|
ATCC
date deposited e coli bl21 pah342 atcc 98538 sep 8 Date Deposited E Coli Bl21 Pah342 Atcc 98538 Sep 8, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+open+reading+frame/us07534445-383-0-6?v=ATCC Average 90 stars, based on 1 article reviews
date deposited e coli bl21 pah342 atcc 98538 sep 8 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Gold Biotechnology Inc
imipenem ![]() Imipenem, supplied by Gold Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+open+reading+frame/pm30380366-36-18-19?v=Gold+Biotechnology+Inc Average 90 stars, based on 1 article reviews
imipenem - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
reading frame ![]() Reading Frame, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+open+reading+frame/pm29321615-214-4-10?v=OriGene Average 90 stars, based on 1 article reviews
reading frame - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
pcmv6ev ![]() Pcmv6ev, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+open+reading+frame/pmc05016695-500-5-6?v=OriGene Average 90 stars, based on 1 article reviews
pcmv6ev - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
reading frame orf ![]() Reading Frame Orf, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+open+reading+frame/pmc10561361-160-4-19?v=OriGene Average 91 stars, based on 1 article reviews
reading frame orf - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
|
ProSci Incorporated
anti vista ![]() Anti Vista, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+open+reading+frame/pmc07462859-88-5-7?v=ProSci+Incorporated Average 90 stars, based on 1 article reviews
anti vista - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
ProSci Incorporated
vista ![]() Vista, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+open+reading+frame/ppr0256926-48-9-10?v=ProSci+Incorporated Average 90 stars, based on 1 article reviews
vista - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
codon-optimized mojv (nc 025352.1) f and g open reading frames (orfs) ![]() Codon Optimized Mojv (Nc 025352.1) F And G Open Reading Frames (Orfs), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+open+reading+frame/pmc11032465-126-6-14?v=GenScript+corporation Average 90 stars, based on 1 article reviews
codon-optimized mojv (nc 025352.1) f and g open reading frames (orfs) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
open reading frames of rnase w (fau-1) from p. furiosus (full-length protein, constructs and mutants; pf0022) ![]() Open Reading Frames Of Rnase W (Fau 1) From P. Furiosus (Full Length Protein, Constructs And Mutants; Pf0022), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+open+reading+frame/pmc11602121-79-9-25?v=GenScript+corporation Average 90 stars, based on 1 article reviews
open reading frames of rnase w (fau-1) from p. furiosus (full-length protein, constructs and mutants; pf0022) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
BIO-CAT Inc
murine mk3 open reading frame ![]() Murine Mk3 Open Reading Frame, supplied by BIO-CAT Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+open+reading+frame/pmc01800641-61-1-15?v=BIO-CAT+Inc Average 90 stars, based on 1 article reviews
murine mk3 open reading frame - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
cbx8 kr21a mutant open reading frame ![]() Cbx8 Kr21a Mutant Open Reading Frame, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/control+open+reading+frame/pmc10888862-15-5-16?v=GenScript+corporation Average 90 stars, based on 1 article reviews
cbx8 kr21a mutant open reading frame - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Pathogens and global health
Article Title: Elucidating the survival and response of carbapenem resistant Klebsiella pneumoniae after exposure to imipenem at sub-lethal concentrations.
doi: 10.1080/20477724.2018.1538281
Figure Lengend Snippet: Figure 1. Similarity between groups of replicates of imipenem-treated and untreated K/1309–39. (a) Dendogram of sample distances and clustering matrix profiles between biological replicates of imipenem-treated and untreated K/1309–39 (b) PCA plot showing similarity among biological replicates and differences between imipenem-treated and untreated K/1309–39.
Article Snippet: Briefly, the strains were grown overnight in Luria Bertani (LB) plates with and without sub- lethal concentrations of
Techniques:
Journal: Pathogens and global health
Article Title: Elucidating the survival and response of carbapenem resistant Klebsiella pneumoniae after exposure to imipenem at sub-lethal concentrations.
doi: 10.1080/20477724.2018.1538281
Figure Lengend Snippet: Figure 3. Comparison of 1H NMR spectra of imipenem-treated and untreated K/1309–39. 1, branched chain amino acid (BCAA); 2, ethanol; 3, threonine; 4, alanine; 5, acetate; 6, methionine; 7, pyruvate; 8, succinate; 9, trimethylamine-N-oxide (TMAO); 10, glycerophosphocholine; 11, phenylacetate; 12, glycine; 13, valine; 14, anserine; 15, uracil; 16, fumarate; 17, tyrosine; 18, xanthine; 19, hypoxanthine; 20, methyladenine; 21, FAPγ-adenine; 22, formate.
Article Snippet: Briefly, the strains were grown overnight in Luria Bertani (LB) plates with and without sub- lethal concentrations of
Techniques: Comparison
Journal: Scientific Reports
Article Title: The prognostic significance of VISTA and CD33-positive myeloid cells in cutaneous melanoma and their relationship with PD-1 expression
doi: 10.1038/s41598-020-71216-2
Figure Lengend Snippet: Clinico-histopathological characteristics of the 136 cutaneous melanomas according to CD33, VISTA and PD-1 expression.
Article Snippet: Paraffin-embedded sections were immunostained with
Techniques: Expressing
Journal: Scientific Reports
Article Title: The prognostic significance of VISTA and CD33-positive myeloid cells in cutaneous melanoma and their relationship with PD-1 expression
doi: 10.1038/s41598-020-71216-2
Figure Lengend Snippet: Correlations among CD33, VISTA, and PD-1 expression.
Article Snippet: Paraffin-embedded sections were immunostained with
Techniques: Expressing
Journal: Scientific Reports
Article Title: The prognostic significance of VISTA and CD33-positive myeloid cells in cutaneous melanoma and their relationship with PD-1 expression
doi: 10.1038/s41598-020-71216-2
Figure Lengend Snippet: Expression of CD33 and VISTA in cutaneous melanoma. ( A ) High intratumoral expression (immunohistochemical score of 3, red color, cytoplasmic) of CD33 in acral melanoma (× 100). ( B ) High intratumoral expression (score 3, red color, cytoplasmic) of VISTA in nodular melanoma (× 100). ( C ) High peritumoral expression (score 3, red color, cytoplasmic) of CD33 in acral melanoma (× 100). ( D ) High peritumoral expression (score 3, red color, cytoplasmic) of VISTA in nodular melanoma (× 200). ( E ) Dual immunofluorescence staining of ( A ) CD33 and VISTA (CD33, red, cytoplasmic; VISTA, green, cytoplasmic) and ( F ) PD-1 and VISTA (PD-1, red, cytoplasmic; VISTA, green, cytoplasmic). Double-positive cells are shown in yellow (white arrow). VISTA, V-domain Ig suppressor of T-cell activation; PD-1, programmed cell death protein-1.
Article Snippet: Paraffin-embedded sections were immunostained with
Techniques: Expressing, Immunohistochemical staining, Immunofluorescence, Staining, Activation Assay
Journal: Scientific Reports
Article Title: The prognostic significance of VISTA and CD33-positive myeloid cells in cutaneous melanoma and their relationship with PD-1 expression
doi: 10.1038/s41598-020-71216-2
Figure Lengend Snippet: Patient survival according to CD33 and VISTA expression. ( A ) OS according to CD33 expression. ( B ) OS according to VISTA expression. ( C ) Worse OS in patients with high expression of both CD33 and VISTA. ( D ) OS according to the degree of CD33 and VISTA expression ( E ) Worse OS in cases with dual expression of VISTA and PD-1 among patients with high expression of PD-1. VISTA, V-domain Ig suppressor of T-cell activation; PD-1, programmed cell death protein-1.
Article Snippet: Paraffin-embedded sections were immunostained with
Techniques: Expressing, Activation Assay
Journal: Scientific Reports
Article Title: The prognostic significance of VISTA and CD33-positive myeloid cells in cutaneous melanoma and their relationship with PD-1 expression
doi: 10.1038/s41598-020-71216-2
Figure Lengend Snippet: Univariate and multivariate analyses of OS and PFS.
Article Snippet: Paraffin-embedded sections were immunostained with
Techniques: Expressing
Journal: Nucleic Acids Research
Article Title: RNase W, a conserved ribonuclease family with a novel active site
doi: 10.1093/nar/gkae907
Figure Lengend Snippet: X-ray diffraction and refinement statistics
Article Snippet: The open reading frames of RNase W (FAU-1) from
Techniques: X-ray Diffraction
Journal: Nucleic Acids Research
Article Title: RNase W, a conserved ribonuclease family with a novel active site
doi: 10.1093/nar/gkae907
Figure Lengend Snippet: Structures of RNase W from P. furiosus and S. acidocaldarius . ( A and B ) Structures of RNase W proteins colored by domains: N-terminal domain in orange, S1 domain in dark green, 5′-sensor domain in light green, α helical bundle domain in red and DUF402 domain in blue. ( A ) Structure of RNase W from P. furiosus ( Pf RNase W). A dinucleotide UU with 5′ and 3′-phosphate extremities is bound to the 5′-sensor domain. In addition, a dinucleotide UA with 5′-hydroxyl and 3′-phosphate extremities is bound to the DUF402 domain. ( B ) Structure of RNase W from S. acidocaldarius ( Sa RNase W). ( C ) Pf RNase W surface representation with residues conservation score in archaeal RNase W proteins mapped on the surface. The encircled central domain includes the N-terminal domain and one helix of the α helical bundle domain annotated in panel A. ( D ) Electrostatic surface potential mapped on the surface of Pf RNase W protein.
Article Snippet: The open reading frames of RNase W (FAU-1) from
Techniques:
Journal: bioRxiv
Article Title: Dynamic PRC1-CBX8 stabilizes a porous structure of chromatin condensates
doi: 10.1101/2023.05.08.539931
Figure Lengend Snippet: a, Schematics introducing the workflow. b, SDS-PAGE of purified PRC1C8 complex that includes RING1b, BMI1 and MBP-tagged CBX8. c, Size exclusion chromatography of the purified PRC1C8 using a HiLoad Sephacryl 300 16/60 column. d, In vitro ubiquitylation assay comparing PRC1C8 to a RING1b-BMI1 heterodimer. Samples in lane 2 and 3 included E1, E2, ubiquitin and ATP. Ubiquitylation is detected by western blot using an anti-H2A antibody. e, Chromatin condensates induced by the PRC1C8 complex and the individual proteins, visualised by confocal (left and centre) and phase contrast (right, from independent experiments) microscopy. CBX8 is GFP-labelled and chromatin is Cy5 labelled. Protein and chromatin concentrations are 1 μM and 20 nM (estimated nucleosome concentration), respectively. f, Cryo-confocal microscopy of vitrified PRC1C8-chromatin condensates. g, Cryo-electron tomography of a PRC1C8-chromatin condensate. Shown is a central slice through the reconstruction (left image). Nucleosome subtomogram averages (centre, bottom) are then placed in a volume the size of the tomographic slice, at the position and orientation determined by template matching and subtomogram averaging (right image). 1330 nM PRC1C8 and 3500 nM chromatin (estimated nucleosome concentration) were assayed in 3.5 mM HEPES-KOH pH 7.5, 6.8 mM TRIS-HCl PH 7.5, 21 mM NaCl, 7 mM KCl, 0.8 mM DTT. See Supplementary Data 1 for a list of cross correlation peaks. h, Surface representation of the volume of a subset of the PRC1C8-chromatin condensate structure that is inaccessible to probes of given radii. i, Inaccessible volumes for a given probe radii are plotted, with exemplary molecules indicated (in grey) and selected probes coloured as in h. For the indicated complexes, the hydrodynamic radius was estimated32 using resolved domains from published structures (see Methods section for PDB accessions) as a minimum size estimate. j, As in g but without PRC1C8. See Supplementary Data 2 for a list of cross correlation peaks. k, Pairwise distances of each individual nucleosome to its nearest three neighbouring nucleosomes in 3D space in tomograms with and without PRC1C8. Only unique pairs are plotted from two tomograms with (+PRC1) and three tomograms without (−PRC1). Whiskers extend from the 5th to the 95th percentiles. Significance was tested using a Brown-Forsythe ANOVA with a Games-Howell post hoc test. **** = p-value < 0.0001.
Article Snippet: CBX8 KR21A , ATGGAATTATCAGCAGTAGGTGAACGCGTGTTTGCAGCGGAAGCGCTGCTCAAACGTAGGATTCGGAAGGGTCGCATGGAGTACCTAGTTAAGTGGAAAGGATGGTCACAGAAGTATAGCACATGGGAACCGGAGGAGAACATACTGGATGCTCGCTTGCTAGCAGCGTTTGAGGAGCGGGAACGAGAAATGGAGCTGTACGGACCTAAAAAACGTGGACCCAAGCCAAAGACCTTCCIIIIGAAGGCTCAAGCGGCTGCCAAGGCTGCCACGTATGAATTCAGATCGGATTCTGCCGCAGGTATAAGAATTCCCTACCCAGGGGCCAGTCCACAGGACTTGGCCTCCACGTCTAGGGCAGCAGAGGGCTTACGGAACATGGGCCTCTCTCCTCCGGCTTCATCTACTAGTACGAGTAGTACATGTGCCGCGGAAGCGCCAAGGGACGCAGACCGAGACGCAGATCGGGATGCCGAGAGAGATGCGGAACGAGAGGCGGAAAGAGAAGCCGAGCGCGAGGCTGAGCGTGAAGCGGAACGTGGCACAAGCGCCGTTGATGACAAACCATCGAGCCCTGGTGATTCCAGCAAAAAACGGGGACCCAAGCCTAGGAAGGAGTTGCCGGACCCATCCCAAGCCCCGCTTGGTGAACCATCGGCGGGCCTCGGGGAATATCTTAAAGGCCGAGCTTTGGACGATACCCCTAGTGGTGCAGGAAAATTTCCTGCGGGACATTCGGTTATCCAACTTGCTGCACGACAAGACTCAGATTTAGTACAGTGCGGGGTGACATCCCCCAGCTCTGCAGAGGCGACCGGGGCCCTAGCTGTCGACACCTTCCCAGCACGCGTGATAGCGCACCGAGCCGCAIIIIIAGAAGCTGCTGGGCAGGGCGCGCTAGATCCCAACGGCACTAGGGTGCGGCACGGTTCAGGACCTCCCTCGTCCGGGGGGGGCCTATATAGAGACATGGGAGCTCAGGGGGGTAGACCGTCGCTTATCGCTCGTATCCCGGTAGCCCGTATTCTGGGTGACCCGGAGGAAGAATCCTGGTCTCCCAGTTTAACGAATTTAGAGAAAGTCGTAGTCACTGACGTTACGTCAAATTTTCTGACAGTCACCATCAAAGAGAGCAATACTGATCAAGGATTCTTCAAGGAAAAGCGCTAA ,
Techniques: SDS Page, Purification, Size-exclusion Chromatography, In Vitro, Ubiquitin Assay, Ubiquitin Proteomics, Western Blot, Microscopy, Concentration Assay, Confocal Microscopy, Tomography
Journal: bioRxiv
Article Title: Dynamic PRC1-CBX8 stabilizes a porous structure of chromatin condensates
doi: 10.1101/2023.05.08.539931
Figure Lengend Snippet: a, MNase digestion of reconstituted Chromatin and a naked DNA (same sequence as used for chromatin reconstitution). DNA fragments post digestion are resolved on a 1.2 % Agarose gel. Protected bands indicating mono- and di-nucleosome core particles (NCP and diNCP) are indicated by the arrows. b, 3 ug of each protein complex used in this study resolved on a 4–12% SDS-PAGE gel stained with Coomassie. c, Ubiquitylation activity of each protein complex used in this study visualized on a western blot. All samples include UBA1, UBCH5C, Ubiquitin, ATP and 1 uM chromatin (nucleosome concentration). d, Phase separation experiment comparing chromatin condensation activity of PRC1C8 with MBP-tagged CBX8 to PRC1C8 with the tag cleaved.
Article Snippet: CBX8 KR21A , ATGGAATTATCAGCAGTAGGTGAACGCGTGTTTGCAGCGGAAGCGCTGCTCAAACGTAGGATTCGGAAGGGTCGCATGGAGTACCTAGTTAAGTGGAAAGGATGGTCACAGAAGTATAGCACATGGGAACCGGAGGAGAACATACTGGATGCTCGCTTGCTAGCAGCGTTTGAGGAGCGGGAACGAGAAATGGAGCTGTACGGACCTAAAAAACGTGGACCCAAGCCAAAGACCTTCCIIIIGAAGGCTCAAGCGGCTGCCAAGGCTGCCACGTATGAATTCAGATCGGATTCTGCCGCAGGTATAAGAATTCCCTACCCAGGGGCCAGTCCACAGGACTTGGCCTCCACGTCTAGGGCAGCAGAGGGCTTACGGAACATGGGCCTCTCTCCTCCGGCTTCATCTACTAGTACGAGTAGTACATGTGCCGCGGAAGCGCCAAGGGACGCAGACCGAGACGCAGATCGGGATGCCGAGAGAGATGCGGAACGAGAGGCGGAAAGAGAAGCCGAGCGCGAGGCTGAGCGTGAAGCGGAACGTGGCACAAGCGCCGTTGATGACAAACCATCGAGCCCTGGTGATTCCAGCAAAAAACGGGGACCCAAGCCTAGGAAGGAGTTGCCGGACCCATCCCAAGCCCCGCTTGGTGAACCATCGGCGGGCCTCGGGGAATATCTTAAAGGCCGAGCTTTGGACGATACCCCTAGTGGTGCAGGAAAATTTCCTGCGGGACATTCGGTTATCCAACTTGCTGCACGACAAGACTCAGATTTAGTACAGTGCGGGGTGACATCCCCCAGCTCTGCAGAGGCGACCGGGGCCCTAGCTGTCGACACCTTCCCAGCACGCGTGATAGCGCACCGAGCCGCAIIIIIAGAAGCTGCTGGGCAGGGCGCGCTAGATCCCAACGGCACTAGGGTGCGGCACGGTTCAGGACCTCCCTCGTCCGGGGGGGGCCTATATAGAGACATGGGAGCTCAGGGGGGTAGACCGTCGCTTATCGCTCGTATCCCGGTAGCCCGTATTCTGGGTGACCCGGAGGAAGAATCCTGGTCTCCCAGTTTAACGAATTTAGAGAAAGTCGTAGTCACTGACGTTACGTCAAATTTTCTGACAGTCACCATCAAAGAGAGCAATACTGATCAAGGATTCTTCAAGGAAAAGCGCTAA ,
Techniques: Control, Construct, Sequencing, Agarose Gel Electrophoresis, SDS Page, Staining, Activity Assay, Western Blot, Ubiquitin Proteomics, Concentration Assay
Journal: bioRxiv
Article Title: Dynamic PRC1-CBX8 stabilizes a porous structure of chromatin condensates
doi: 10.1101/2023.05.08.539931
Figure Lengend Snippet: a, Schematics depicting the different CBX8 mutants used, drawn to scale. b, PRC1C8-chromatin condensates in the context of different CBX8 mutants. Varying concentrations of PRC1C8 were titrated to a constant concentration of C5-labelled reconstituted chromatin (50 ng/μl). Widefield fluorescence and differential interference contrast (DIC) micrographs are representative of three replicates. c Quantification of the total area covered by condensates per micrograph for different PRC1C8 mutants and concentrations. Bars represent the means from three independent replicates and error bars represent the standard deviation. d, Fluorescence polarisation assay measured the affinity of different PRC1C8 mutants for a Fluorescein-labelled 24 bp DNA probe. Data points are the mean (baseline subtracted) of three independent replicates and error bars indicate the standard error. The continuous line represents the fit to a Hill binding model, when applicable. e, Model for chromatin condensation by PRC1C8: Electrostatic interaction between the CBX8 IDR with DNA provides charge screening and promotes phase separation.
Article Snippet: CBX8 KR21A , ATGGAATTATCAGCAGTAGGTGAACGCGTGTTTGCAGCGGAAGCGCTGCTCAAACGTAGGATTCGGAAGGGTCGCATGGAGTACCTAGTTAAGTGGAAAGGATGGTCACAGAAGTATAGCACATGGGAACCGGAGGAGAACATACTGGATGCTCGCTTGCTAGCAGCGTTTGAGGAGCGGGAACGAGAAATGGAGCTGTACGGACCTAAAAAACGTGGACCCAAGCCAAAGACCTTCCIIIIGAAGGCTCAAGCGGCTGCCAAGGCTGCCACGTATGAATTCAGATCGGATTCTGCCGCAGGTATAAGAATTCCCTACCCAGGGGCCAGTCCACAGGACTTGGCCTCCACGTCTAGGGCAGCAGAGGGCTTACGGAACATGGGCCTCTCTCCTCCGGCTTCATCTACTAGTACGAGTAGTACATGTGCCGCGGAAGCGCCAAGGGACGCAGACCGAGACGCAGATCGGGATGCCGAGAGAGATGCGGAACGAGAGGCGGAAAGAGAAGCCGAGCGCGAGGCTGAGCGTGAAGCGGAACGTGGCACAAGCGCCGTTGATGACAAACCATCGAGCCCTGGTGATTCCAGCAAAAAACGGGGACCCAAGCCTAGGAAGGAGTTGCCGGACCCATCCCAAGCCCCGCTTGGTGAACCATCGGCGGGCCTCGGGGAATATCTTAAAGGCCGAGCTTTGGACGATACCCCTAGTGGTGCAGGAAAATTTCCTGCGGGACATTCGGTTATCCAACTTGCTGCACGACAAGACTCAGATTTAGTACAGTGCGGGGTGACATCCCCCAGCTCTGCAGAGGCGACCGGGGCCCTAGCTGTCGACACCTTCCCAGCACGCGTGATAGCGCACCGAGCCGCAIIIIIAGAAGCTGCTGGGCAGGGCGCGCTAGATCCCAACGGCACTAGGGTGCGGCACGGTTCAGGACCTCCCTCGTCCGGGGGGGGCCTATATAGAGACATGGGAGCTCAGGGGGGTAGACCGTCGCTTATCGCTCGTATCCCGGTAGCCCGTATTCTGGGTGACCCGGAGGAAGAATCCTGGTCTCCCAGTTTAACGAATTTAGAGAAAGTCGTAGTCACTGACGTTACGTCAAATTTTCTGACAGTCACCATCAAAGAGAGCAATACTGATCAAGGATTCTTCAAGGAAAAGCGCTAA ,
Techniques: Concentration Assay, Fluorescence, Standard Deviation, Binding Assay
Journal: bioRxiv
Article Title: Dynamic PRC1-CBX8 stabilizes a porous structure of chromatin condensates
doi: 10.1101/2023.05.08.539931
Figure Lengend Snippet: a, Titration of Chromatin against PRC1C8. Condensates were assessed with a fluorescence widefield microscope imaging a Cy5 label on the chromatin. Presented are representative micrographs of three replicates, including two with MBP-tagged PRC1C8 (presented) and one with GFP-tagged PRC1C8. b, Representative micrographs of FRAP recorded in PRC1C8-chromatin condensates. CBX8 is GFP labelled and chromatin is Cy5 labelled. Mean fluorescence intensity of the bleached area, normalised to pre-bleach mean signal, is plotted for every time point. Error bars show standard deviation from n=7 (GFP) and n=8 (Cy5) measurements recorded from two independent experiments. The GFP signal recovery was fit with an exponential association model, best fit values for Plateau and fluorescence recovery half time (T1/2) are shown with standard error. c, Schematic representation of the FRAP experiment.
Article Snippet: CBX8 KR21A , ATGGAATTATCAGCAGTAGGTGAACGCGTGTTTGCAGCGGAAGCGCTGCTCAAACGTAGGATTCGGAAGGGTCGCATGGAGTACCTAGTTAAGTGGAAAGGATGGTCACAGAAGTATAGCACATGGGAACCGGAGGAGAACATACTGGATGCTCGCTTGCTAGCAGCGTTTGAGGAGCGGGAACGAGAAATGGAGCTGTACGGACCTAAAAAACGTGGACCCAAGCCAAAGACCTTCCIIIIGAAGGCTCAAGCGGCTGCCAAGGCTGCCACGTATGAATTCAGATCGGATTCTGCCGCAGGTATAAGAATTCCCTACCCAGGGGCCAGTCCACAGGACTTGGCCTCCACGTCTAGGGCAGCAGAGGGCTTACGGAACATGGGCCTCTCTCCTCCGGCTTCATCTACTAGTACGAGTAGTACATGTGCCGCGGAAGCGCCAAGGGACGCAGACCGAGACGCAGATCGGGATGCCGAGAGAGATGCGGAACGAGAGGCGGAAAGAGAAGCCGAGCGCGAGGCTGAGCGTGAAGCGGAACGTGGCACAAGCGCCGTTGATGACAAACCATCGAGCCCTGGTGATTCCAGCAAAAAACGGGGACCCAAGCCTAGGAAGGAGTTGCCGGACCCATCCCAAGCCCCGCTTGGTGAACCATCGGCGGGCCTCGGGGAATATCTTAAAGGCCGAGCTTTGGACGATACCCCTAGTGGTGCAGGAAAATTTCCTGCGGGACATTCGGTTATCCAACTTGCTGCACGACAAGACTCAGATTTAGTACAGTGCGGGGTGACATCCCCCAGCTCTGCAGAGGCGACCGGGGCCCTAGCTGTCGACACCTTCCCAGCACGCGTGATAGCGCACCGAGCCGCAIIIIIAGAAGCTGCTGGGCAGGGCGCGCTAGATCCCAACGGCACTAGGGTGCGGCACGGTTCAGGACCTCCCTCGTCCGGGGGGGGCCTATATAGAGACATGGGAGCTCAGGGGGGTAGACCGTCGCTTATCGCTCGTATCCCGGTAGCCCGTATTCTGGGTGACCCGGAGGAAGAATCCTGGTCTCCCAGTTTAACGAATTTAGAGAAAGTCGTAGTCACTGACGTTACGTCAAATTTTCTGACAGTCACCATCAAAGAGAGCAATACTGATCAAGGATTCTTCAAGGAAAAGCGCTAA ,
Techniques: Titration, Fluorescence, Microscopy, Imaging, Standard Deviation
Journal: bioRxiv
Article Title: Dynamic PRC1-CBX8 stabilizes a porous structure of chromatin condensates
doi: 10.1101/2023.05.08.539931
Figure Lengend Snippet: a, Chromatin condensation in response to the whole PRC1C8 complex (RING1b, BMI1 and CBX8) or the individual components CBX8 and the RING1b–BMI1 heterodimer. Representative images from two replicates. b, Intermolecular (purple lines) and intramolecular (green lines) protein-protein interactions mapped within PRC1-chromatin condensates using crosslinking mass spectrometry (XL-MS). Data is from three independent replicates. c, PRC1C8 or PRC1 core binding to a fluorescein labelled 24bp DNA probe measured by fluorescence polarisation. Data points show the mean (baseline subtracted) of three independent replicates and the error bars indicate the standard error. The continuous line represents the fit to a Hill binding model, when applicable. d, Titration of PRC1C8 to unmodified chromatin (top) and H3K27me3-MLA chromatin (bottom) at an identical chromatin concentration (50 ng/μl DNA) and 150 mM KCl. Micrographs are representative of two independent replicates.
Article Snippet: CBX8 KR21A , ATGGAATTATCAGCAGTAGGTGAACGCGTGTTTGCAGCGGAAGCGCTGCTCAAACGTAGGATTCGGAAGGGTCGCATGGAGTACCTAGTTAAGTGGAAAGGATGGTCACAGAAGTATAGCACATGGGAACCGGAGGAGAACATACTGGATGCTCGCTTGCTAGCAGCGTTTGAGGAGCGGGAACGAGAAATGGAGCTGTACGGACCTAAAAAACGTGGACCCAAGCCAAAGACCTTCCIIIIGAAGGCTCAAGCGGCTGCCAAGGCTGCCACGTATGAATTCAGATCGGATTCTGCCGCAGGTATAAGAATTCCCTACCCAGGGGCCAGTCCACAGGACTTGGCCTCCACGTCTAGGGCAGCAGAGGGCTTACGGAACATGGGCCTCTCTCCTCCGGCTTCATCTACTAGTACGAGTAGTACATGTGCCGCGGAAGCGCCAAGGGACGCAGACCGAGACGCAGATCGGGATGCCGAGAGAGATGCGGAACGAGAGGCGGAAAGAGAAGCCGAGCGCGAGGCTGAGCGTGAAGCGGAACGTGGCACAAGCGCCGTTGATGACAAACCATCGAGCCCTGGTGATTCCAGCAAAAAACGGGGACCCAAGCCTAGGAAGGAGTTGCCGGACCCATCCCAAGCCCCGCTTGGTGAACCATCGGCGGGCCTCGGGGAATATCTTAAAGGCCGAGCTTTGGACGATACCCCTAGTGGTGCAGGAAAATTTCCTGCGGGACATTCGGTTATCCAACTTGCTGCACGACAAGACTCAGATTTAGTACAGTGCGGGGTGACATCCCCCAGCTCTGCAGAGGCGACCGGGGCCCTAGCTGTCGACACCTTCCCAGCACGCGTGATAGCGCACCGAGCCGCAIIIIIAGAAGCTGCTGGGCAGGGCGCGCTAGATCCCAACGGCACTAGGGTGCGGCACGGTTCAGGACCTCCCTCGTCCGGGGGGGGCCTATATAGAGACATGGGAGCTCAGGGGGGTAGACCGTCGCTTATCGCTCGTATCCCGGTAGCCCGTATTCTGGGTGACCCGGAGGAAGAATCCTGGTCTCCCAGTTTAACGAATTTAGAGAAAGTCGTAGTCACTGACGTTACGTCAAATTTTCTGACAGTCACCATCAAAGAGAGCAATACTGATCAAGGATTCTTCAAGGAAAAGCGCTAA ,
Techniques: Protein-Protein interactions, Mass Spectrometry, Structural Proteomics, Binding Assay, Fluorescence, Titration, Concentration Assay
Journal: bioRxiv
Article Title: Dynamic PRC1-CBX8 stabilizes a porous structure of chromatin condensates
doi: 10.1101/2023.05.08.539931
Figure Lengend Snippet: a, Schematics of the experimental setup (left) and anti-CBX8 western blot (right) of wildtype and Cbx8 knockout mESC after 48 hours of retinoic acid (RA) treatment. b, Overlap of ATAC-seq peaks and CBX8 and H3K27me3 ChIP-seq peaks. ATAC-seq peaks are defined from two biological replicates. c, ChIP-seq traces for H3K27me3 and CBX8 in wildtype mESC and representative ATAC-seq traces at four genes in wildtype and CBX8 knockout mESC after 48 hours of RA treatment. d, Accessibility changes at all ATAC-seq peaks in wildtype (WT) mESC, in response to retinoic acid (RA) treatment. e, Accessibility changes at all CBX8-target sites in wildtype mESC, in response to RA treatment. f, Comparison of accessibility at CBX8-target sites between wildtype and Cbx8 knockout cells after RA treatment. g, Top: schematic representation of the chromosome-integrated reporter. Left panel: ChIP-qPCR using FLAG antibody (CBX8 is FLAG tagged) at indicated distances from the TetO array, in the presence and absence of doxycycline (Dox) treatment for six hours. Bars represent the mean bound over input (Bd/In) normalised to the IAP gene and points represent two replicates. See Extended Data Fig 9a for ChIP-qPCR using additional antibodies. Right panel: Brightfield and GFP-fluorescence images of the mECS cells before and after Dox treatment. h, ATAC-seq signal reporting accessibility of the integrated locus before and after Dox treatment for six days. From left to right: annotated are the TetO array and its proximal PGK promoter that controls the Puromycin-GFP reporter gene, and the distal PGK promoter. i, Model: PRC1 forms multivalent interactions with chromatin, thereby stabilizing chromatin condensates potentially through charge screening of negatively charged DNA by positive charges in the CBX8 IDR. These interactions dynamically change as PRC1 diffuses through condensates.
Article Snippet: CBX8 KR21A , ATGGAATTATCAGCAGTAGGTGAACGCGTGTTTGCAGCGGAAGCGCTGCTCAAACGTAGGATTCGGAAGGGTCGCATGGAGTACCTAGTTAAGTGGAAAGGATGGTCACAGAAGTATAGCACATGGGAACCGGAGGAGAACATACTGGATGCTCGCTTGCTAGCAGCGTTTGAGGAGCGGGAACGAGAAATGGAGCTGTACGGACCTAAAAAACGTGGACCCAAGCCAAAGACCTTCCIIIIGAAGGCTCAAGCGGCTGCCAAGGCTGCCACGTATGAATTCAGATCGGATTCTGCCGCAGGTATAAGAATTCCCTACCCAGGGGCCAGTCCACAGGACTTGGCCTCCACGTCTAGGGCAGCAGAGGGCTTACGGAACATGGGCCTCTCTCCTCCGGCTTCATCTACTAGTACGAGTAGTACATGTGCCGCGGAAGCGCCAAGGGACGCAGACCGAGACGCAGATCGGGATGCCGAGAGAGATGCGGAACGAGAGGCGGAAAGAGAAGCCGAGCGCGAGGCTGAGCGTGAAGCGGAACGTGGCACAAGCGCCGTTGATGACAAACCATCGAGCCCTGGTGATTCCAGCAAAAAACGGGGACCCAAGCCTAGGAAGGAGTTGCCGGACCCATCCCAAGCCCCGCTTGGTGAACCATCGGCGGGCCTCGGGGAATATCTTAAAGGCCGAGCTTTGGACGATACCCCTAGTGGTGCAGGAAAATTTCCTGCGGGACATTCGGTTATCCAACTTGCTGCACGACAAGACTCAGATTTAGTACAGTGCGGGGTGACATCCCCCAGCTCTGCAGAGGCGACCGGGGCCCTAGCTGTCGACACCTTCCCAGCACGCGTGATAGCGCACCGAGCCGCAIIIIIAGAAGCTGCTGGGCAGGGCGCGCTAGATCCCAACGGCACTAGGGTGCGGCACGGTTCAGGACCTCCCTCGTCCGGGGGGGGCCTATATAGAGACATGGGAGCTCAGGGGGGTAGACCGTCGCTTATCGCTCGTATCCCGGTAGCCCGTATTCTGGGTGACCCGGAGGAAGAATCCTGGTCTCCCAGTTTAACGAATTTAGAGAAAGTCGTAGTCACTGACGTTACGTCAAATTTTCTGACAGTCACCATCAAAGAGAGCAATACTGATCAAGGATTCTTCAAGGAAAAGCGCTAA ,
Techniques: Western Blot, Knock-Out, ChIP-sequencing, Comparison, ChIP-qPCR, Fluorescence
Journal: bioRxiv
Article Title: Dynamic PRC1-CBX8 stabilizes a porous structure of chromatin condensates
doi: 10.1101/2023.05.08.539931
Figure Lengend Snippet: a, ChIP-qPCR in the presence and absence of doxycycline (Dox) treatment using RING1B antibody at indicated distances from a chromosome-integrated TetO array (left), at control genes (right) and using FLAG (CBX8) antibodies at control genes (middle). Bars represented the bound over input (Bd/In) normalised to the IAP gene and the dots represent individual data points. b, ATAC-seq signal at the HoxA locus of the reporter-integrated mECS cell line before and after dox treatment. Two independent replicates are shown.
Article Snippet: CBX8 KR21A , ATGGAATTATCAGCAGTAGGTGAACGCGTGTTTGCAGCGGAAGCGCTGCTCAAACGTAGGATTCGGAAGGGTCGCATGGAGTACCTAGTTAAGTGGAAAGGATGGTCACAGAAGTATAGCACATGGGAACCGGAGGAGAACATACTGGATGCTCGCTTGCTAGCAGCGTTTGAGGAGCGGGAACGAGAAATGGAGCTGTACGGACCTAAAAAACGTGGACCCAAGCCAAAGACCTTCCIIIIGAAGGCTCAAGCGGCTGCCAAGGCTGCCACGTATGAATTCAGATCGGATTCTGCCGCAGGTATAAGAATTCCCTACCCAGGGGCCAGTCCACAGGACTTGGCCTCCACGTCTAGGGCAGCAGAGGGCTTACGGAACATGGGCCTCTCTCCTCCGGCTTCATCTACTAGTACGAGTAGTACATGTGCCGCGGAAGCGCCAAGGGACGCAGACCGAGACGCAGATCGGGATGCCGAGAGAGATGCGGAACGAGAGGCGGAAAGAGAAGCCGAGCGCGAGGCTGAGCGTGAAGCGGAACGTGGCACAAGCGCCGTTGATGACAAACCATCGAGCCCTGGTGATTCCAGCAAAAAACGGGGACCCAAGCCTAGGAAGGAGTTGCCGGACCCATCCCAAGCCCCGCTTGGTGAACCATCGGCGGGCCTCGGGGAATATCTTAAAGGCCGAGCTTTGGACGATACCCCTAGTGGTGCAGGAAAATTTCCTGCGGGACATTCGGTTATCCAACTTGCTGCACGACAAGACTCAGATTTAGTACAGTGCGGGGTGACATCCCCCAGCTCTGCAGAGGCGACCGGGGCCCTAGCTGTCGACACCTTCCCAGCACGCGTGATAGCGCACCGAGCCGCAIIIIIAGAAGCTGCTGGGCAGGGCGCGCTAGATCCCAACGGCACTAGGGTGCGGCACGGTTCAGGACCTCCCTCGTCCGGGGGGGGCCTATATAGAGACATGGGAGCTCAGGGGGGTAGACCGTCGCTTATCGCTCGTATCCCGGTAGCCCGTATTCTGGGTGACCCGGAGGAAGAATCCTGGTCTCCCAGTTTAACGAATTTAGAGAAAGTCGTAGTCACTGACGTTACGTCAAATTTTCTGACAGTCACCATCAAAGAGAGCAATACTGATCAAGGATTCTTCAAGGAAAAGCGCTAA ,
Techniques: ChIP-qPCR, Control
Journal: bioRxiv
Article Title: Dynamic PRC1-CBX8 stabilizes a porous structure of chromatin condensates
doi: 10.1101/2023.05.08.539931
Figure Lengend Snippet: Cloning and mutagenesis primers (5’–3’) and sequences
Article Snippet: CBX8 KR21A , ATGGAATTATCAGCAGTAGGTGAACGCGTGTTTGCAGCGGAAGCGCTGCTCAAACGTAGGATTCGGAAGGGTCGCATGGAGTACCTAGTTAAGTGGAAAGGATGGTCACAGAAGTATAGCACATGGGAACCGGAGGAGAACATACTGGATGCTCGCTTGCTAGCAGCGTTTGAGGAGCGGGAACGAGAAATGGAGCTGTACGGACCTAAAAAACGTGGACCCAAGCCAAAGACCTTCCIIIIGAAGGCTCAAGCGGCTGCCAAGGCTGCCACGTATGAATTCAGATCGGATTCTGCCGCAGGTATAAGAATTCCCTACCCAGGGGCCAGTCCACAGGACTTGGCCTCCACGTCTAGGGCAGCAGAGGGCTTACGGAACATGGGCCTCTCTCCTCCGGCTTCATCTACTAGTACGAGTAGTACATGTGCCGCGGAAGCGCCAAGGGACGCAGACCGAGACGCAGATCGGGATGCCGAGAGAGATGCGGAACGAGAGGCGGAAAGAGAAGCCGAGCGCGAGGCTGAGCGTGAAGCGGAACGTGGCACAAGCGCCGTTGATGACAAACCATCGAGCCCTGGTGATTCCAGCAAAAAACGGGGACCCAAGCCTAGGAAGGAGTTGCCGGACCCATCCCAAGCCCCGCTTGGTGAACCATCGGCGGGCCTCGGGGAATATCTTAAAGGCCGAGCTTTGGACGATACCCCTAGTGGTGCAGGAAAATTTCCTGCGGGACATTCGGTTATCCAACTTGCTGCACGACAAGACTCAGATTTAGTACAGTGCGGGGTGACATCCCCCAGCTCTGCAGAGGCGACCGGGGCCCTAGCTGTCGACACCTTCCCAGCACGCGTGATAGCGCACCGAGCCGCAIIIIIAGAAGCTGCTGGGCAGGGCGCGCTAGATCCCAACGGCACTAGGGTGCGGCACGGTTCAGGACCTCCCTCGTCCGGGGGGGGCCTATATAGAGACATGGGAGCTCAGGGGGGTAGACCGTCGCTTATCGCTCGTATCCCGGTAGCCCGTATTCTGGGTGACCCGGAGGAAGAATCCTGGTCTCCCAGTTTAACGAATTTAGAGAAAGTCGTAGTCACTGACGTTACGTCAAATTTTCTGACAGTCACCATCAAAGAGAGCAATACTGATCAAGGATTCTTCAAGGAAAAGCGCTAA ,
Techniques: Cloning, Mutagenesis, Plasmid Preparation, Labeling, Binding Assay