells. ( D ) A single guiding RNA (sgRNA) targeting a 20-bp region (TGG ATC GCA GCT CCA AGA GG) in PHF14 Exon 1 was designed for CRISPR-Cas9 mediated genetic editing. The knockout efficiency was confirmed by Western Blot. PHF14 knockout in human neuroblastoma SHSY-5Y cells promoted cell proliferation as measured by CellTiter-Glo ® luminescent cell viability assay. PHF14 knockout increased colony formation in soft agar assay. The results shown were representative of three independent experiments. * p < 0.05; ** p < 0.01; *** p < 0.001.

Article Snippet: ShRNA PHF14 (TRCN0000312505) was purchased from Sigma-Aldrich Corp. sgRNA/Cas9 all-in-one expression clone targeting PHF14 (HCP223067-CG01-3-B) and scrambled sgRNA control were from GeneCopoeia, Inc. (Rockville, MD, USA).

Techniques: shRNA, Knockdown, Expressing, Selection, Western Blot, Software, Cell Viability Assay, Soft Agar Assay, CRISPR, Knock-Out

Journal: Cancer discovery

Article Title: The AMPK-related kinases SIK1 and SIK3 mediate key tumor suppressive effects of LKB1 in NSCLC.

doi: 10.1158/2159-8290.CD-18-1261

Figure Lengend Snippet: (A) Schematic of the experimental design using pSECC lentivirus to deliver Cre-recombinase, Cas9 and a Sik1 or Sik3 sgRNA as a single payload to the lungs of KrasG12D-mice (K) and Kras-Sik1 floxed mice (KSik1) after intratracheal virus delivery.

Article Snippet: As a cohort, KPSik1 mice showed an increase from 10% to 28% in tumor burden over KP mice, (a 2.8-fold increase) compared to a tumor burden of 52% in the KPL mice (5.25-fold increase over KP) , and this was consistent with the results observed in KP mice treated with SIK1 sgRNA guides ( Figure S3B , 2.5 fold tumor burden increase of KP+sgSik1 over KP+sgControls).

Techniques: Virus

Journal: Cancer discovery

Article Title: The AMPK-related kinases SIK1 and SIK3 mediate key tumor suppressive effects of LKB1 in NSCLC.

doi: 10.1158/2159-8290.CD-18-1261

Figure Lengend Snippet: (A) Schematic of the experimental design using pSECC lentivirus to deliver Cre-recombinase, Cas9 and a sgRNA of choice as a single payload to the lungs of KrasG12D-mice (K) and Kras-p53 floxed mice (KP) after intratracheal virus delivery.

Article Snippet: As a cohort, KPSik1 mice showed an increase from 10% to 28% in tumor burden over KP mice, (a 2.8-fold increase) compared to a tumor burden of 52% in the KPL mice (5.25-fold increase over KP) , and this was consistent with the results observed in KP mice treated with SIK1 sgRNA guides ( Figure S3B , 2.5 fold tumor burden increase of KP+sgSik1 over KP+sgControls).

Techniques: Virus

Journal: Cancer discovery

Article Title: The AMPK-related kinases SIK1 and SIK3 mediate key tumor suppressive effects of LKB1 in NSCLC.

doi: 10.1158/2159-8290.CD-18-1261

Figure Lengend Snippet: (A) ELISA analysis of IL-6 secretion in mouse KP lines. KP cells lines were transduced with a sgRNA guide targeting Lkb1 or with two independent sets of guides to target Sik1 and Sik3 simultaneously. 500,000 control or KO cells were seeded in 6 well plates and supernatant was collected at 48hrs to quantitate the amount of IL6 released by the cells into the media.

Article Snippet: As a cohort, KPSik1 mice showed an increase from 10% to 28% in tumor burden over KP mice, (a 2.8-fold increase) compared to a tumor burden of 52% in the KPL mice (5.25-fold increase over KP) , and this was consistent with the results observed in KP mice treated with SIK1 sgRNA guides ( Figure S3B , 2.5 fold tumor burden increase of KP+sgSik1 over KP+sgControls).

Techniques: Enzyme-linked Immunosorbent Assay, Transduction, Control

Journal: The Journal of Clinical Investigation

Article Title: Induced CD8 α identifies human NK cells with enhanced proliferative fitness and modulates NK cell activation

doi: 10.1172/JCI173602

Figure Lengend Snippet: ( A ) MFI of RUNX3 on day 6 within the indicated cell populations cultured in 1 ng/mL IL-15. n = 5 donors and 3 independent experiments. ( B – D ) NK cells were electroporated with RUNX3 sgRNA and Cas9 mRNA, cultured in vitro for 48 hours, and then sorted on the basis of CD8α expression. NSG mice were injected i.v. with sorted CD8α +/– control or RUNX3-KO cells and supported with i.p. rhIL-15 for 9 days. ( B ) Experimental schema. ( C and D ) Percentage of human NK cells in the liver expressing CD8α within RUNX3 + or RUNX3 – cell populations that were originally sorted as ( C ) CD8α + or ( D ) CD8α – . n = 3 donors and 2 independent experiments. Data represent the mean ± SEM. ** P < 0.01, by ( A ) repeated-measures 1-way ANOVA and ( C and D ) ratio-paired, 2-tailed Student’s t test. ( E and F ) NK cells were electroporated with control or RUNX3 gRNA and Cas9 mRNA, cultured in 5 ng/mL IL-15 for 9 days, and assessed for H3K27ac abundance using CUT&TAG. ( E ) Integrative Genomics Viewer (IGV) tracks showing H3K27ac peaks within the CD8A locus for control (ctrl) and RUNX3-KO donor pairs, with the log 2 FC for each donor pair for the entire CD8A locus shown. ( F ) Volcano plot showing the average log 2 FC and –log 10 P value, determined by matched, paired, 2-tailed Student’s t test, for donor-matched RUNX3-KO versus control H3K27ac signal for gene loci. Genes in highlighted in red had significantly increased H3K27ac signal, and genes in blue had significantly decreased H3K27ac signal in RUNX3-KO cells with log 2 FC cutoffs of absolute (0.5) or higher for at least 3 of 4 donors. We filtered genes with P < 0.05 using the results of 1-sided Student’s t tests (peaks lost/lower in KO or peaks gained/higher in KO), a log 2 fold change ≤ -0.5 or ≥ 0.5, respectively) in at least 3 of 4 donors, for genes expressed in NK cells. n = 4 donors and 2 independent experiments.

Article Snippet: Next, CD8A sgRNA (GACUUCCGCCGAGAGAACGA) (IDT with modifications as described previously; ref. ), RUNX3 sgRNA (UGCGCACGAGCUCGCCUGCG), or control sgRNA against the TCRα chain TRAC (GAGAAUCAAAAUCGGUGAAU) (Synthego) was added to the cells, which were then electroporated in a Maxcyte GT electroporator using the WUSTL-2 setting in an OC-100 processing assembly.

Techniques: Cell Culture, In Vitro, Expressing, Injection, Control

Journal: The Journal of Clinical Investigation

Article Title: Induced CD8 α identifies human NK cells with enhanced proliferative fitness and modulates NK cell activation

doi: 10.1172/JCI173602

Figure Lengend Snippet: ( A – C ) Primary human NK cells were electroporated with Cas9 mRNA and sgRNA targeting CD8A or a control gRNA ( TRAC ) and cultured in vitro in 1 ng/mL IL-15 for 6 days. NK cells were stimulated with plate-bound antibodies (10 μg/mL) targeting NKp30 or mouse IgG1 isotype control antibody for 6 hours, with GolgiPlug/Stop for the last 5 hours. The percentage of NK cells positive for expression of ( A ) CD107a, ( B ) IFN-γ, or ( C ) TNF is shown. n = 13 donors and 7 independent experiments. ( D – F ) Control or CD8-KO cells were labeled with 50 nM CFSE, mixed together at a 1:1 ratio, and then labeled with the UV-excitable, Ca 2+ -sensing dye Indo-1. A mAb (5 μg/mL) targeting NKp30 alone or NKp30 (5 μg/mL) and KIR3DL1 (0.2 μg/mL) was added for 20 minutes at 4°C, cells were washed, and then cross-linking was induced at the indicated time point (black arrow) using goat anti–mouse IgG (10 μg/mL). Calcium flux was measured by flow cytometry. ( E ) Data are shown as the normalized ratio of Indo-violet over Indo-blue within control or CD8-KO cells as a function of time in cells from 1 representative donor. ( F ) Sum of the AUC of the normalized Indo-violet/Indo-blue ratio for all time points in control and CD8-KO cells. n = 3 donors and 3 independent experiments; donors were prescreened to ensure KIR3DL1 and CD8α expression of greater than 30%. Data represent the mean ± SEM. ** P < 0.01 and *** P < 0.001, by ( A – C ) 2-way ANOVA with Holm-Šídák correction for multiple comparisons and ( F – G ) paired, 2-tailed Student’s t test.

Article Snippet: Next, CD8A sgRNA (GACUUCCGCCGAGAGAACGA) (IDT with modifications as described previously; ref. ), RUNX3 sgRNA (UGCGCACGAGCUCGCCUGCG), or control sgRNA against the TCRα chain TRAC (GAGAAUCAAAAUCGGUGAAU) (Synthego) was added to the cells, which were then electroporated in a Maxcyte GT electroporator using the WUSTL-2 setting in an OC-100 processing assembly.

Techniques: Control, Cell Culture, In Vitro, Expressing, Labeling, Flow Cytometry