complex heatmap r-package Search Results


90
RStudio r package complex heatmap
<t>Heatmap</t> and hierarchical clustering for morpho-agronomical and biochemical parameters constructed using Complex Heatmap package. The heatmap plot describes the relative abundance of each amaranth genotype (columns) within each feature (rows). The color code (blue to dark red) displays the row z-score: red color indicates high abundance and blue color low abundance. The dendrogram shows hierarchical clustering of amaranth genotypes based on Euclidian as the measure of distance and Ward's cluster agglomeration method. PH = Plant height, SBD = Stem base diameter, L/P = Leaves/plant, SW = Shoot weight, RW = Root weight, STW = Stem weight, Chl = Chlorophyll, β-Cy = β-cyanins, β-X = β-xanthins, β-C = β-carotene, TF = Total flavonoids, TP = Total polyphenols, FY = Foliage yield.
R Package Complex Heatmap, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/r package complex heatmap/product/RStudio
Average 90 stars, based on 1 article reviews
r package complex heatmap - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
RStudio r studio 19.0
<t>Heatmap</t> and hierarchical clustering for morpho-agronomical and biochemical parameters constructed using Complex Heatmap package. The heatmap plot describes the relative abundance of each amaranth genotype (columns) within each feature (rows). The color code (blue to dark red) displays the row z-score: red color indicates high abundance and blue color low abundance. The dendrogram shows hierarchical clustering of amaranth genotypes based on Euclidian as the measure of distance and Ward's cluster agglomeration method. PH = Plant height, SBD = Stem base diameter, L/P = Leaves/plant, SW = Shoot weight, RW = Root weight, STW = Stem weight, Chl = Chlorophyll, β-Cy = β-cyanins, β-X = β-xanthins, β-C = β-carotene, TF = Total flavonoids, TP = Total polyphenols, FY = Foliage yield.
R Studio 19.0, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/r studio 19.0/product/RStudio
Average 90 stars, based on 1 article reviews
r studio 19.0 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Broad Institute Inc volcano plot (r package version 1.4.0)
<t>Heatmap</t> and hierarchical clustering for morpho-agronomical and biochemical parameters constructed using Complex Heatmap package. The heatmap plot describes the relative abundance of each amaranth genotype (columns) within each feature (rows). The color code (blue to dark red) displays the row z-score: red color indicates high abundance and blue color low abundance. The dendrogram shows hierarchical clustering of amaranth genotypes based on Euclidian as the measure of distance and Ward's cluster agglomeration method. PH = Plant height, SBD = Stem base diameter, L/P = Leaves/plant, SW = Shoot weight, RW = Root weight, STW = Stem weight, Chl = Chlorophyll, β-Cy = β-cyanins, β-X = β-xanthins, β-C = β-carotene, TF = Total flavonoids, TP = Total polyphenols, FY = Foliage yield.
Volcano Plot (R Package Version 1.4.0), supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/volcano plot (r package version 1.4.0)/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
volcano plot (r package version 1.4.0) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Becton Dickinson v10.8.1
<t>Heatmap</t> and hierarchical clustering for morpho-agronomical and biochemical parameters constructed using Complex Heatmap package. The heatmap plot describes the relative abundance of each amaranth genotype (columns) within each feature (rows). The color code (blue to dark red) displays the row z-score: red color indicates high abundance and blue color low abundance. The dendrogram shows hierarchical clustering of amaranth genotypes based on Euclidian as the measure of distance and Ward's cluster agglomeration method. PH = Plant height, SBD = Stem base diameter, L/P = Leaves/plant, SW = Shoot weight, RW = Root weight, STW = Stem weight, Chl = Chlorophyll, β-Cy = β-cyanins, β-X = β-xanthins, β-C = β-carotene, TF = Total flavonoids, TP = Total polyphenols, FY = Foliage yield.
V10.8.1, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/v10.8.1/product/Becton Dickinson
Average 90 stars, based on 1 article reviews
v10.8.1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Millipore tardbp-g368a_reverse
KEY RESOURCES TABLE
Tardbp G368a Reverse, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tardbp-g368a_reverse/product/Millipore
Average 90 stars, based on 1 article reviews
tardbp-g368a_reverse - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Addgene inc phage-teto-stemcca
KEY RESOURCES TABLE
Phage Teto Stemcca, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phage-teto-stemcca/product/Addgene inc
Average 90 stars, based on 1 article reviews
phage-teto-stemcca - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphpad prism 9.0
KEY RESOURCES TABLE
Graphpad Prism 9.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prism 9.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prism 9.0 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Indica Labs halo v3.5
KEY RESOURCES TABLE
Halo V3.5, supplied by Indica Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/halo v3.5/product/Indica Labs
Average 90 stars, based on 1 article reviews
halo v3.5 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

98
Addgene inc plko 1 puro vector addgene
KEY RESOURCES TABLE
Plko 1 Puro Vector Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 puro vector addgene/product/Addgene inc
Average 98 stars, based on 1 article reviews
plko 1 puro vector addgene - by Bioz Stars, 2026-03
98/100 stars
  Buy from Supplier

98
Addgene inc pmd2 g plasmid addgene
KEY RESOURCES TABLE
Pmd2 G Plasmid Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pmd2 g plasmid addgene/product/Addgene inc
Average 98 stars, based on 1 article reviews
pmd2 g plasmid addgene - by Bioz Stars, 2026-03
98/100 stars
  Buy from Supplier

90
Broad Institute Inc kasumi-1 cells
KEY RESOURCES TABLE
Kasumi 1 Cells, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kasumi-1 cells/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
kasumi-1 cells - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc prism 9.0 and 10.0
KEY RESOURCES TABLE
Prism 9.0 And 10.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prism 9.0 and 10.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prism 9.0 and 10.0 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Heatmap and hierarchical clustering for morpho-agronomical and biochemical parameters constructed using Complex Heatmap package. The heatmap plot describes the relative abundance of each amaranth genotype (columns) within each feature (rows). The color code (blue to dark red) displays the row z-score: red color indicates high abundance and blue color low abundance. The dendrogram shows hierarchical clustering of amaranth genotypes based on Euclidian as the measure of distance and Ward's cluster agglomeration method. PH = Plant height, SBD = Stem base diameter, L/P = Leaves/plant, SW = Shoot weight, RW = Root weight, STW = Stem weight, Chl = Chlorophyll, β-Cy = β-cyanins, β-X = β-xanthins, β-C = β-carotene, TF = Total flavonoids, TP = Total polyphenols, FY = Foliage yield.

Journal: Heliyon

Article Title: Evaluation of yield attributes and bioactive phytochemicals of twenty amaranth genotypes of Bengal floodplain

doi: 10.1016/j.heliyon.2023.e19644

Figure Lengend Snippet: Heatmap and hierarchical clustering for morpho-agronomical and biochemical parameters constructed using Complex Heatmap package. The heatmap plot describes the relative abundance of each amaranth genotype (columns) within each feature (rows). The color code (blue to dark red) displays the row z-score: red color indicates high abundance and blue color low abundance. The dendrogram shows hierarchical clustering of amaranth genotypes based on Euclidian as the measure of distance and Ward's cluster agglomeration method. PH = Plant height, SBD = Stem base diameter, L/P = Leaves/plant, SW = Shoot weight, RW = Root weight, STW = Stem weight, Chl = Chlorophyll, β-Cy = β-cyanins, β-X = β-xanthins, β-C = β-carotene, TF = Total flavonoids, TP = Total polyphenols, FY = Foliage yield.

Article Snippet: The biochemical and morpho-physiological traits were used to build a two-way clustering heatmap using the R package Complex Heatmap [ ] in the R studio software [ ].

Techniques: Construct

KEY RESOURCES TABLE

Journal: Cell systems

Article Title: BraInMap elucidates the macromolecular connectivity landscape of mammalian brain

doi: 10.1016/j.cels.2020.03.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: 5‘-GTACTTGCGCTCAGGAGGA TARDBP-outer_Forward Millipore-Sigma CAAGATGAGCCTTTGAGAAGC TARDBP-outer_Reverse Millipore-Sigma AGAGCTGCCAGGAAACAGC TARDBP-G287A_ Forward Millipore-Sigma AATCAGGCTGGATTTGGTAATAGCAGAGGG TARDBP-G287A_ Reverse Millipore-Sigma AAATCCAGCCTGATTCCCAAAGC TARDBP-A315T_ Forward Millipore-Sigma TTGGTACGTTCAGCATTAATCCAGCC TARDBP-A315T_Reverse Millipore-Sigma GAACGTACCAAAGTTCATCCCACC TARDBP-G368A_ Forward Millipore-Sigma GCCTTCGCTTCTGGAAATAACTCTTATAGTGG TARDBP-G368A_ Reverse Millipore-Sigma CCAGAAGCGAAGGCCTGG TARDBP-W385G_ Forward Millipore-Sigma AATTGGTGGCGGATCAGCATCCAATGC TARDBP-W385G_ Reverse Millipore-Sigma ATCCGCCACCAATTGCTGCACC Recombinant DNA pENTR-TARDBP-G287A pENTR-TARDBP-A315T pENTR-TARDBP-G368A pENTR-TARDBP-W385A pLD-puro-Cc-TARDBP-WT-VA pLD-puro-Cc-TARDBP-G287A-VA pLD-puro-Cc-TARDBP-A315T-VA pLD-puro-Cc-TARDBP-G368A-VA pLD-puro-Cc-TARDBP-W387G-VA Software and Algorithms Sequence database searching MaxQuant 1.5.5.1 & 1.6.0.16 PMID: 19029910 Ortholog mapping InParanoid8 PMID: 25429972 PPI Prediction EPIC PMID: 31308550 Complex prediction ClusterONE PMID: 22426491 Network visualization Cytoscape v. 3.5.1 PMID: 14597658 Gene Set Enrichment Analysis GSEA PMID: 16199517; PMID: 12808457 Enrichment analysis BinGO 3.0 Cytoscape App PMID: 15972284 Enrichment analysis DAVID Bioinformatics resource 6.8 PMID: 19131956 Hierarchical clustering Cluster 3.0 PMID: 14871861 Cluster visualization Java TreeView v 1.1.6r4 PMID: 15180930 Hypergeometric test R function Stats: R package RNA-Seq data analysis R function edgeR: R Package RNA-SEQ analysis StringTie PMID:25690850 RNA-SEQ analysis HiSAT PMID:25751142 Binomial test Scipy function Python package Mann-Whitney U test Scipy function Python package Network analysis NetworkX Python package PIPER Schrödinger, LLC Protein-protein docking ITASSER Protein structure and function prediction PMID: 25549265 Plots R function ggplot2: R package Venn diagram R function VennDiagram: R package Overlap analysis Venn Draw Tool http://bioinformatics.psb.ugent.be/webtools/Venn/ Surrogate Variable Analysis R function sva: R package Quantile Normalization R function preprocessCore: R package Heatmap R function ComplexHeatmap: R package R R version 3.5 R Foundation for Statistical Computing IsobaricAnalyzer C++ Library OpenMS v2.4 Other Proteomics data deposition PRIDE PXD011304 Proteomics data deposition BioGRID To be deposited Nano-HPLC Thermo Scientific EASY-nLC ™ 1200 System HPLC Agilent Agilent 1100 Series Mass Spectrometer Thermo Scientific Q Exactive ™ HF-X Hybrid Quadrupole-Orbitrap ™ Mass Spectrometer Open in a separate window KEY RESOURCES TABLE BraInMap is a global proteomic survey of over 1000 multi-protein brain complexes.

Techniques: Mutagenesis, Recombinant, Protease Inhibitor, Bicinchoninic Acid Protein Assay, Functional Assay, Expressing, RNA Binding Assay, Software, Sequencing, Mann-Whitney U-Test, Mass Spectrometry