|
Thermo Fisher
gene exp chd3 mm01332658 m1 ![]() Gene Exp Chd3 Mm01332658 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chd3/pmc09107693-177-5--1?v=Thermo+Fisher Average 91 stars, based on 1 article reviews
gene exp chd3 mm01332658 m1 - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
|
Novus Biologicals
chd3 ![]() Chd3, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chd3/pmc04649039-77-5-6?v=Novus+Biologicals Average 90 stars, based on 1 article reviews
chd3 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Novus Biologicals
anti rabbit chd3 ![]() Anti Rabbit Chd3, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chd3/10__1128_slash_jvi__01154___17-177-54-56?v=Novus+Biologicals Average 90 stars, based on 1 article reviews
anti rabbit chd3 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Bethyl
antibodies chd2 agtcagtcggaaagtgagcag chd3 bethyl a301 219a a301 220a acatcagctatccgttccttct chd4 bethyl a301 082a ![]() Antibodies Chd2 Agtcagtcggaaagtgagcag Chd3 Bethyl A301 219a A301 220a Acatcagctatccgttccttct Chd4 Bethyl A301 082a, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chd3/pmc03903285__mbo006131706st1-16-4-8?v=Bethyl Average 93 stars, based on 1 article reviews
antibodies chd2 agtcagtcggaaagtgagcag chd3 bethyl a301 219a a301 220a acatcagctatccgttccttct chd4 bethyl a301 082a - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Cyagen Biosciences
chd3 knockout mouse ![]() Chd3 Knockout Mouse, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chd3/pm39710094-46-1-12?v=Cyagen+Biosciences Average 92 stars, based on 1 article reviews
chd3 knockout mouse - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
|
Novus Biologicals
anti chd3 ![]() Anti Chd3, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chd3/pmc09837035-427-90-92?v=Novus+Biologicals Average 91 stars, based on 1 article reviews
anti chd3 - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp chd3 cg04568295 gh 1 at FDR < 5% (ordered by p-value)." width="250" height="auto" />Gene Exp Chd3 Cg04568295 Gh, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chd3/pmc07590966-420-28--1?v=Thermo+Fisher Average 88 stars, based on 1 article reviews
gene exp chd3 cg04568295 gh - by Bioz Stars,
2026-07
88/100 stars
|
Buy from Supplier |
|
Cambridge Isotope Laboratories
chd3 cambridge isotope 1 at FDR < 5% (ordered by p-value)." width="250" height="auto" />Chd3 Cambridge Isotope, supplied by Cambridge Isotope Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chd3/pmc04939468__jz6b01022_si_001-26-7-8?v=Cambridge+Isotope+Laboratories Average 90 stars, based on 1 article reviews
chd3 cambridge isotope - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
sirna targeting chd3 ![]() Sirna Targeting Chd3, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chd3/pmc04323543-51-6-34?v=Shanghai+GenePharma Average 90 stars, based on 1 article reviews
sirna targeting chd3 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
biotinylated chd3 peptides ![]() Biotinylated Chd3 Peptides, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chd3/pmc03818072-223-10-13?v=GenScript+corporation Average 90 stars, based on 1 article reviews
biotinylated chd3 peptides - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Ribobio co
chd3 sirna ![]() Chd3 Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chd3/pm38880223-71-2-7?v=Ribobio+co Average 90 stars, based on 1 article reviews
chd3 sirna - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
ABclonal Biotechnology
anti-chd3 ![]() Anti Chd3, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chd3/pm35915078-186-83-86?v=ABclonal+Biotechnology Average 90 stars, based on 1 article reviews
anti-chd3 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Epigenetics & Chromatin
Article Title: Mouse Chd4-NURD is required for neonatal spermatogonia survival and normal gonad development
doi: 10.1186/s13072-022-00448-5
Figure Lengend Snippet: Chd4 and chd3 gene targeting design and testis developmental defects in c hd4 mutant mice. A , B Testis specific Cre knockout strategy for deletion of chd4 and chd3 . See description in “ ”. C H&E-stained paraffin testis sections of wild type, ddx4-chd4 −/− , and ddx4-chd3 −/− mice. D Quantification of testis weight for wild type and homozygous knockout mice is shown. Images and testis weigh measurements were obtained independently from three mice. E Chd3 transcription levels were measured in ddx4-chd3 −/− total testis and compared to wild-type littermates (2 months old mice, n = 3). Chd4 transcription level in enriched fractions of spermatogonia obtained from 7 dpp ddx4-chd4 −/− and control wild-type litter mate mice (mice, biological replicate n = 3). *** represents P < 0.0001 (two-tailed Student t test)
Article Snippet: TaqMan Mm01190896_m1 ( chd4 ),
Techniques: Mutagenesis, Knock-Out, Staining, Control, Two Tailed Test
Journal: Frontiers in Behavioral Neuroscience
Article Title: Impaired Contextual Fear Extinction Learning is Associated with Aberrant Regulation of CHD-Type Chromatin Remodeling Factors
doi: 10.3389/fnbeh.2015.00313
Figure Lengend Snippet: mRNA expression and protein complex formation of various ChRFs in the brain and in embryonic stem cells (ESCs). (A) Schematic of regions that were assessed for RNA levels of several ChRFs: Bs, brain stem; Ce, cerebellum; Mb, midbrain; Hth, hypothalamus; Hc, Th, S, hippocampus/thalamus/septum; Ctx, cortex; and Ob, olfactory bulb. (B) ChRFs fall into two large expression groups (I + II) in the brain. RT-qPCR results were expressed as ΔC T values (reference gene: Gapdh ) which were then centered at the median and subjected to hierarchical clustering. Red color indicates high expression (negative ΔC T value) and green color indicates low expression (positive ΔC T value). (C) Superose 6 size exclusion chromatography of ChRF peak fractions after anion exchange chromatography followed by immunoblot analysis of CHD3, CHD5, and ATRX as well as HDAC1, 2, and 3. The arrowhead indicates the void volume of the column, the asterisk marks a scanning artifact. Molecular masses of defined marker proteins are indicated at the bottom of their corresponding elution fractions.
Article Snippet: The following antibodies were used:
Techniques: Expressing, Quantitative RT-PCR, Size-exclusion Chromatography, Chromatography, Western Blot, Marker
Journal: Frontiers in Behavioral Neuroscience
Article Title: Impaired Contextual Fear Extinction Learning is Associated with Aberrant Regulation of CHD-Type Chromatin Remodeling Factors
doi: 10.3389/fnbeh.2015.00313
Figure Lengend Snippet: ChRF expression changes during fear extinction training in different brain areas of extinction-competent S6 and S1 ZnR mice and extinction-deficient S1 mice .
Article Snippet: The following antibodies were used:
Techniques: Expressing
Journal: Frontiers in Behavioral Neuroscience
Article Title: Impaired Contextual Fear Extinction Learning is Associated with Aberrant Regulation of CHD-Type Chromatin Remodeling Factors
doi: 10.3389/fnbeh.2015.00313
Figure Lengend Snippet: S1 mice display behavior-dependent aberrant ChRF protein expression in the vHC. (A) CHD1 showed aberrant up-regulation (S6: n = 5; S1 and S1 ZnR: n = 6), (B) CHD3 failed to become down-regulated (S6: n = 5; S1 and S1 ZnR: n = 6), and (C) CHD5 was down-regulated (S6: n = 5; S1: n = 4 and S1 ZnR: n = 3) following prologed CS exposure in the vHC of extinction-deficient S1 mice. Different brain areas were dissected from S6, S1 and S1 ZnR mice 2 h after contextual fear expression or extinction training, nuclear proteins were extracted and subjected to western blot analysis with antibodies against different ChRFs. Western blot signals were quantified, normalized to TBP and expressed relative to values of the respective fear expression group (left panels). Mean values ± SEM are shown. Statistical significance of protein level differences was determined by Two-way ANOVA with Bonferroni's post-hoc test ( * P < 0.05; *** P < 0.005). Right panels, representative western blots of significantly altered proteins are shown.
Article Snippet: The following antibodies were used:
Techniques: Expressing, Western Blot
Journal: Frontiers in Behavioral Neuroscience
Article Title: Impaired Contextual Fear Extinction Learning is Associated with Aberrant Regulation of CHD-Type Chromatin Remodeling Factors
doi: 10.3389/fnbeh.2015.00313
Figure Lengend Snippet: CHD3 is expressed in all neuronal cell types of the hippocampus . Mouse brain sections were immunostained with antibodies against CHD3 (red), Satb2 or GABA (green), and DNA was visualized by DAPI staining (blue). (A) CHD3-positive cells are found in all layers of the ventral hippocampus. CHD3 is highly expressed in the dentate gyrus (DG), granulae cells and in the pyramidal cell layer of CA1-4. CHD3 colocalizes with Satb2-expressing excitatory neurons in the CA1. (B) CHD3 is expressed in nuclei of Satb2-positive excitatory neurons. (C) Double staining for GABA and CHD3 in the vHC. (D) CHD3 is expressed by inhibitory GABAergic neurons.
Article Snippet: The following antibodies were used:
Techniques: Staining, Expressing, Double Staining
Journal: Journal of oral biosciences
Article Title: The potential role of chromodomain helicase DNA-binding protein 3 in defining the cervical width by regulating the early growth stage of the apical papilla during tooth development.
doi: 10.1016/j.job.2024.100604
Figure Lengend Snippet: Fig. 1. Tooth cervix constrictions were more enhanced in the Chd3 knockout mouse than in the wild-type littermates. (A) Schematic representation of the generation of the Chd3 knockout mouse (C57BL/6N-Chd3td2-11/td2-11). (B–D) Macroscopical images of the mandibular first molars in a Chd3 knockout mouse and wild-type littermate 35 days after birth. (A) Exon 2–11 was selected as the target site and deleted by Cas9 and gRNAs. (B) Lingual side view. (C) Mesial side view. (D) Distal side view. Scale bar = 500 μm.
Article Snippet: The
Techniques: Knock-Out
Journal: Journal of oral biosciences
Article Title: The potential role of chromodomain helicase DNA-binding protein 3 in defining the cervical width by regulating the early growth stage of the apical papilla during tooth development.
doi: 10.1016/j.job.2024.100604
Figure Lengend Snippet: Fig. 3. Micrographs showing the narrowing of width between the lingual and buccal sides of the cemento-enamel junction in the Chd3 knockout mice at PN8. Histological (Hematoxylin and eosin [HE] staining) and immunohistochemical (Chd3 staining) analyses of the homozygous Chd3 knockout and wild-type mouse during tooth development at E16.5 (A–D), E18.5 (E–H), PN1 (I–L), and PN8 (M − P). All figures are mesial side views of the mandibular first molar, including both Hyd and End. Chd3 was expressed in the enamel organ and dental papilla in wild-type mice during tooth development. However, no remarkable histological change was detected in the tooth germs from E16.5 to PN1 in the homozygous Chd3 knockout mice. (Q) Schematic diagram of the measurement sites (a) in the morpho- metrical analysis showing the width between the lingual and buccal sides of the cemento-enamel junction. (P) Graph showing a significant difference in the width of the tooth cervix between the Chd3 knockout and wild type mice at PN8. All values shown are mean ± SD (n = 3). **P < 0.01. Scale bar = 100 μm.
Article Snippet: The
Techniques: Knock-Out, Staining, Immunohistochemical staining
Journal: Journal of oral biosciences
Article Title: The potential role of chromodomain helicase DNA-binding protein 3 in defining the cervical width by regulating the early growth stage of the apical papilla during tooth development.
doi: 10.1016/j.job.2024.100604
Figure Lengend Snippet: Fig. 4. Micrographs and graphs showing Ki-67-positive cells in the homozygous Chd3 knockout mouse during tooth development. Ki-67-positive cells were localized on the lateral side areas near the cervical loop on the lingual and buccal sides at PN1 and the apical papilla at PN8. (A, B, D, E, G, H, J, K) Immunoperoxidase staining for Ki-67 in the mandibular first molar during tooth development at E16.5 (A, B), E18.5 (D, E), PN1 (G, H), and PN8 (J, K). (A, D, G, J) Wild-type mice. (B, E, H, K) Homozygous Chd3 knockout mouse. (C, F, I, L) Quantification of Ki-67-positive nuclei/total nuclei in the dental papilla at E16.5 (C), E18.5 (F), PN1 (I), and PN8 (L). All values shown are mean ± SD (n = 3). **P < 0.01; n.s., not significant. Scale bar = 100 μm.
Article Snippet: The
Techniques: Knock-Out, Immunoperoxidase Staining
Journal: Journal of oral biosciences
Article Title: The potential role of chromodomain helicase DNA-binding protein 3 in defining the cervical width by regulating the early growth stage of the apical papilla during tooth development.
doi: 10.1016/j.job.2024.100604
Figure Lengend Snippet: Fig. 5. Graphs showing the relative Chd3 mRNA expression and absorbance values in mDP (A, B) and HERS (C, D) cells. Knockdown efficiency of Chd3 shRNA and nonsense scramble shRNA (Ctrl) transduction by adenovirus vector in the mDP (A) and HERS (C) cell lines. qRT-PCR was performed 48 h after adenovirus trans- fection. (B, D) Cell proliferation assay of the mDP (B) and HERS (D) cell lines transfected with Chd3 shRNA or control vector. The absorbance of each cell line at 450 nm was measured four days after seeding the cells transfected with the adenovirus vector. All values shown are mean ± SD (n = 3). **P < 0.01; n.s., not significant.
Article Snippet: The
Techniques: Expressing, Knockdown, shRNA, Transduction, Plasmid Preparation, Quantitative RT-PCR, Proliferation Assay, Transfection, Control
Journal: Journal of oral biosciences
Article Title: The potential role of chromodomain helicase DNA-binding protein 3 in defining the cervical width by regulating the early growth stage of the apical papilla during tooth development.
doi: 10.1016/j.job.2024.100604
Figure Lengend Snippet: Fig. 6. Graphs showing the expression levels of Bmp2, Bmp4, Shh, and Wnt3a in dental mesenchymal and HERS cells (A–H). qRT-PCR analysis of the expression of Bmp2 (A, E), Bmp4 (B, F), Shh (C, G), Wnt3a (D, H), Alpl (I), Dmp1 (J), and Ipo7 (K). (A–D, I–K) Effects of Chd3 shRNA or control adenovirus transfection in mDP cells after 48 h. (E–H) Effects of Chd3 shRNA or control adenovirus transfection in HERS cells after 48 h. Chd3 maintained the expression of Shh and suppressed the expression of Bmp4 in dental mesenchymal cells. Additionally, it maintained the expression of Shh and Wnt3a and suppressed that of Bmp2 in the HERS cells. All values shown are mean ± SD (n = 3). *P < 0.05; **P < 0.01; n.s., not significant.
Article Snippet: The
Techniques: Expressing, Quantitative RT-PCR, shRNA, Control, Transfection
1 at FDR < 5% (ordered by p-value)." width="100%" height="100%">
Journal: Nature metabolism
Article Title: DNA methylation mediates HbA1c-associated complications development in Type 1 diabetes
doi: 10.1038/s42255-020-0231-8
Figure Lengend Snippet: CpGs where DNAme was associated with mean-DCCT HbA1c
Article Snippet: GWAS was performed on each of the 8 CpGs associated with mean-DCCT HbA1c at Bonferroni-adjusted p < 0.05 (p < 5e-08) (namely cg19693031, cg06721411, cg04816311, cg26262157, cg20983494, cg19285358,
Techniques:
Journal: Cellular and Molecular Life Sciences
Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
doi: 10.1007/s00018-014-1726-9
Figure Lengend Snippet: IAV NS2 protein interacts with CHD3. a NS2 binds CHD3 in M2H assay. COS-1 cells were cotransfected with the plasmids pACT–cCHD3, pBIND–NS2, and pG5luc, and then cell lysates were subjected to luciferase activity assays via M2H 24 h later. pBIND-Id and pACT-MyoD were used as positive controls, and pACT and pBIND as negative controls. The results are presented as the mean ± SD (** p < 0.01, n = 3). b NS2 interacts with CHD3 in Co-IP assay. Myc-NS2 and Flag-NLS-cCHD3 were cotransfected into COS-1 cells. 36 h after transfection, the cells were lysed, and immunoprecipitation was performed using an anti-Flag monoclonal antibody. The immunoprecipitated proteins were assayed with an anti-Myc polyclonal antibody. c NS2 interacts with CHD3 in GST pull-down assay. GST-tagged NS2 was expressed in bacteria. The cell lysates containing Flag-NLS-cCHD3 were mixed with beads to which GST-NS2 or GST alone was bound. The samples were analyzed using an anti-Flag monoclonal antibody. d NLS–cCHD3 interacted with NS2 in the nucleus by IFA assay. COS-1 cells on coverslips were transfected with plasmids coding the NLS–cCHD3 and NS2, and analyzed by IFA using antibodies against Myc (rabbit) and Flag (mouse). Colocalization was analyzed using Image J and the coefficients confirmed the strong colocalization
Article Snippet: Duplex small interfering RNAs (siRNAs) targeting
Techniques: Luciferase, Activity Assay, Co-Immunoprecipitation Assay, Transfection, Immunoprecipitation, Pull Down Assay, Bacteria
Journal: Cellular and Molecular Life Sciences
Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
doi: 10.1007/s00018-014-1726-9
Figure Lengend Snippet: NS2 interacts with endogenous CHD3 under infection. a NS2 colocalizes with endogenous CHD3 under WD infection. COS-1 cells on coverslips were infected with WD [0.5 multiplicity of infection (MOI)], and at 5 h p.i., the cells were fixed for IFA with antibodies against NS2 and CHD3. b NS2 bound endogenous CHD3 during virus infection. COS-1 cells were infected by the WD or WD-Flag-NS2 viruses at an MOI of 3. At 8 h p.i., cell lysates were subjected to the IP assay with anti-Flag monoclonal antibody. The immunoprecipitated proteins were assayed with indicated antibody. Colocalization was analyzed using Image J and the coefficients confirmed the strong colocalization
Article Snippet: Duplex small interfering RNAs (siRNAs) targeting
Techniques: Infection, Virus, Immunoprecipitation
Journal: Cellular and Molecular Life Sciences
Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
doi: 10.1007/s00018-014-1726-9
Figure Lengend Snippet: The key amino acids (M16, M19 and L21) of NS2 were involved in NS2–CHD3 interaction. a The NS2 N-terminus containing aa 16–20 mediated interactions with CHD3. Top COS-1 cells were cotransfected with pACT-cCHD3, pG5luc and pBIND-NS2 or pBIND-NS2-truncations. The strength of the interaction between cCHD3 and the NS2 truncations was assayed via M2H assay 24 h later. The interaction between CHD3 and the NS2 truncations was normalized to the self-activation of the NS2 truncations (co-transfection of the pBIND-NS2 truncations and pACT plasmid). The results are shown as the mean ± SD for three independent experiments (* p < 0.05, ** p < 0.01, n = 3). Bottom the expression level of the NS2 truncations was detected with an anti-NS2 polyclonal antibody. GAPDH served as a protein loading control. b The NES of NS2 mediates interactions with CHD3. COS-1 cells were cotransfected with pACT-cCHD3, pG5luc and pBIND-NS2 or pBIND-NS2 mutants, and the strength of the interaction was assayed via M2H assay as above. The results are shown as the mean ± SD (* p < 0.05, ** p < 0.01, n = 3). c NS2 (L19S) bound cCHD3 but weaker than NS2 did in Co-IP assay
Article Snippet: Duplex small interfering RNAs (siRNAs) targeting
Techniques: Activation Assay, Cotransfection, Plasmid Preparation, Expressing, Control, Co-Immunoprecipitation Assay
Journal: Cellular and Molecular Life Sciences
Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
doi: 10.1007/s00018-014-1726-9
Figure Lengend Snippet: The NS2–CHD3 interaction played a significant impact on the distribution of Crm1 and NS2. a COS-1 cells were fractionated and cell fractionation was confirmed with antibodies against the following subcellular marker proteins: tubulin (cytoplasmic, cyt), HMGB1 (mainly nucleoplasmic, nuc), TFIIB (low-salt chromatin fraction, ch150) and histone H3 (whole chromatin fraction). b The distribution of endogenous CHD3 during WD infection. Cells were infected with WD virus (MOI 0.1). At 0 h and 18 h p.i., the cells were harvested and analyzed via western blotting. c The effect of WD infection (MOI 3) on the location of NP and NS2 at early stage of the infection (4 h p.i.). d a Knockdown of CHD3 using siRNA resulted in the diffusion of NS2 into all subcellular fractions and less Crm1 in the >ch500 fraction. COS-1 cells were transfected with si-CHD3 or si-NC; then, 24 h later the cells were infected with WD virus (MOI 3) for 4 h. The relative quantities of the NS2 ( b ) and Crm1 ( c ) in each fraction were analyzed using the software Image J (NIH) (* p < 0.05, ** p < 0.01, n = 3). e NLS–cCHD3 changed the Crm1 and NS2 distribution under WD infection. COS-1cells were transfected with NLS–cCHD3 or empty vector as a control; 24 h later, the cells were infected with WD virus (MOI 0.3) for 10 h. f IFA assaying the effect of NLS–cCHD3 overexpression on location of NS2 and Crm1 at early stage of infection. COS-1 cells transfected with plasmid expressing NLS-Myc-cCHD3 ( top ) or untransfected ( bottom ) were infected with WD-Flag-NS2 virus. The location of NLS-Myc-cCHD3 and NS2 was marked by IFA. Colocalization was analyzed using Image J and the coefficients confirmed the strong colocalization. GAPDH was used to control the protein loading
Article Snippet: Duplex small interfering RNAs (siRNAs) targeting
Techniques: Cell Fractionation, Marker, Infection, Virus, Western Blot, Knockdown, Diffusion-based Assay, Transfection, Software, Plasmid Preparation, Control, Over Expression, Expressing
Journal: Cellular and Molecular Life Sciences
Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
doi: 10.1007/s00018-014-1726-9
Figure Lengend Snippet: The NS2–CHD3 interaction modulated vRNP export. a L19S mutation interfered with the Crm1-dependent export activity of NS2. COS-1 cells on coverslips were transfected with plasmids coding the RFP, RFP–NS2 or RFP–NS2(L19S); 24 h later, the location of each expressing protein was collected using the confocal microscopy. b a The WD–NS2 (L19S) providing weakened NS2–CHD3 interaction exhibited less NS2 and Crm1 in >ch500. COS-1 cells were infected with WD–NS2 (L19S) or WD virus at MOI 3 for 4 h and cell fractionations was made immediately. The relative quantities of the NS2 ( b ) and Crm1 ( c ) in each fraction were analyzed using the software Image J (NIH) (* p < 0.05, ** p < 0.01, n = 3). c The WD–NS2(L19S) delayed vRNPs export. COS-1 cells on coverslips were infected with WD–NS2(L19S) or WD virus at MOI 0.5. At 4, 6 and 8 h p.i., cells were fixed and permeabilized. vRNP localization was assessed via IFA using an anti-NP monoclonal antibody
Article Snippet: Duplex small interfering RNAs (siRNAs) targeting
Techniques: Mutagenesis, Activity Assay, Transfection, Expressing, Confocal Microscopy, Infection, Virus, Software
Journal: Cellular and Molecular Life Sciences
Article Title: CHD3 facilitates vRNP nuclear export by interacting with NES1 of influenza A virus NS2
doi: 10.1007/s00018-014-1726-9
Figure Lengend Snippet: The NS2–CHD3 interaction modulated the propagation of the influenza A virus. a The WD–NS2(L19S) virus containing weaker NS2–CHD3 interaction exhibited poor propagation. COS-1 cells were infected and the supernatants were collected at the indicated time points for detecting the viral titer. b The knockdown of CHD3 ( a ) significantly decreased WD viral titers ( b ). c The knockdown of CHD3 ( a ) decreased WD–NS2(L19S) viral titers to a small extent ( b ). COS-1 cells were transfected with si-CHD3 or si-NC and infected with the WD or WD–NS2(L19S) virus (MOI 0.1) at the 24 h post-transfection. At 12, 24 and 36 h p.i., the cell supernatants were collected to measure the viral titer. The results are presented as the mean ± SD (* p < 0.05, ** p < 0.01, n = 3)
Article Snippet: Duplex small interfering RNAs (siRNAs) targeting
Techniques: Virus, Infection, Knockdown, Transfection