|
Proteintech
gfp ck2α Gfp Ck2α, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gfp ck2α/product/Proteintech Average 93 stars, based on 1 article reviews
gfp ck2α - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
GeneTex
polyclonal rabbit anti-ck2α primary antibody gtx107897 Polyclonal Rabbit Anti Ck2α Primary Antibody Gtx107897, supplied by GeneTex, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/polyclonal rabbit anti-ck2α primary antibody gtx107897/product/GeneTex Average 90 stars, based on 1 article reviews
polyclonal rabbit anti-ck2α primary antibody gtx107897 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Taconic Biosciences
ck2α’ heterozygous mice (ck2α’ (+/ ![]() Ck2α’ Heterozygous Mice (Ck2α’ (+/, supplied by Taconic Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ck2α’ heterozygous mice (ck2α’ (+//product/Taconic Biosciences Average 90 stars, based on 1 article reviews
ck2α’ heterozygous mice (ck2α’ (+/ - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
ck2α ![]() Ck2α, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ck2α/product/GenScript corporation Average 90 stars, based on 1 article reviews
ck2α - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
ATGen Inc
recombinant ck2α ![]() Recombinant Ck2α, supplied by ATGen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/recombinant ck2α/product/ATGen Inc Average 90 stars, based on 1 article reviews
recombinant ck2α - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
AUM Biotech
aum silence aso ck2α: tagtctgttaacgtctggtac ![]() Aum Silence Aso Ck2α: Tagtctgttaacgtctggtac, supplied by AUM Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aum silence aso ck2α: tagtctgttaacgtctggtac/product/AUM Biotech Average 90 stars, based on 1 article reviews
aum silence aso ck2α: tagtctgttaacgtctggtac - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Biaffin Inc
recombinant maize ( zea mays ) ck2 α-subunit ![]() Recombinant Maize ( Zea Mays ) Ck2 α Subunit, supplied by Biaffin Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/recombinant maize ( zea mays ) ck2 α-subunit/product/Biaffin Inc Average 90 stars, based on 1 article reviews
recombinant maize ( zea mays ) ck2 α-subunit - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Akela Pharma
anti-calnexin antibody ![]() Anti Calnexin Antibody, supplied by Akela Pharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-calnexin antibody/product/Akela Pharma Average 90 stars, based on 1 article reviews
anti-calnexin antibody - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cyclex Inc
ck2α kinase assay/inhibitor screening kit ![]() Ck2α Kinase Assay/Inhibitor Screening Kit, supplied by Cyclex Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ck2α kinase assay/inhibitor screening kit/product/Cyclex Inc Average 90 stars, based on 1 article reviews
ck2α kinase assay/inhibitor screening kit - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Upstate Biotechnology Inc
anti-ck2α ![]() Anti Ck2α, supplied by Upstate Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-ck2α/product/Upstate Biotechnology Inc Average 90 stars, based on 1 article reviews
anti-ck2α - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Affinity Biosciences
antibody against phosphorylated ck2α (p-ck2α) ![]() Antibody Against Phosphorylated Ck2α (P Ck2α), supplied by Affinity Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antibody against phosphorylated ck2α (p-ck2α)/product/Affinity Biosciences Average 90 stars, based on 1 article reviews
antibody against phosphorylated ck2α (p-ck2α) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Macrogen
lentipkg - mcmv - ha - ck2α irespuro plasmid ![]() Lentipkg Mcmv Ha Ck2α Irespuro Plasmid, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentipkg - mcmv - ha - ck2α irespuro plasmid/product/Macrogen Average 90 stars, based on 1 article reviews
lentipkg - mcmv - ha - ck2α irespuro plasmid - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: bioRxiv
Article Title: CK2 alpha prime and alpha-synuclein pathogenic functional interaction mediates inflammation and transcriptional dysregulation in Huntington’s disease
doi: 10.1101/2020.10.29.359380
Figure Lengend Snippet: A , B , Immunostaining and quantification of HTT puncta detected with anti-HTT EM48 antibody, C , D , NeuN + cells and E , F , CK2α’ levels in zQ175 compared with WT mice at 3, 6, 12 and 22 months ( n =6 mice/genotype). G , CK2α’ mRNA levels analyzed by RT-qPCR in striatum and cortex of 6 month old mice. Data was normalized to GAPDH and WT striatum (n=3 mice/genotype). H , Linear regression analysis between CK2α’ levels and HTT puncta, and I , between CK2α’ levels and number of NeuN + cells in zQ175 mice. The Pearson correlation coefficient (ρ) and R 2 are indicated. Data are mean ± SD with significance determined by one-way ANOVA Dunnett’s post-hoc test in B and F and two-way ANOVA Tukey post-hoc test in D and G . p-values <0.05 are indicated. n.s = not significant. Scale bar, 50 μm.
Article Snippet:
Techniques: Immunostaining, Quantitative RT-PCR
Journal: bioRxiv
Article Title: CK2 alpha prime and alpha-synuclein pathogenic functional interaction mediates inflammation and transcriptional dysregulation in Huntington’s disease
doi: 10.1101/2020.10.29.359380
Figure Lengend Snippet: A , RT-qPCR analysis for CK2α’ and IL-6 in immortalized embryonic striatal cells ST Hdh Q7/Q7 (control) and ST Hdh Q111/Q111 (HD) (n = 5 independent experiments). Data were normalized to GAPDH and using control cells as a reference. B , siRNA knockdown of CK2α’ for 24 h in ST Hdh Q111/Q111 cells and RT-qPCR. Data were normalized with GAPDH and relativized to non-targeting control siRNA-treated cells (scramble), ( n = 6 independent experiments). Data are mean ± SEM with significance determined by paired Student’s t-test. C , D , Representative IF images and quantitative analysis of CK2α’ in striatal MSNs immunostained for Ctip2, a specific MSN marker, in WT, zQ175 and zQ175:CK2α’ (+/-) mice at 12 months of age ( n =6 mice/genotype). Scale bar, 50 μm. E , F , Representative images of mouse cytokine array panels in striatum extracts of WT, zQ175, and zQ175:CK2α’ (+/-) at 12-14 months of age ( n = 6 mice/genotype). G-I , Iba1 IB in the striatum of 12 months old WT, zQ175 and zQ175:CK2α’. Quantification was measured by image analyses using Image J software. Scale bar, 100 μm. Error bars denote mean ± SD, values were analyzed by Student’s t test in F , and one-way ANOVA and Tukey post-hoc test in A, B, D , and H . * p represent p-values comparing zQ175 and WT, # p are p-values comparing zQ175 and zQ175:CK2α’ (+/-) .
Article Snippet:
Techniques: Quantitative RT-PCR, Marker, Software
Journal: bioRxiv
Article Title: CK2 alpha prime and alpha-synuclein pathogenic functional interaction mediates inflammation and transcriptional dysregulation in Huntington’s disease
doi: 10.1101/2020.10.29.359380
Figure Lengend Snippet: A , Representative images of striatum sections from 12-month-old mice immunostained for CK2α’ and glutamine synthetase (GS, an astrocytic marker) in WT, zQ175 and zQ175:CK2α’ (+/-) . B , Quantification of GS + cells from images in A ( n = 5 mice/genotype). C , Representative coronal images of brain scans in 9.4T magnet showing the striatum voxel (green box) for MRS acquisition from each genotype at 22 months of age. D , myo -inositol (Ins) quantification in WT, zQ175 and zQ175:CK2α’ (+/-) ( n = 4-6 mice/genotype). E , Representative IF analysis of C3d co-stained with GS in the striatum of 12-month-old mice. E’ , Higher magnification of the outlined section in E shows a representative view of a single astrocyte immunolabeled with C3d and GS. F , Quantification of C3d signal from images in E . G , Quantification of C3d + GS + double-positive cells ( n = 5 mice/genotype). DAPI is used for nuclear staining. Scale bars, 50 μm. Error bars denote mean ± SD. p -values for differences between groups are indicated in each graph and calculated using two-way ANOVA and Tukey post-hoc tests. n.s. = not significant.
Article Snippet:
Techniques: Marker, Staining, Immunolabeling
Journal: bioRxiv
Article Title: CK2 alpha prime and alpha-synuclein pathogenic functional interaction mediates inflammation and transcriptional dysregulation in Huntington’s disease
doi: 10.1101/2020.10.29.359380
Figure Lengend Snippet: A , Image shows whole-cell patch-clamp recording diagram in acute dorsolateral striatum slices, where Ctip2 labeled MSNs from 12-month-old mice. Scale bar 500 μm, Ctr: Cortex; Str: Striatum. B , Input–output curve (WT, n = 8; zQ175, n = 9; zQ175:CK2α’ (+/-) n = 13). Representative traces are shown in the top inset. C , Short-term potentiation measured via paired-pulse facilitation (WT, n = 8; zQ175, n = 9; zQ175:CK2α’ (+/-) n = 11). Representative traces of two consecutive stimuli delivered at 25 ms time intervals are shown in the top inset. D , Short-term depression analyzed through synaptic fatigue (WT, n = 7; zQ175, n = 9; zQ175:CK2α’ (+/-) n = 12). Representative traces are shown in the top inset. Values were analyzed using two-way ANOVA with Tukey’s post-hoc analysis. E-F , Spontaneous recordings of mini excitatory postsynaptic currents (mEPSCs). Amplitude (in pA; left panel) and frequency (in Hz; right panel) were analyzed (WT, n = 10; zQ175, n = 9; zQ175:CK2α’ (+/-) n = 12). G , Representative mEPSC traces. Values were analyzed using one-way ANOVA with Dunn’s post-hoc analysis. P values <0.05 are indicated. Error bars represent mean ± SEM from at least 3 mice/genotype.
Article Snippet:
Techniques: Patch Clamp, Labeling
Journal: bioRxiv
Article Title: CK2 alpha prime and alpha-synuclein pathogenic functional interaction mediates inflammation and transcriptional dysregulation in Huntington’s disease
doi: 10.1101/2020.10.29.359380
Figure Lengend Snippet: A , Kruskal-Wallis test of module expressions between zQ175 (HD) mice and zQ175:CK2α’ (+/-) mice. The y-axis is the negative log transformed p-values. B , Expressions of module “Greenyellow” in each mouse sample. C , IPA canonical pathway analysis of module genes for module “Greenyellow”. D , Enrichment analysis of GO terms in CC (cellular component) for module genes of module “Greenyellow”. E , Network visualization of top 15% connected genes in “Greenyellow” Module. The size of the circles was scaled by the absolute value of the mean log2-fold change between zQ175 and zQ175:CK2α’ (+/-) mice. F , Marker genes and their mean log2 fold change between zQ175 and zQ175:CK2α’ (+/-) mice compared to WT. G , IPA network analysis of DGEs in zQ175:CK2α’ mice showing α-syn as the most significant upstream regulator.
Article Snippet:
Techniques: Transformation Assay, Marker
Journal: bioRxiv
Article Title: CK2 alpha prime and alpha-synuclein pathogenic functional interaction mediates inflammation and transcriptional dysregulation in Huntington’s disease
doi: 10.1101/2020.10.29.359380
Figure Lengend Snippet: A, α-syn (4D6 antibody) IB in the striatum of WT, zQ175 and SNCA KO and B in WT, zQ175 and zQ175:CK2α’ (+/-) mice at 12 months old. GAPDH used as loading control. C, α-syn protein levels analyzed by Image J from IB analyses (n= 5-6 mice/genotype). D, Nuclear/cytoplasmic fractionation of striatum samples from 12-month-old WT, zQ175 and SNCA KO mice. E , Quantification of nuclear α-syn from images in D (n=4 mice/genotype). F , Representative IF images of dorsal striatum sections from 12 month old WT, zQ175 and zQ175:CK2α’ (+/-) (n=3 mice/genotype) for α-syn and HTT (EM48 antibody). White arrows indicate α-syn/HTT colocalization. Scale bar, 10 μm. G, Magnification of images from F showing nuclear and cytoplasmic α-syn and HTT colocalization. Grey circles represent nuclei. White arrows indicate α-syn/HTT colocalization. Scale bar, 2 μm. H Number of cytoplasmic and I nuclear EM48 + puncta calculated using Image J Puncta analysis plugin. A total of three images per brain section and three brain sections per genotype were analyzed (n=27 images, n=3 mice/ genotype). J , Number of colocalized α-syn and EM48 + puncta calculated using Image J Puncta analysis plugin (n=3 mice/genotype). Error bars denote mean ± SEM, values were analyzed by Student’s t-test.
Article Snippet:
Techniques: Fractionation
Journal: bioRxiv
Article Title: CK2 alpha prime and alpha-synuclein pathogenic functional interaction mediates inflammation and transcriptional dysregulation in Huntington’s disease
doi: 10.1101/2020.10.29.359380
Figure Lengend Snippet: A, pS129-α-syn (EP1536Y antibody) IB in the striatum of 12-month-old WT, zQ175 and SNCA KO (n=4 mice/genotype) . B pS129-α-syn (81A antibody) IB in the striatum of patients with HD (Vonsattel grade 3 and 4) compared to age and sex matched controls. GAPDH is used as loading control. C pS129-α-syn protein levels analyzed by Image J from images in B . Samples from grade 3 and grade 4 HD were all grouped for pS129-α-syn quantification. D , Representative pS129-α-syn IF images (81A antibody) in the dorsal striatum of 12-month-old WT, zQ175 and zQ175:CK2α’ (+/-) (n=3 mice/genotype), Scale bar, 20 μm. E, pS129-α-syn fluorescence signal was calculated using Image J from images in D (n=3 mice/genotype, n=27 images per mouse). F , Magnification of images in D showed pS129-α-syn and EM48 colocalization in zQ175 and zQ175:CK2α’ (+/-) (n=3 mice/group). G , Quantification of pS129-α-syn and EM48 colocalized puncta using Image J puncta plug in. All data are mean ± SEM. Statistical analyses were conducted by one-way ANOVA. H , Working model for the role of CK2α’ in the regulation of pS129-α-syn and HD-like phenotype.
Article Snippet:
Techniques: Fluorescence
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: Endogenous and exogenous MOTS-c regulates CK2 activity in the skeletal muscle (A–C) CK2 activity assessed by detecting endogenous proteins containing a pS/pTDXE motif and MOTS-c expression levels in gastrocnemius muscle from young control (2 months) and aged (22 months) mice ( n = 4 per group). (D–F) Effect of 4 weeks of voluntary wheel running exercise on CK2 activity and MOTS-c expression levels in gastrocnemius muscle from young mice ( n = 4 per group). (G and H) Effect of 8 weeks of MOTS-c administration (5 mg/kg/day) on CK2 activity in quadriceps muscle from high-fat-diet (HFD)-fed mice ( n = 4 per group). (I) Summary of MOTS-c and CK2 activity in the skeletal muscle. Data are represented as mean ± SEM for (B, C, E, F, and H). ∗∗ p < 0.01.
Article Snippet: First, 70 nM of
Techniques: Activity Assay, Expressing, Control
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: MOTS-c directly binds and activates CK2 in cell-free systems (A–C) Dot blot assays with (A) CK2 complex (contains both CK2α and CK2β subunits) immobilized, MOTS-c flowed over the membrane, and detected by MOTS-c antibody. (B–C) MOTS-c immobilized, CK2 complex flowed over the membrane, and detected by CK2α (B) and CK2β (C) antibodies. (D) CK2α or CK2β immobilized, MOTS-c flowed over the membrane, and detected by MOTS-c antibody. FO, flow over; IB, immunoblotting. (E): Surface plasmon resonance (Biacore assay) of MOTS-c (10 μg/mL) and CK2α (2.5 nM, 5.0 nM, 10 nM, and 20 nM). MOTS-c was immobilized on the sensor chip and CK2α flowed over the sensor chip. K D , dissociation constant. (F) Molecular docking simulation of the binding between MOTS-c and CK2α by using AlphaFold2. (G) CK2 activity assessed by kinase activity assay with/without MOTS-c in cell-free condition. A different dose of MOTS-c (0–100 μM) was used for the assay. Data are represented as mean ± SEM for (G). ∗ p < 0.05, ∗∗ p < 0.01 versus CK2 without MOTS-c group.
Article Snippet: First, 70 nM of
Techniques: Dot Blot, Membrane, Western Blot, SPR Assay, Binding Assay, Activity Assay, Kinase Assay
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: MOTS-c modulates CK2 activity in a tissue-specific manner (A) Experimental design of a single MOTS-c administration (7.5 mg/kg) experiment in young mice ( n = 5 per time point). (B) Plasma MOTS-c levels after MOTS-c administration. ∗: p < 0.05 versus time 0. (C) Quantification of CK2 activity assessed by western blotting in each tissue shown in (E–F). (E–F) CK2 activity assessed by western blotting with p-CK2 substrate antibody in gastrocnemius muscle (D), epididymal fat (E), and liver (F) after MOTS-c administration. ∗ p < 0.05, ∗∗ p < 0.01 versus time 0 in same tissue. (G–I) MOTS-c detection following CK2α immunoprecipitation (IP) in gastrocnemius muscle (G), epididymal fat (H), and liver (I) 30 min after MOTS-c administration (7.5 mg/kg). The "-" indicates tissues from non-MOTS-c administered mice, while the "+" indicates tissues from MOTS-c administered mice. (J–K) CK2 activity after 10 min MOTS-c treatment (10 μM) in differentiated skeletal muscle (J) and adipocyte (K). Data are represented as mean ± SEM for (B, C, J, and K).
Article Snippet: First, 70 nM of
Techniques: Activity Assay, Western Blot, Immunoprecipitation
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: MOTS-c modulates the CK2 interactome in a tissue-specific manner (A) Experimental design for the interactome analyses in young mice ( n = 3 per condition). Proteome analysis was performed following CK2α immunoprecipitation in gastrocnemius muscle and epididymal fat with/without MOTS-c administration. (B) Principal components (PCs) of control and MOTS-c-treated mouse gastrocnemius muscle and epididymal fat. (C) Venn diagram of interacting proteins in each condition. (D–E) Numbers of CK2 interacting proteins (D) and enriched Reactome pathways (E) in gastrocnemius muscle. (F–G) Numbers of CK2 interacting proteins (F) and enriched Reactome pathways (G) in epididymal fat. (H) Interacting proteins and significantly enriched Reactome pathways in MOTS-c-administered gastrocnemius muscle compared to the control group. The protein-protein interactions and enrichment analysis were assessed by using the STRING database. (I) Summary of the interactome analysis in gastrocnemius muscle and epididymal fat.
Article Snippet: First, 70 nM of
Techniques: Immunoprecipitation, Control
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: A naturally occurring K14Q MOTS-c is a bio-inactive form of MOTS-c due to its reduced binding to CK2 alpha (A) Nucleotide and amino acid substitutions of naturally occurring MOTS-c variant K14Q MOTS-c, which modulates skeletal muscle function and increases type 2 diabetes risk. (B) Comparison of reciprocal K D between WT and K14Q MOTS-c assessed by the surface plasmon resonance (Biacore) assay. (C) Comparison of CK2 activating effects between WT MOTS-c and K14Q MOTS-c in cell-free condition ( n = 3 per group). MOTS-c concentrations are 0, 0.8, 1.6, 3.1, 6.3, 12.5, and 25 μM ∗ p < 0.05, ∗∗ p < 0.01 versus control. # p < 0.05 versus same concentration of K14Q MOTS-c. (D–E) Comparison of gastrocnemius muscle CK2 activity between WT MOTS-c- and K14Q MOTS-c-administered young mice (2.5 mg/kg, n = 5 per group). ∗ p < 0.05 versus control group. (F) Protective effect of MOTS-c administration (WT or K14Q MOTS-c, 15 mg/kg/day, IP injection) against 8 days of immobilization-induced skeletal muscle atrophy ( n = 8 per group). Skeletal muscle mass was assessed by a total mass of gastrocnemius, plantaris, and soleus muscles. ∗ p < 0.05, ∗∗ p < 0.01. (G)Skeletal muscle 2-deoxy-d-glucose (2DG) uptake after MOTS-c administration (WT or K14Q, 7.5 mg/kg) with/without CK2 inhibitor (CX-4945, 25 mg/kg) ( n = 10–11 per group). ∗ p < 0.05. Data are represented as mean ± SEM for (C, E, F, and G).
Article Snippet: First, 70 nM of
Techniques: Binding Assay, Variant Assay, Comparison, SPR Assay, Control, Concentration Assay, Activity Assay, Injection, Muscles
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet:
Article Snippet: First, 70 nM of
Techniques: Recombinant, RNA Sequencing Assay, Software, Immunoprecipitation, Blocking Assay, Western Blot, Bicinchoninic Acid Protein Assay
Journal: Molecular Biology of the Cell
Article Title: Nuclear hormone receptor corepressor promotes esophageal cancer cell invasion by transcriptional repression of interferon-γ–inducible protein 10 in a casein kinase 2–dependent manner
doi: 10.1091/mbc.E11-11-0947
Figure Lengend Snippet: CK2α phosphorylates Ser-2436 of NCoR. (A) Reciprocal immunoprecipitation analysis was performed using HeLa cell lysates with a CK2α or NCoR antibody, and immunoblotting was performed using their respective antibodies (right). HeLa cells were transfected with Myc-CK2α, and cell lysates were immunoprecipitated and immunoblotted with their respective antibodies (left). (B) A schematic of the deletion mutants of NCoR for in vitro translation (left). Bound proteins were eluted and analyzed by autoradiography (right, top). HeLa cells were transfected with FLAG-tagged NCoR-15/16 (1985–2440) and HA-tagged CK2α plasmids. Whole-cell lysates were immunoprecipitated and immunoblotted with the indicated antibodies (right, bottom). (C and D) In vitro kinase assays were performed with CK2α and the indicated GST-fused NCoR-15/16 proteins. Bound proteins were eluted and analyzed by autoradiography (C) and scintillation counter (D). (E) In vitro kinase assays were performed with recombinant CK2α enzyme and the indicated GST-fused NCoR-15/16 proteins. Western blotting was performed with phospho-NCoR antibody. CBB , Coomassie blue staining. (F) Full-length GFP-NCoR plasmids were transfected into HeLa cells with or without Myc-CK2α and treated with TBB (50 μM) for 6 h. Cell lysates were analyzed by Western blotting with indicated antibodies. (G) HeLa cells were seeded on coverslips and transfected with the indicated expression plasmids in the presence or absence of TBB (50 μM). The permeabilized HeLa cells were incubated with indicated antibodies and/or 1 μg/ml of non-phosphopeptide (NPP) or phosphopeptide (PP) for 12 h, which was followed by PLA probes (PLUS and MINUS) treatment. The positive signal was analyzed using confocal microscopy. (H) In situ PLA analysis was performed under the same conditions as above without transfection of expression plasmids. The level of NCoR phosphorylation was assessed with αNCoR antibody and α-phospho-NCoR antibody.
Article Snippet: GST-fusion proteins were incubated with 500 U of
Techniques: Immunoprecipitation, Western Blot, Transfection, In Vitro, Autoradiography, Recombinant, Staining, Expressing, Incubation, Phospho-proteomics, Confocal Microscopy, In Situ
Journal: Molecular Biology of the Cell
Article Title: Nuclear hormone receptor corepressor promotes esophageal cancer cell invasion by transcriptional repression of interferon-γ–inducible protein 10 in a casein kinase 2–dependent manner
doi: 10.1091/mbc.E11-11-0947
Figure Lengend Snippet: CK2α-dependent NCoR phosphorylation increases NCoR stability via inhibition of the ubiquitin-dependent proteasomal pathway. (A) HeLa cells were transfected with full-length GFP-NCoR plasmids and treated with an increase amount of TBB (10, 50, 100 μM) and/or MG132 (10 μM) for 6 h. Cell lysates were analyzed by Western blotting. (B) HeLa cells were treated with an increase amount of TBB (10, 50 μM) and/or MG132, and cell lysates were analyzed by Western blotting with indicated antibodies. (C) HeLa cells were transfected with either FLAG-NCoR-15/16 WT or FLAG-NCoR-15/16 S2436A plasmid. After 2 d, cells were treated with cycloheximide (10 μg/ml), TBB (50 μM), and/or MG132 for various time periods, and cell lysates were analyzed by Western blotting. (D) HeLa cells were treated with TBB (50 μM) and/or MG132, and endogenous NCoR and phospho-NCoR levels were analyzed by confocal microscopy. (E and F) HeLa cells were treated with TBB (50 μM) or siRNAs against NCoR or CK2α, and then protein and mRNA levels were analyzed by Western blotting (E) and RT-PCR (F), respectively. (G) HeLa cells were treated with emodin (50 μM), TBB, LiCl 2 , and indicated siRNAs, and endogenous NCoR levels were then analyzed by confocal microscopy. (H) HeLa cells were treated with indicated inhibitors or siRNAs, and cell lysates were analyzed by Western blotting. (I) FLAG-NCoR-15/16 plasmids and HA-ubiquitin (Ub) were transfected into HeLa cells with TBB and/or MG132, and cell lysates were analyzed by Western blotting.
Article Snippet: GST-fusion proteins were incubated with 500 U of
Techniques: Phospho-proteomics, Inhibition, Ubiquitin Proteomics, Transfection, Western Blot, Plasmid Preparation, Confocal Microscopy, Reverse Transcription Polymerase Chain Reaction
Journal: Molecular Biology of the Cell
Article Title: Nuclear hormone receptor corepressor promotes esophageal cancer cell invasion by transcriptional repression of interferon-γ–inducible protein 10 in a casein kinase 2–dependent manner
doi: 10.1091/mbc.E11-11-0947
Figure Lengend Snippet: The levels of NCoR phosphorylation at Ser-2436 are well associated with patterns of CK2α activities. (A) In vitro kinase assays were performed by incubation of GST-NCoR-15/16 protein and immunoprecipitated CK2α enzyme from TE2, TE2-CK2α and HCE4 cells, and CK2α phosphorylation levels were analyzed by autoradiography and scintillation counter. (B) Whole-cell lysates from TE2 and HCE4 cells were analyzed by Western blotting. (C) HCE4 cells were treated with TBB (10, 50 μM) and/or MG132 for 6 h, and cell lysates were analyzed by Western blotting. (D) TE2, TE2-CK2α, and HCE4 cells were seeded on coverslips and treated with or without TBB (50 μM). Permeabilized cells were incubated with a phosphospecific NCoR antibody, an NCoR antibody, and PLA probes. Duolink in situ PLA analysis was performed as described in Materials and Methods .
Article Snippet: GST-fusion proteins were incubated with 500 U of
Techniques: Phospho-proteomics, In Vitro, Incubation, Immunoprecipitation, Autoradiography, Western Blot, In Situ
Journal: Molecular Biology of the Cell
Article Title: Nuclear hormone receptor corepressor promotes esophageal cancer cell invasion by transcriptional repression of interferon-γ–inducible protein 10 in a casein kinase 2–dependent manner
doi: 10.1091/mbc.E11-11-0947
Figure Lengend Snippet: NCoR promotes the invasion of esophageal cancer cells in a CK2α-dependent manner. (A) Invasion was analyzed by counting cells that migrated through the extracellular matrix layer of BioCoat Matrigel invasion chambers. Data are expressed as the means ± SD of at least three independent experiments. (B) Both TE2-CK2α and HCE4 cells were transfected with siRNAs against NCoR and/or TBB (50 μM) before application to the upper chamber. Data are expressed as the means ± SD of at least three independent experiments. (C) HCE4 cells were treated with individual siNCoRs, GFP-NCoR plasmids, and/or TBB, and invasion was analyzed by counting cells that migrated through the extracellular matrix layer of BioCoat Matrigel invasion chambers. *, p < 0.05 vs. siCon; **, p < 0.01 vs. siCon + TBB. (D) Either TE2 or HCE4 cell was treated with indicated siRNAs or TBB, and cell lysates were analyzed by Western blotting.
Article Snippet: GST-fusion proteins were incubated with 500 U of
Techniques: Transfection, Western Blot
Journal: Molecular Biology of the Cell
Article Title: Nuclear hormone receptor corepressor promotes esophageal cancer cell invasion by transcriptional repression of interferon-γ–inducible protein 10 in a casein kinase 2–dependent manner
doi: 10.1091/mbc.E11-11-0947
Figure Lengend Snippet: NCoR selectively represses transcription of the anti-tumorigenic gene IP-10/CXCL10 in a CK2α-dependent manner. (A) HCE4 cells were transfected with siRNA against NCoR and CK2α, and the change in mRNA expression was analyzed by cDNA microarray analysis using the Illumina HumanRef-8 version 3 Expression BeadChip. Data outputs and the average intensity for each array were normalized against housekeeping genes located on each array. Differentially expressed genes were identified by comparison of the siCK2 sample set with the small-interfering control sample set, and the siNCoR-2 sample set with the small-interfering control sample set using p < 0.05 as the significance cutoff. Only fold changes greater than 2.0 were considered. (B) HCE4 cells were treated with siRNAs, and the levels of indicated genes were analyzed by real-time PCR (left). The relative levels of indicated genes between TE2 and HCE4 cells were analyzed by real-time PCR (right). All samples were normalized to human GAPDH. (C) HCE4 cells were treated with TBB (50 μM, 6 H) or indicated siRNAs, and the level of each gene was analyzed by real-time PCR. (D) HCE4 cells were treated with an increasing amount of indicated inhibitors, and then mRNAs were analyzed by real-time PCR. (E) HCE4 cells were treated with siRNAs against each HDAC, and the level of each gene was analyzed by real-time PCR. (F) HCE4 cells were treated with TBB (50 μM, 6 H) or indicated siRNAs, and the level of each gene was analyzed by real-time PCR. (G) TE2 cells were transfected with CK2α plasmid. After 24 h, cells were treated with indicated siRNAs or TBB (50 μm, 6 H), and the levels of the indicated genes were analyzed by real-time PCR. *, p < 0.01 vs. CK2α alone; **, p < 0.05 vs. CK2α alone; #, p < 0.05 vs. CK2α +.siCon; # #, p < 0.05 vs. CK2α + siCon.
Article Snippet: GST-fusion proteins were incubated with 500 U of
Techniques: Transfection, Expressing, Microarray, Comparison, Control, Real-time Polymerase Chain Reaction, Plasmid Preparation
Journal: Molecular Biology of the Cell
Article Title: Nuclear hormone receptor corepressor promotes esophageal cancer cell invasion by transcriptional repression of interferon-γ–inducible protein 10 in a casein kinase 2–dependent manner
doi: 10.1091/mbc.E11-11-0947
Figure Lengend Snippet: NCoR complexes repress IP-10 transcription at the epigenetic status via deacetylation of histone tails in a CK2α-dependent manner. (A and B) HCE4 cells were treated with TBB (50 μM, 6 H) or indicated siRNAs, and ChIP assays were performed with the indicated antibodies. The precipitated samples were analyzed by real-time PCR, and results are given as the percentage of input as means ± SD of three independent experiments. *, p < 0.005 vs. SiCon; #, P < 0.01 vs. SiCon; **, p < 0.05 vs. SiCon. (C) ChIP and reChIP assays were performed with the indicated antibodies. Error bars, SD ( n = 3). *, p < 0.05 vs. IgG; **, p < 0.01 vs. IgG. (D) TE2 cells were transfected with indicated siRNAs and/or plasmids, and treated with TBB (50 μM, 6 H). The invading cells were counted in BioCoat Matrigel invasion chambers. (E) Model of our findings. In tumor cells with high CK2α activity, active CK2α phosphorylates NCoR and HDAC3 to repress IP-10 transcription, enhancing tumorigenesis. Additionally, CK2α phosphorylates Snail1 to repress E-cadherin transcription via an NCoR-independent pathway. Thus selective CK2α inhibition may be promising for anticancer therapy.
Article Snippet: GST-fusion proteins were incubated with 500 U of
Techniques: Real-time Polymerase Chain Reaction, Transfection, Activity Assay, Inhibition
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: Endogenous and exogenous MOTS-c regulates CK2 activity in the skeletal muscle (A–C) CK2 activity assessed by detecting endogenous proteins containing a pS/pTDXE motif and MOTS-c expression levels in gastrocnemius muscle from young control (2 months) and aged (22 months) mice ( n = 4 per group). (D–F) Effect of 4 weeks of voluntary wheel running exercise on CK2 activity and MOTS-c expression levels in gastrocnemius muscle from young mice ( n = 4 per group). (G and H) Effect of 8 weeks of MOTS-c administration (5 mg/kg/day) on CK2 activity in quadriceps muscle from high-fat-diet (HFD)-fed mice ( n = 4 per group). (I) Summary of MOTS-c and CK2 activity in the skeletal muscle. Data are represented as mean ± SEM for (B, C, E, F, and H). ∗∗ p < 0.01.
Article Snippet:
Techniques: Activity Assay, Expressing, Control
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: MOTS-c directly binds and activates CK2 in cell-free systems (A–C) Dot blot assays with (A) CK2 complex (contains both CK2α and CK2β subunits) immobilized, MOTS-c flowed over the membrane, and detected by MOTS-c antibody. (B–C) MOTS-c immobilized, CK2 complex flowed over the membrane, and detected by CK2α (B) and CK2β (C) antibodies. (D) CK2α or CK2β immobilized, MOTS-c flowed over the membrane, and detected by MOTS-c antibody. FO, flow over; IB, immunoblotting. (E): Surface plasmon resonance (Biacore assay) of MOTS-c (10 μg/mL) and CK2α (2.5 nM, 5.0 nM, 10 nM, and 20 nM). MOTS-c was immobilized on the sensor chip and CK2α flowed over the sensor chip. K D , dissociation constant. (F) Molecular docking simulation of the binding between MOTS-c and CK2α by using AlphaFold2. (G) CK2 activity assessed by kinase activity assay with/without MOTS-c in cell-free condition. A different dose of MOTS-c (0–100 μM) was used for the assay. Data are represented as mean ± SEM for (G). ∗ p < 0.05, ∗∗ p < 0.01 versus CK2 without MOTS-c group.
Article Snippet:
Techniques: Dot Blot, Membrane, Western Blot, SPR Assay, Binding Assay, Activity Assay, Kinase Assay
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: MOTS-c modulates CK2 activity in a tissue-specific manner (A) Experimental design of a single MOTS-c administration (7.5 mg/kg) experiment in young mice ( n = 5 per time point). (B) Plasma MOTS-c levels after MOTS-c administration. ∗: p < 0.05 versus time 0. (C) Quantification of CK2 activity assessed by western blotting in each tissue shown in (E–F). (E–F) CK2 activity assessed by western blotting with p-CK2 substrate antibody in gastrocnemius muscle (D), epididymal fat (E), and liver (F) after MOTS-c administration. ∗ p < 0.05, ∗∗ p < 0.01 versus time 0 in same tissue. (G–I) MOTS-c detection following CK2α immunoprecipitation (IP) in gastrocnemius muscle (G), epididymal fat (H), and liver (I) 30 min after MOTS-c administration (7.5 mg/kg). The "-" indicates tissues from non-MOTS-c administered mice, while the "+" indicates tissues from MOTS-c administered mice. (J–K) CK2 activity after 10 min MOTS-c treatment (10 μM) in differentiated skeletal muscle (J) and adipocyte (K). Data are represented as mean ± SEM for (B, C, J, and K).
Article Snippet:
Techniques: Activity Assay, Western Blot, Immunoprecipitation
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: MOTS-c modulates the CK2 interactome in a tissue-specific manner (A) Experimental design for the interactome analyses in young mice ( n = 3 per condition). Proteome analysis was performed following CK2α immunoprecipitation in gastrocnemius muscle and epididymal fat with/without MOTS-c administration. (B) Principal components (PCs) of control and MOTS-c-treated mouse gastrocnemius muscle and epididymal fat. (C) Venn diagram of interacting proteins in each condition. (D–E) Numbers of CK2 interacting proteins (D) and enriched Reactome pathways (E) in gastrocnemius muscle. (F–G) Numbers of CK2 interacting proteins (F) and enriched Reactome pathways (G) in epididymal fat. (H) Interacting proteins and significantly enriched Reactome pathways in MOTS-c-administered gastrocnemius muscle compared to the control group. The protein-protein interactions and enrichment analysis were assessed by using the STRING database. (I) Summary of the interactome analysis in gastrocnemius muscle and epididymal fat.
Article Snippet:
Techniques: Immunoprecipitation, Control
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet: A naturally occurring K14Q MOTS-c is a bio-inactive form of MOTS-c due to its reduced binding to CK2 alpha (A) Nucleotide and amino acid substitutions of naturally occurring MOTS-c variant K14Q MOTS-c, which modulates skeletal muscle function and increases type 2 diabetes risk. (B) Comparison of reciprocal K D between WT and K14Q MOTS-c assessed by the surface plasmon resonance (Biacore) assay. (C) Comparison of CK2 activating effects between WT MOTS-c and K14Q MOTS-c in cell-free condition ( n = 3 per group). MOTS-c concentrations are 0, 0.8, 1.6, 3.1, 6.3, 12.5, and 25 μM ∗ p < 0.05, ∗∗ p < 0.01 versus control. # p < 0.05 versus same concentration of K14Q MOTS-c. (D–E) Comparison of gastrocnemius muscle CK2 activity between WT MOTS-c- and K14Q MOTS-c-administered young mice (2.5 mg/kg, n = 5 per group). ∗ p < 0.05 versus control group. (F) Protective effect of MOTS-c administration (WT or K14Q MOTS-c, 15 mg/kg/day, IP injection) against 8 days of immobilization-induced skeletal muscle atrophy ( n = 8 per group). Skeletal muscle mass was assessed by a total mass of gastrocnemius, plantaris, and soleus muscles. ∗ p < 0.05, ∗∗ p < 0.01. (G)Skeletal muscle 2-deoxy-d-glucose (2DG) uptake after MOTS-c administration (WT or K14Q, 7.5 mg/kg) with/without CK2 inhibitor (CX-4945, 25 mg/kg) ( n = 10–11 per group). ∗ p < 0.05. Data are represented as mean ± SEM for (C, E, F, and G).
Article Snippet:
Techniques: Binding Assay, Variant Assay, Comparison, SPR Assay, Control, Concentration Assay, Activity Assay, Injection, Muscles
Journal: iScience
Article Title: MOTS-c modulates skeletal muscle function by directly binding and activating CK2
doi: 10.1016/j.isci.2024.111212
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, RNA Sequencing Assay, Software, Immunoprecipitation, Blocking Assay, Western Blot, Bicinchoninic Acid Protein Assay
Journal: Plant Physiology
Article Title: The Acidic A-Domain of Arabidopsis Toc159 Occurs as a Hyperphosphorylated Protein
doi: 10.1104/pp.110.158048
Figure Lengend Snippet: Phosphorylation of recombinant A-domains by CK2. A, One microgram of purified Toc159A-His-6x or casein as a control was incubated without (lanes 1 and 4) or with (lanes 2 and 5) recombinant maize CK2 α-subunit and ATP/[γ-33P]ATP as the phosphate donor. In addition, phosphorylation of Toc159A-His-6x with CK2 was performed in the presence of 15 μg mL−1 heparin as an inhibitor (lane 3). The samples were separated by SDS-PAGE followed by Coomassie Brilliant Blue staining (lanes 1′–5′) and phosphorimager analysis (lanes 1–5). B, One microgram of purified Toc33G-His-6x, Toc120A-His-6x, Toc132A-His-6x, Toc159A-His-6x, or GST-Toc159G was incubated without (even lanes) or with (odd lanes) recombinant CK2 and ATP/[γ-33P]ATP as the phosphate donor. The samples were separated by SDS-PAGE followed by Coomassie Brilliant Blue staining (lanes 1′–10′) and phosphorimager analysis (lanes 1–10).
Article Snippet: One microgram of recombinant protein or casein was incubated with or without 37.5 units of
Techniques: Phospho-proteomics, Recombinant, Purification, Control, Incubation, SDS Page, Staining
Journal: Plant Physiology
Article Title: The Acidic A-Domain of Arabidopsis Toc159 Occurs as a Hyperphosphorylated Protein
doi: 10.1104/pp.110.158048
Figure Lengend Snippet: Inhibition of in vitro chloroplast protein import by heparin. A, Isolated Arabidopsis chloroplasts were preincubated without or with 15 μg mL−1 heparin, 6 μm DRB, 3 units μL−1 recombinant maize CK2 α-subunit, 50 μm apigenin, or 10 mm glycerol-2-phosphate for 20 min at 25°C in the dark. Then, in vitro-translated, [35S]Met-labeled preprotein of the small subunit of Rubisco (pSSu) was added and import was allowed to proceed for 0, 7.5, and 15 min. B, Quantification of the effect of heparin on chloroplast protein import. The graph shows the quantification of the amount of imported SSu at 15 min in three independent experiments. In both panels, the amount of SSu imported into wild-type (WT) chloroplasts without the addition of inhibitor at 15 min was set to 100%. IVT, In vitro translate; M, molecular mass standard. Asterisks indicate pSSu modified in the course of the import reactions.
Article Snippet: One microgram of recombinant protein or casein was incubated with or without 37.5 units of
Techniques: Inhibition, In Vitro, Isolation, Recombinant, Labeling, Modification
Journal: Cellular and Molecular Life Sciences: CMLS
Article Title: Pharmacological attenuation of melanoma by tryptanthrin pertains to the suppression of MITF-M through MEK/ERK signaling axis
doi: 10.1007/s00018-022-04476-y
Figure Lengend Snippet: CK2α–MEK–ERK axis mediates the degradation of MITF-M upon Tpn treatment A Western blotting to check the protein level expression of BRAF V600E and BRAF WT in response to Tpn in various melanoma cells. B In silico binding studies of Tpn with wild-type BRAF (Green) and mutant BRAF V600E (Red). C Heat maps generated from microarray analysis to identify differentially regulated genes upon Tpn treatment at 24 h and 30 min. D Western blotting to check the protein level expression of MITF-M among various melanoma cell lines. E Western blotting was carried out to check the expression of the master regulator protein, MITF-M upon treatment with increasing concentrations of Tpn in different melanoma cell lines. F FLAG expression was checked to confirm the plasmid pCMV- Tag4A-MITF-M (WT) transfection using Western blotting. G Relative cell viabilities of A375-MITF-M and A375-Neo cells towards Tpn assessed by MTT assay. H Comparative evaluation of the levels of MITF-M in response to increasing concentrations of Tpn in A375-MITF-M and A375-Neo cells by Western blotting. I Comparative evaluation of the levels of β-catenin in response to increasing concentrations of Tpn in A375-MITF-M and A375-Neo cells by Western blotting. J Western blotting to evaluate the expression pattern of the major proteins of the MAPK pathway, P- MEK1/2, P- ERK1/2 on Tpn treatment at increasing concentrations, and the relative levels of MITF-M expression in SK-MEL-28 cells. The levels of total ERK and GAPDH serve as loading controls. K Western blot analysis reveals the activation status of MAPK proteins and MITF-M after treating with Tpn, in response to U0126 (10 µM). L Microscopic images of the cells under 20 X magnification, in the presence of increasing concentrations Tpn is shown in the left panel, and the cells pre-treated with U0126 prior to Tpn treatment are shown in the right panel. The relative cell viabilities are plotted. M In silico binding of Tpn with the crystal structure of MKP3. N In silico docking of Tpn with the crystal structure of Casein Kinase 2α. O In vitro kinase assay conducted using CK2α-substrate coated ELISA plates treated with enzyme-CK2α alone or CK2α pre-incubated with Tpn (3 µM) or the positive control, Heparin, a known inhibitor of CK2α. P Western blotting was carried out to check the expression of CK2α upon treatment with increasing concentrations of Tpn
Article Snippet: The
Techniques: Western Blot, Expressing, In Silico, Binding Assay, Mutagenesis, Generated, Microarray, Plasmid Preparation, Transfection, MTT Assay, Activation Assay, In Vitro, Kinase Assay, Enzyme-linked Immunosorbent Assay, Incubation, Positive Control
Journal: Cellular and Molecular Life Sciences: CMLS
Article Title: Pharmacological attenuation of melanoma by tryptanthrin pertains to the suppression of MITF-M through MEK/ERK signaling axis
doi: 10.1007/s00018-022-04476-y
Figure Lengend Snippet: Illustration of tryptanthrin-mediated melanoma suppression. Tryptanthrin blocks melanoma progression by suppressing BRAFV600E and CK2α independently. Tryptanthrin potentiates MITF-M degradation via MEK/ERK signaling axis
Article Snippet: The
Techniques:
Journal: Scientific Reports
Article Title: Protein kinase CK2-dependent aerobic glycolysis-induced lactate dehydrogenase A enhances the migration and invasion of cancer cells
doi: 10.1038/s41598-019-41852-4
Figure Lengend Snippet: Glucose is necessary for Cα OE cells survival, migration, and invasion. ( A ) The survival of HT29 or SW620 cells is shown; CK2α represents HT29 or SW620 cells transduced with lentivirus expressing CK2α under Glc- or Gln-deprived conditions. Cells (2 × 10 5 ) were incubated in Glc- or Gln-free DMEM, and the number of surviving cells were estimated at the indicated time-points. The number of cells was counted using an ADAM automatic Cell Counter. Values are expressed as the mean ± SD (n = 3; ** p < 0.01; *** p < 0.001 at 72 h). ( B ) The percentage of cell death was assessed by LSRII FACS analysis. Cells (5 × 10 5 ) were cultured under Glc- or Gln-depletion conditions in regular medium for 72 h. ( C ) The colony-forming ability was assessed by SRB staining. Cells (1 × 10 3 ) were cultured under Glc- or Gln-depletion conditions in regular medium for one week. ( D and E ) Reduced migration and invasion of Cα OE cells in the absence of Glc. Cells (2 × 10 5 /well) were seeded and cultured for 48 h. Migrated and invaded cells were visualized by SRB staining and eluted by 10 mM Tris-HCl buffer. Original magnification, 200×. Values are expressed as the mean ± SD (n = 3; * p < 0.05; ** p < 0.01). Original magnification, 200×. Scale bar, 500 µm.
Article Snippet: To obtain the lentiviral supernatant, the control vector and
Techniques: Migration, Transduction, Expressing, Incubation, Cell Culture, Staining
Journal: Scientific Reports
Article Title: Protein kinase CK2-dependent aerobic glycolysis-induced lactate dehydrogenase A enhances the migration and invasion of cancer cells
doi: 10.1038/s41598-019-41852-4
Figure Lengend Snippet: LDHA inhibition reduces cell migration and invasion in cancer cells with high CK2 activity. ( A ) Quantification of CK2 kinase activity in cancer cells. 32 P-GST-CS (GST-tagged CK2 Substrate) represents 32 P-labeled GST-CS and CBB represents Coomassie blue-stained input GST-CS, respectively. ( B ) The number of cells was counted using an ADAM automatic Cell Counter. Cells (1 × 10 5 ) were incubated in Glc- or Gln-free RPMI and the number of surviving cells was estimated at the indicated time-points. ( C ) Reduced migration and invasion by FX11. Cancer cells (2 × 10 5 ) were exposed to 10 μM FX11 for 72 h. Migration and invasion were assessed by the chemotactic transwell assay. Original magnification, 200×. Values are expressed as the mean ± SD (n = 3; * p < 0.0; ** p < 0.01; *** p < 0.001). Scale bar, 500 µm.
Article Snippet: To obtain the lentiviral supernatant, the control vector and
Techniques: Inhibition, Migration, Activity Assay, Labeling, Staining, Incubation, Transwell Assay