|
RStudio
r package complex heatmap ![]() R Package Complex Heatmap, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/r package complex heatmap/product/RStudio Average 90 stars, based on 1 article reviews
r package complex heatmap - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
RStudio
r studio 19.0 ![]() R Studio 19.0, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/r studio 19.0/product/RStudio Average 90 stars, based on 1 article reviews
r studio 19.0 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
volcano plot (r package version 1.4.0) ![]() Volcano Plot (R Package Version 1.4.0), supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/volcano plot (r package version 1.4.0)/product/Broad Institute Inc Average 90 stars, based on 1 article reviews
volcano plot (r package version 1.4.0) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Becton Dickinson
v10.8.1 ![]() V10.8.1, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/v10.8.1/product/Becton Dickinson Average 90 stars, based on 1 article reviews
v10.8.1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Millipore
tardbp-g368a_reverse ![]() Tardbp G368a Reverse, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tardbp-g368a_reverse/product/Millipore Average 90 stars, based on 1 article reviews
tardbp-g368a_reverse - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
phage-teto-stemcca ![]() Phage Teto Stemcca, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phage-teto-stemcca/product/Addgene inc Average 90 stars, based on 1 article reviews
phage-teto-stemcca - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
graphpad prism 9.0 ![]() Graphpad Prism 9.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/graphpad prism 9.0/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
graphpad prism 9.0 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Indica Labs
halo v3.5 ![]() Halo V3.5, supplied by Indica Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/halo v3.5/product/Indica Labs Average 90 stars, based on 1 article reviews
halo v3.5 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 puro vector addgene ![]() Plko 1 Puro Vector Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 puro vector addgene/product/Addgene inc Average 98 stars, based on 1 article reviews
plko 1 puro vector addgene - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
|
Addgene inc
pmd2 g plasmid addgene ![]() Pmd2 G Plasmid Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pmd2 g plasmid addgene/product/Addgene inc Average 98 stars, based on 1 article reviews
pmd2 g plasmid addgene - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
kasumi-1 cells ![]() Kasumi 1 Cells, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/kasumi-1 cells/product/Broad Institute Inc Average 90 stars, based on 1 article reviews
kasumi-1 cells - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
prism 9.0 and 10.0 ![]() Prism 9.0 And 10.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prism 9.0 and 10.0/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
prism 9.0 and 10.0 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Heliyon
Article Title: Evaluation of yield attributes and bioactive phytochemicals of twenty amaranth genotypes of Bengal floodplain
doi: 10.1016/j.heliyon.2023.e19644
Figure Lengend Snippet: Heatmap and hierarchical clustering for morpho-agronomical and biochemical parameters constructed using Complex Heatmap package. The heatmap plot describes the relative abundance of each amaranth genotype (columns) within each feature (rows). The color code (blue to dark red) displays the row z-score: red color indicates high abundance and blue color low abundance. The dendrogram shows hierarchical clustering of amaranth genotypes based on Euclidian as the measure of distance and Ward's cluster agglomeration method. PH = Plant height, SBD = Stem base diameter, L/P = Leaves/plant, SW = Shoot weight, RW = Root weight, STW = Stem weight, Chl = Chlorophyll, β-Cy = β-cyanins, β-X = β-xanthins, β-C = β-carotene, TF = Total flavonoids, TP = Total polyphenols, FY = Foliage yield.
Article Snippet: The biochemical and morpho-physiological traits were used to build a two-way clustering heatmap using the
Techniques: Construct
Journal: Cell systems
Article Title: BraInMap elucidates the macromolecular connectivity landscape of mammalian brain
doi: 10.1016/j.cels.2020.03.003
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: 5‘-GTACTTGCGCTCAGGAGGA TARDBP-outer_Forward Millipore-Sigma CAAGATGAGCCTTTGAGAAGC TARDBP-outer_Reverse Millipore-Sigma AGAGCTGCCAGGAAACAGC TARDBP-G287A_ Forward Millipore-Sigma AATCAGGCTGGATTTGGTAATAGCAGAGGG TARDBP-G287A_ Reverse Millipore-Sigma AAATCCAGCCTGATTCCCAAAGC TARDBP-A315T_ Forward Millipore-Sigma TTGGTACGTTCAGCATTAATCCAGCC TARDBP-A315T_Reverse Millipore-Sigma GAACGTACCAAAGTTCATCCCACC TARDBP-G368A_ Forward Millipore-Sigma GCCTTCGCTTCTGGAAATAACTCTTATAGTGG TARDBP-G368A_
Techniques: Mutagenesis, Recombinant, Protease Inhibitor, Bicinchoninic Acid Protein Assay, Functional Assay, Expressing, RNA Binding Assay, Software, Sequencing, Mann-Whitney U-Test, Mass Spectrometry