Journal: EMBO Reports

Article Title: Loss of primary cilia promotes inflammation and carcinogenesis

doi: 10.15252/embr.202255687

Figure Lengend Snippet: A Representative image of vimentin + fibroblasts (in green) expressing PC (identified using Arl13b, in red) in a normal colon. Nuclei were stained with DAPI (in blue). Most PC are detected on vimentin + cells (arrow), and few on vimentin‐negative epithelial cells (arrowhead). Scale bars represent 50 μm in the upper and 10 μm in the lower panel. B, C Quantitative analysis of PC presence on tumoral and peritumoral regions of colons from CRC patients ( n = 28) at tumor (T) stages 1–4. The panels represent the quantification of PC expression (B) of vimentin positive cells per mm 2 and (C) per vimentin positive cells as an arbitrary unit (AU, see ). Data are presented as Box‐and‐whisker plots. The box plot shows the median (inside line), 25–75 percentiles (box bottom to top), and the Whiskers connect the minimum and the maximum values to the Box. * p < 0.05, ** p < 0.01, *** p < 10 −3 , **** p < 10 −4 by two‐tailed unpaired t ‐test. Images were acquired on an Andor Dragonfly Spinning Disk Confocal microscope and analyzed with the Imaris software. Quantification of PC and Vimentin + fibroblasts was done on at least five random fields (about 1 mm 2 each) per sample using ImageJ software.

Article Snippet: Fluorescent images were acquired on a brightfield microscope (Leica) using Metamorph software, inverted Confocal SP5 (Leica) using the Leica LAS AF software, or an Andor Dragonfly Spinning Disk Confocal microscope employing Imaris software.

Techniques: Expressing, Staining, Whisker Assay, Two Tailed Test, Microscopy, Software

Journal: Applied Sciences

Article Title: Microgravity-Induced Cell-to-Cell Junctional Contacts Are Counteracted by Antioxidant Compounds in TCam-2 Seminoma Cells

doi: 10.3390/app10228289

Figure Lengend Snippet: Figure 3. Confocal microscopy analysis of the distribution pattern of pan-cadherin (A,B), beta1 integrin (C,D), and vimentin (E,F) in TCam-2 seminoma cells cultured for 24 h at 1 g (CTR: A,C,E) and in simulated microgravity (RPM: B,D,F). BAR: 60 µm.

Article Snippet: MA1-91128, Thermo Fisher Scientific, Monza, Italy), or a rabbit polyclonal anti beta1 integrin (1:500 dilution, clone M106 cod. sc-8978, Santa Cruz Biotechnology), or a mouse monoclonal anti vimentin (1:500 dilution, clone V9 cod.

Techniques: Confocal Microscopy, Cell Culture

Journal: Applied Sciences

Article Title: Microgravity-Induced Cell-to-Cell Junctional Contacts Are Counteracted by Antioxidant Compounds in TCam-2 Seminoma Cells

doi: 10.3390/app10228289

Figure Lengend Snippet: Figure 5. Confocal microscopy analysis of double-immunofluorescence staining of beta1 integrin (green signal) and vimentin (red signal) in TCam-2 seminoma cells exposed to simulated microgravity for 24 h. In the bottom panel, the merging picture is reported showing that Vimentin does not co-localize with beta1 integrin (yellow signal).

Article Snippet: MA1-91128, Thermo Fisher Scientific, Monza, Italy), or a rabbit polyclonal anti beta1 integrin (1:500 dilution, clone M106 cod. sc-8978, Santa Cruz Biotechnology), or a mouse monoclonal anti vimentin (1:500 dilution, clone V9 cod.

Techniques: Confocal Microscopy, Staining

Journal: Applied Sciences

Article Title: Microgravity-Induced Cell-to-Cell Junctional Contacts Are Counteracted by Antioxidant Compounds in TCam-2 Seminoma Cells

doi: 10.3390/app10228289

Figure Lengend Snippet: Figure 6. Representative immunoblots of beta1 integrin, pan-cadherin, and vimentin expression levels (A) and the corresponding densitometric analyses (B). These last ones were performed on bands at the corresponding molecular weight of beta1 integrin, pan-cadherin, vimentin, and GAPDH. In addition, they were plotted as a ratio between RPM and CTR, each calculated by the ratio between OD × mm2 of each band and OD × mm2 of the respective band in the immunoblot of the GAPDH, considered as a loading control. In the densitometric analyses, data are means ± SEM from three independent experiments. * p < 0.05.

Article Snippet: MA1-91128, Thermo Fisher Scientific, Monza, Italy), or a rabbit polyclonal anti beta1 integrin (1:500 dilution, clone M106 cod. sc-8978, Santa Cruz Biotechnology), or a mouse monoclonal anti vimentin (1:500 dilution, clone V9 cod.

Techniques: Western Blot, Expressing, Molecular Weight, Control

Journal: Nature Communications

Article Title: In vivo cation exchange in quantum dots for tumor-specific imaging

doi: 10.1038/s41467-017-00153-y

Figure Lengend Snippet: Breast tumor-specific imaging achieved by extravascular delivery of etchable ZHS-QDs. Mice bearing orthotopic MCF10CA1a human breast tumors received an intravenous injection of iRGD or PBS before an intravenous dose of ZHS-QDs. Ag-TS was given intraperitoneally. n = 4 per group. a The mice were anesthetized and imaged with a Li-Cor Pearl imager 40 min after etching. Arrows , tumors. b In situ NIR imaging of the mice after euthanasia and necropsy performed under deep anesthesia. c NIR images of collected tissues. d NIR signal per unit area in collected tissues ( left panel ) and T/Li ratio ( right panel ). B, brain; H, heart; Li, liver; S, spleen; Lu, lung; K, kidney; T, tumor. Statistics, two-way analysis of variance ( left panel ) or Student’s t -test ( right panel ); error bars , SEM; ns, not significant; * P < 0.05; *** P < 0.001. e Confocal micrographs of cultured MCF10CA1a cells treated with ZHS-QDs with or without free iRGD followed by etching with Ag-TS. Note that the QDs were internalized into the cells in the presence of iRGD, and that only the extracellular QDs were etched. Blue, Hoechst 33342; green, ZHS-QDs; scale bars , 50 μm. Insets show a magnified view of the boxed areas . f Epifluorescence micrographs of cultured PC-3 human prostate cancer cells treated with cell-penetrating QDs followed by etching with Ag-TS. PC-3 cells were incubated with CdSe/ZnS QDs coated with a cell-penetrating peptide KCDGRPARPAR. Only speckled peri-nuclear signals remain after etching. Scale bars , 50 µm. g The tumors shown in c were processed for immunofluorescence staining and subjected to confocal microscopy. Blue , DAPI; red , CD31 or α-SMA; green , ZHS-QDs; scale bars , 50 μm. The boxed area is magnified. Note that the QD signals are found in the perinuclear area of the cells

Article Snippet: Tissue sections were treated with 0.25% Triton X-100 for 10 min, washed with PBS 3 times, blocked with 1% bovine serum albumin for 1 h, and incubated with a rat anti-mouse CD31 primary antibody (Catalog number: 553370, BD Biosciences, San Jose, CA), rabbit anti-mouse α-SMA antibody (Product code: ab5694, Abcam, Cambridge, MA), or a rat anti-mouse ER-TR7 antibody (Catalog number: sc-73355, Santa Cruz Biotechnology, Dallas, TX) at 4 °C overnight.

Techniques: Imaging, Injection, In Situ, Cell Culture, Incubation, Immunofluorescence, Staining, Confocal Microscopy

Journal: Nature Communications

Article Title: In vivo cation exchange in quantum dots for tumor-specific imaging

doi: 10.1038/s41467-017-00153-y

Figure Lengend Snippet: Desmoplastic PDAC imaging with etchable ZHS-QDs. a H&E staining of orthotopic KRAS-Ink tumor tissue collected from mice. A mixed histology ranging from pancreas tissue with severe desmoplasia, high-grade PanIN, to full-blown PDAC is observed. n = 3, scale bars , 100 μm. b – e Mice bearing orthotopic KRAS-Ink PDAC tumors received intravenous injections of iRGD or PBS 25 min before ZHS-QD injection. Ag-TS was intravenously injected 30 min after the QD injection. n = 3 per group. NIR images of anesthetized mice b and collected tissues c . Arrows , tumors; dotted lines , tissues. B, brain; H, heart; Li, liver; S, spleen; Lu, lung; K, kidney; T, tumor. NIR signal per unit area in collected tissues ( left panel ) and T/Li ratio ( right panel ) d . Statistics, two-way analysis of variance ( left panel ) or Student’s t -test ( right panel ); error bars , SEM; ns, not significant; * P < 0.05; *** P < 0.001. Confocal micrographs of tumor sections e . Blue , DAPI; red , CD31, ER-TR7 or α-SMA; green , ZHS-QDs; scale bars , 50 μm; P stands for PanIN. Inset , an area with PanINs

Article Snippet: Tissue sections were treated with 0.25% Triton X-100 for 10 min, washed with PBS 3 times, blocked with 1% bovine serum albumin for 1 h, and incubated with a rat anti-mouse CD31 primary antibody (Catalog number: 553370, BD Biosciences, San Jose, CA), rabbit anti-mouse α-SMA antibody (Product code: ab5694, Abcam, Cambridge, MA), or a rat anti-mouse ER-TR7 antibody (Catalog number: sc-73355, Santa Cruz Biotechnology, Dallas, TX) at 4 °C overnight.

Techniques: Imaging, Staining, Injection

Journal: Cell reports

Article Title: Diet-induced modifications to human microbiome reshape colonic homeostasis in irritable bowel syndrome.

doi: 10.1016/j.celrep.2022.111657

Figure Lengend Snippet: Figure 1. Low-FODMAP diet modifies gut microbiome composition in patients with IBS-D (A) Experimental design: a longitudinal cohort of therapy-naive patients with IBS-D (n = 10; patients exhibited IBS symptoms for at least a year) included clinical evaluations and microbiome sampling throughout 6 weeks of low-FODMAP diet. Microbiome composition was determined by 16S rRNA gene sequencing. The functional impact of post-diet microbiota was determined by ex vivo stimulation of colon organ cultures with patient microbiota samples pre- and post-diet. Colonic gene expression was determined using bulk RNA sequencing followed by predictions of reciprocal associations between specific microbial taxa and differentially expressed host genes. (B) Weight loss was observed in patients with IBS-D following low-FODMAP diet. Weight is represented as a fraction of the initial (pre-diet) weight, at the mid- phase (3 weeks), and at the end phase (6 weeks) of the diet. Colored lines represent individual patients, and black line represents average weight change with standard error bars. Statistical significance was determined by one-way ANOVA with multiple comparisons, **adjusted p value = 0.003. (C and D) Normalized abundance of A. timonensis (C) and B. adolescentis (D) in patients’ gut microbiota at the beginning (0 weeks), middle (3 weeks), and end (6 weeks) of low-FODMAP diet. Legend: patient ID by color. Statistical significance was determined by Wald test (DESeq), **p < 0.01.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ZO-1 Polyclonal Antibody Invitrogen Cat#40–2200 Purified Mouse Anti-Human ZO-1 BD bioscience Cat#610967 Cy5-AffiniPure Donkey Anti-Mouse IgG (H + L) Jackson Cat#715-175-151 Cy3-AffiniPure Donkey Anti-Rabbit IgG (H + L) Jackson Cat#711-165-152 Bacterial and virus strains Bifidobacterium adolescentis DSMZ Cat#20083 Bacteroides fragilis ATCC Cat#NCTC 9343 Biological samples Human fecal samples of IBS-D patients This paper N/A Chemicals, peptides, and recombinant proteins SYBER green Thermo Fisher scientific Cat#4385614 TOS-propionate agar medium MERCK Cat#43314 Lithium mupirocin MERCK Cat#73346-79-9 RNAlater RNAStabilization Reagent (50mL) Qiagen Cat#76104 Fluorescein isothiocyanate–dextran MERCK Cat#FD-4 CytoView Z, 96-well impedance Axion BioSystems Cat#Z96-IMP-96B-25 Fluoroshield MERCK F6182 Critical commercial assays NextSeq 500 High Output v2 kit Illumina Cat#FC-404-2005 DNeasy PowerSoil Kit Qiagen Cat#12888–100 Miseq V2 Kit Illumina Cat#MS-103-1002 Direct-zolTM RNA Microprep Zymo Cat#R2062 qSqript Quanta bio Cat#95047–100 RNEASY Micro kit (50) Qiagen Cat#20–74004 RNeasy Plus Universal Mini QIAGEN kit Qiagen Cat#74134 TruSeq stranded mRNA library prep kit Illumina Cat#20020594 Deposited data Raw and normalized data (16S and RNAseq) This paper GEO: GSE215050 Experimental models: Cell lines CaCo-2 human colon colorectal adenocarcinoma cell line Kindly provided by Prof. Ohad Gal-Mor, Sheba Medical Center, Israel Experimental models: Organisms/strains C57BL/6JOlaHsd mice Envigo, Israel Cat#2BL-623 Oligonucleotides Forward primer for Eef2 RT-PCR: AACTTCACGGTAGACCAGATCC N/A Reverse primer for Eef2 RT-PCR: TCGTCCTTCCGGGTATCAGTG N/A Forward primer for Tjp1 RT-PCR: CGGTCCTCTGAGCCTGTAAG N/A Reverse primer for Tjp1 RT-PCR: GGATCTACATGCGACGACAA N/A (Continued on next page) Cell Reports 41, 111657, November 15, 2022 e1

Techniques: Sampling, Sequencing, Functional Assay, Ex Vivo, Gene Expression, RNA Sequencing

Journal: Cell reports

Article Title: Diet-induced modifications to human microbiome reshape colonic homeostasis in irritable bowel syndrome.

doi: 10.1016/j.celrep.2022.111657

Figure Lengend Snippet: Figure 3. B. adolescentis disrupts TJ integrity and epithelial barrier functions (A) Gene expression assessed by RT-PCR in CaCo-2 cells co-cultured for 4 h with B.adolescentis or B.fragilis. Computed tomography (CT) values are normalized to the reference gene, Eef2. Data acquired by three independent experiments. (B and C) Confocal microscopy images stained for ZO-1 (B) and quantification of mean fluorescence intensity (MFI) (C) of CaCo-2 cells following different treatments.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ZO-1 Polyclonal Antibody Invitrogen Cat#40–2200 Purified Mouse Anti-Human ZO-1 BD bioscience Cat#610967 Cy5-AffiniPure Donkey Anti-Mouse IgG (H + L) Jackson Cat#715-175-151 Cy3-AffiniPure Donkey Anti-Rabbit IgG (H + L) Jackson Cat#711-165-152 Bacterial and virus strains Bifidobacterium adolescentis DSMZ Cat#20083 Bacteroides fragilis ATCC Cat#NCTC 9343 Biological samples Human fecal samples of IBS-D patients This paper N/A Chemicals, peptides, and recombinant proteins SYBER green Thermo Fisher scientific Cat#4385614 TOS-propionate agar medium MERCK Cat#43314 Lithium mupirocin MERCK Cat#73346-79-9 RNAlater RNAStabilization Reagent (50mL) Qiagen Cat#76104 Fluorescein isothiocyanate–dextran MERCK Cat#FD-4 CytoView Z, 96-well impedance Axion BioSystems Cat#Z96-IMP-96B-25 Fluoroshield MERCK F6182 Critical commercial assays NextSeq 500 High Output v2 kit Illumina Cat#FC-404-2005 DNeasy PowerSoil Kit Qiagen Cat#12888–100 Miseq V2 Kit Illumina Cat#MS-103-1002 Direct-zolTM RNA Microprep Zymo Cat#R2062 qSqript Quanta bio Cat#95047–100 RNEASY Micro kit (50) Qiagen Cat#20–74004 RNeasy Plus Universal Mini QIAGEN kit Qiagen Cat#74134 TruSeq stranded mRNA library prep kit Illumina Cat#20020594 Deposited data Raw and normalized data (16S and RNAseq) This paper GEO: GSE215050 Experimental models: Cell lines CaCo-2 human colon colorectal adenocarcinoma cell line Kindly provided by Prof. Ohad Gal-Mor, Sheba Medical Center, Israel Experimental models: Organisms/strains C57BL/6JOlaHsd mice Envigo, Israel Cat#2BL-623 Oligonucleotides Forward primer for Eef2 RT-PCR: AACTTCACGGTAGACCAGATCC N/A Reverse primer for Eef2 RT-PCR: TCGTCCTTCCGGGTATCAGTG N/A Forward primer for Tjp1 RT-PCR: CGGTCCTCTGAGCCTGTAAG N/A Reverse primer for Tjp1 RT-PCR: GGATCTACATGCGACGACAA N/A (Continued on next page) Cell Reports 41, 111657, November 15, 2022 e1

Techniques: Gene Expression, Reverse Transcription Polymerase Chain Reaction, Cell Culture, Computed Tomography, Confocal Microscopy, Staining