consensus Search Results


93
Miltenyi Biotec ebv consensus premium grade
Ebv Consensus Premium Grade, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus/10__24287_slash_1726___1708___2018___17___2___9___20-125-13-16?v=Miltenyi+Biotec
Average 93 stars, based on 1 article reviews
ebv consensus premium grade - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

96
LI-COR irdye 700
Irdye 700, supplied by LI-COR, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus/10__1523_slash_jneurosci__1930___15__2016-45-14-16?v=LI-COR
Average 96 stars, based on 1 article reviews
irdye 700 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

86
Icare Inc consensus meeting
Consensus Meeting, supplied by Icare Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus/pmc12318851-1-4-13?v=Icare+Inc
Average 86 stars, based on 1 article reviews
consensus meeting - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
Geneka Biotechnology Inc double-stranded oligonucleotides containing rxr-rxr (dr1) binding consensus sequences
Double Stranded Oligonucleotides Containing Rxr Rxr (Dr1) Binding Consensus Sequences, supplied by Geneka Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus/10__1074_slash_jbc__m103587200-116-2-21?v=Geneka+Biotechnology+Inc
Average 90 stars, based on 1 article reviews
double-stranded oligonucleotides containing rxr-rxr (dr1) binding consensus sequences - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega 22-bp dna fragment oligonucleotide nf- b consensus sequence
22 Bp Dna Fragment Oligonucleotide Nf B Consensus Sequence, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus/10__1074_slash_jbc__m109__023044-79-19-23?v=Promega
Average 90 stars, based on 1 article reviews
22-bp dna fragment oligonucleotide nf- b consensus sequence - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Geneka Biotechnology Inc sp1 consensus binding site oligonucleotide
Sp1 Consensus Binding Site Oligonucleotide, supplied by Geneka Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus/10__1074_slash_jbc__m107773200-74-1-18?v=Geneka+Biotechnology+Inc
Average 90 stars, based on 1 article reviews
sp1 consensus binding site oligonucleotide - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Genomatix gmbh re-1 consensus matrix
Re 1 Consensus Matrix, supplied by Genomatix gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus/10__1074_slash_jbc__m111__310763-246-23-24?v=Genomatix+gmbh
Average 90 stars, based on 1 article reviews
re-1 consensus matrix - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega sp1 consensus , attcgatc ggggcgggg cgagc
Sp1 Consensus , Attcgatc Ggggcgggg Cgagc, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus/pmc00533985-3-3-8?v=Promega
Average 90 stars, based on 1 article reviews
sp1 consensus , attcgatc ggggcgggg cgagc - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega γ- 32 p-labeled nf-κb consensus oligonucleotide probe 5′-agttgaggggactttcccaggc-3′
<t>TAB-induced</t> <t>NF-κB</t> activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.
γ 32 P Labeled Nf κb Consensus Oligonucleotide Probe 5′ Agttgaggggactttcccaggc 3′, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus/pmc02853899-105-15-20?v=Promega
Average 90 stars, based on 1 article reviews
γ- 32 p-labeled nf-κb consensus oligonucleotide probe 5′-agttgaggggactttcccaggc-3′ - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Retrogen Inc consensus and mutant oligonucleotide of sm α actin sre
<t>TAB-induced</t> <t>NF-κB</t> activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.
Consensus And Mutant Oligonucleotide Of Sm α Actin Sre, supplied by Retrogen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus/pmc01942159-120-8-24?v=Retrogen+Inc
Average 90 stars, based on 1 article reviews
consensus and mutant oligonucleotide of sm α actin sre - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Walser GmbH consensus sequences of l1 families
Primate <t>L1</t> families. A full-length generic primate L1 element is shown. The primate-specific L1Pa families examined here are placed on a simplified primate tree according to their average ages (see Methods). The columns give the KB of ORFII orthologs of the various families used for the various analyses in this paper (see Methods). M, P, and H indicate Macaca mulatta (macaque, Old World monkey), Pan troglodytes (chimpanzee), and Homo sapiens (human), respectively. The ages for the divergences of theses species were derived as described <t>earlier</t> <t>(Walser</t> et al. 2008). See Methods and Results, for details on the various steps outlined on the right side of the figure.
Consensus Sequences Of L1 Families, supplied by Walser GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus/pmc02892088-240-3-12?v=Walser+GmbH
Average 90 stars, based on 1 article reviews
consensus sequences of l1 families - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega 32 p-radiolabeled consensus oligonucleotides 5'agttgaggggactttcccaggc-3
Primate <t>L1</t> families. A full-length generic primate L1 element is shown. The primate-specific L1Pa families examined here are placed on a simplified primate tree according to their average ages (see Methods). The columns give the KB of ORFII orthologs of the various families used for the various analyses in this paper (see Methods). M, P, and H indicate Macaca mulatta (macaque, Old World monkey), Pan troglodytes (chimpanzee), and Homo sapiens (human), respectively. The ages for the divergences of theses species were derived as described <t>earlier</t> <t>(Walser</t> et al. 2008). See Methods and Results, for details on the various steps outlined on the right side of the figure.
32 P Radiolabeled Consensus Oligonucleotides 5'agttgaggggactttcccaggc 3, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus/pmc03226551-74-55-64?v=Promega
Average 90 stars, based on 1 article reviews
32 p-radiolabeled consensus oligonucleotides 5'agttgaggggactttcccaggc-3 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


TAB-induced NF-κB activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.

Journal: Physiological Genomics

Article Title: Superoxide scavenging and Akt inhibition in myocardium ameliorate pressure overload-induced NF-?B activation and cardiac hypertrophy

doi: 10.1152/physiolgenomics.00202.2009

Figure Lengend Snippet: TAB-induced NF-κB activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.

Article Snippet: EMSA was performed with 6 μg of nuclear protein incubated with a γ- 32 P-labeled NF-κB consensus oligonucleotide probe 5′-AGTTGAGGGGACTTTCCCAGGC-3′ (Promega, Madison, WI) as described earlier ( 52 ).

Techniques: Activation Assay, Luciferase, Activity Assay, In Vivo, Imaging, Dominant Negative Mutation

Primate L1 families. A full-length generic primate L1 element is shown. The primate-specific L1Pa families examined here are placed on a simplified primate tree according to their average ages (see Methods). The columns give the KB of ORFII orthologs of the various families used for the various analyses in this paper (see Methods). M, P, and H indicate Macaca mulatta (macaque, Old World monkey), Pan troglodytes (chimpanzee), and Homo sapiens (human), respectively. The ages for the divergences of theses species were derived as described earlier (Walser et al. 2008). See Methods and Results, for details on the various steps outlined on the right side of the figure.

Journal: Genome Research

Article Title: The mutational spectrum of non-CpG DNA varies with CpG content

doi: 10.1101/gr.103283.109

Figure Lengend Snippet: Primate L1 families. A full-length generic primate L1 element is shown. The primate-specific L1Pa families examined here are placed on a simplified primate tree according to their average ages (see Methods). The columns give the KB of ORFII orthologs of the various families used for the various analyses in this paper (see Methods). M, P, and H indicate Macaca mulatta (macaque, Old World monkey), Pan troglodytes (chimpanzee), and Homo sapiens (human), respectively. The ages for the divergences of theses species were derived as described earlier (Walser et al. 2008). See Methods and Results, for details on the various steps outlined on the right side of the figure.

Article Snippet: Consensus sequences of L1 families These were derived as described earlier ( Walser et al. 2008 ) except we limited ourselves to the ∼3800 bp (depending on the family) ORF2 sequence because we could use the highly conserved amino acid sequence of the ORF2 protein as a guide for aligning the base sequences.

Techniques: Derivative Assay

Mutational fate of each of the four bases for different L1 families. Panel A shows the distribution of A mutations to G, C, and T that occurred between the human and chimpanzee lineages for each L1Pa family. There are two x-axes on the bottom of panel A: the top one (boxed in gray) gives the total mutations (N × 103) that occurred and the bottom one (in bold) indicates the L1Pa family. For example, we found (Methods, Determination of the Mutational Spectrum) that 17,458 substitutions of A occurred between the chimpanzee and human L1Pa3 orthologs (rounded to 17.5 × 103 in Fig. 5): 8387 and 9071, respectively, for the human and chimpanzee orthologs. Of the total, 10,095 (0.58) were G transitions (green bar, left y-axis), 4595 (0.26) were C transversions (red bar, right y-axis), and 2768 (0.16) were T transversions (blue bar, right y-axis). Note that the left (transitions) and right (transversions) axes cover different ranges. The numbers of A mutations to G, and A transversions to C or T were about the same for chimpanzee and human (results not shown). For L1Pa4, 16,678 (16.7 × 103) A mutations occurred, again with about one-half occurring in chimpanzee and human, and again the numbers of G transitions and C or T transversions were about the same in chimpanzees and human. And so on for the rest of the families in panel A and for the mutations of G, C, and T presented in panels G, C, and T respectively. In each case the green bar (left axis) shows transitions and the red and blue bars (right axis) show transversions. The gray line is the total non-CpG divergence for each L1Pa family normalized to that of L1Pa3, set to 1.0. Families that differ in total non-CpG divergence generally differ in their proportions of transitions and transversions, especially in regard to mutations of A, G, and C (much less so for T). For example, chi-square comparisons in panel A showed that the proportion of transitions and transversions in L1Pa3 are significantly different from that of L1Pa4 (indicated by the asterisks between these families). Likewise the distribution of transitions and transversions in L1Pa4 is significantly different from that of L1Pa5, but this is not the case for proportions of transitions and transversion between L1Pa7 and L1Pa8.

Journal: Genome Research

Article Title: The mutational spectrum of non-CpG DNA varies with CpG content

doi: 10.1101/gr.103283.109

Figure Lengend Snippet: Mutational fate of each of the four bases for different L1 families. Panel A shows the distribution of A mutations to G, C, and T that occurred between the human and chimpanzee lineages for each L1Pa family. There are two x-axes on the bottom of panel A: the top one (boxed in gray) gives the total mutations (N × 103) that occurred and the bottom one (in bold) indicates the L1Pa family. For example, we found (Methods, Determination of the Mutational Spectrum) that 17,458 substitutions of A occurred between the chimpanzee and human L1Pa3 orthologs (rounded to 17.5 × 103 in Fig. 5): 8387 and 9071, respectively, for the human and chimpanzee orthologs. Of the total, 10,095 (0.58) were G transitions (green bar, left y-axis), 4595 (0.26) were C transversions (red bar, right y-axis), and 2768 (0.16) were T transversions (blue bar, right y-axis). Note that the left (transitions) and right (transversions) axes cover different ranges. The numbers of A mutations to G, and A transversions to C or T were about the same for chimpanzee and human (results not shown). For L1Pa4, 16,678 (16.7 × 103) A mutations occurred, again with about one-half occurring in chimpanzee and human, and again the numbers of G transitions and C or T transversions were about the same in chimpanzees and human. And so on for the rest of the families in panel A and for the mutations of G, C, and T presented in panels G, C, and T respectively. In each case the green bar (left axis) shows transitions and the red and blue bars (right axis) show transversions. The gray line is the total non-CpG divergence for each L1Pa family normalized to that of L1Pa3, set to 1.0. Families that differ in total non-CpG divergence generally differ in their proportions of transitions and transversions, especially in regard to mutations of A, G, and C (much less so for T). For example, chi-square comparisons in panel A showed that the proportion of transitions and transversions in L1Pa3 are significantly different from that of L1Pa4 (indicated by the asterisks between these families). Likewise the distribution of transitions and transversions in L1Pa4 is significantly different from that of L1Pa5, but this is not the case for proportions of transitions and transversion between L1Pa7 and L1Pa8.

Article Snippet: Consensus sequences of L1 families These were derived as described earlier ( Walser et al. 2008 ) except we limited ourselves to the ∼3800 bp (depending on the family) ORF2 sequence because we could use the highly conserved amino acid sequence of the ORF2 protein as a guide for aligning the base sequences.

Techniques: