Journal: Frontiers in Cardiovascular Medicine

Article Title: Plasma Proteome Profiling of Patients With In-stent Restenosis by Tandem Mass Tag-Based Quantitative Proteomics Approach

doi: 10.3389/fcvm.2022.793405

Figure Lengend Snippet: ELISA validation of differentially abundant plasma proteins in ISR. Plasma level of (A) Fetuin B, (B) APOC3, (C) CETP. Data came from 23 HCs, 20 ISR patients and 27 non-ISR patients. Data were expressed as mean ± SD. LSD- t test was used to compare differences between groups. Statistical significance was defined as ** p < 0.01 and *** p < 0.001.

Article Snippet: ELISA kits for plasma fetuin-B and apolipoprotein C-III (APOC3) were purchased from Abcam (Cambridge, UK), while a kit for cholesteryl ester transfer protein (CETP) was purchased from Cusabio Biotech (Wuhan, China).

Techniques: Enzyme-linked Immunosorbent Assay, Biomarker Discovery, Clinical Proteomics

Journal: Journal of Translational Medicine

Article Title: Characterization of the proteome of stable and unstable carotid atherosclerotic plaques using data-independent acquisition mass spectrometry

doi: 10.1186/s12967-023-04723-1

Figure Lengend Snippet: Validation of ferroptosis- and lipid metabolism-associated DEPs using IHC in a validation cohort. A Representative images (see Additional file : Figure S4a,b for 500 µm images) of immunohistochemical staining of TFR1, TF, AIFM2, DPP4, and GCLC proteins in stable and unstable plaques in the plaque fibrous cap region (black arrows) and immunohistochemical staining for SLC1A5, BID, and APOA5 proteins in the plaque lipid core region (black arrows). B In unstable plaques, the levels of TFR1, TF, AIFM2, DPP4, GCLC, SLC1A5, BID, and APOA5 were significantly increased, while other differences were not statistically significant. IHC immunohistochemistry. TFR1 transferrin receptor protein 1; TF transferrin; AIFM2 apoptosis-inducing factor 2; DPP4 dipeptidyl peptidase 4; GCLC glutamate-cysteine ligase catalytic. SLC1A5 solute carrier family 1, member 5; BID BH3 interacting-domain death agonist; APOA5, apolipoprotein A-V; CETP cholesteryl ester transfer protein. *P < 0.05; **P < 0.01 Student’s t test (two-tailed distribution)

Article Snippet: Primary antibodies for IHC against solute carrier family 1, member 5 (SLC1A5) (rabbit polyclonal, 20350-1-AP), apoptosis-inducing factor 2 (AIFM2) (rabbit polyclonal, 20886–1-AP), BH3 interacting-domain death agonist (BID) (rabbit polyclonal, 10988-1-AP), dipeptidyl peptidase 4 (DPP4) (rabbit polyclonal, 29403-1-AP), transferrin receptor protein 1 (TFR1) (mouse monoclonal, 66180–1-Ig), transferrin (TF) (rabbit polyclonal, 17435-1-AP), glutamate–cysteine ligase catalytic (GCLC) (rabbit polyclonal, 12601–1-AP), cholesteryl ester transfer protein (CETP) (rabbit polyclonal, 13459-1-AP), and apolipoprotein A-V (APOA5) (rabbit polyclonal, 18019-1-AP) were purchased from Proteintech (China).

Techniques: Biomarker Discovery, Immunohistochemical staining, Staining, Immunohistochemistry, Two Tailed Test

Journal: Journal of Translational Medicine

Article Title: Characterization of the proteome of stable and unstable carotid atherosclerotic plaques using data-independent acquisition mass spectrometry

doi: 10.1186/s12967-023-04723-1

Figure Lengend Snippet: The differently expressed proteins (DEPs) that were validated using immunohistochemistry (all up regulated) (unstable/stable)

Article Snippet: Primary antibodies for IHC against solute carrier family 1, member 5 (SLC1A5) (rabbit polyclonal, 20350-1-AP), apoptosis-inducing factor 2 (AIFM2) (rabbit polyclonal, 20886–1-AP), BH3 interacting-domain death agonist (BID) (rabbit polyclonal, 10988-1-AP), dipeptidyl peptidase 4 (DPP4) (rabbit polyclonal, 29403-1-AP), transferrin receptor protein 1 (TFR1) (mouse monoclonal, 66180–1-Ig), transferrin (TF) (rabbit polyclonal, 17435-1-AP), glutamate–cysteine ligase catalytic (GCLC) (rabbit polyclonal, 12601–1-AP), cholesteryl ester transfer protein (CETP) (rabbit polyclonal, 13459-1-AP), and apolipoprotein A-V (APOA5) (rabbit polyclonal, 18019-1-AP) were purchased from Proteintech (China).

Techniques: Immunohistochemistry, Biomarker Discovery, Significance Assay

Journal: Journal of Translational Medicine

Article Title: Characterization of the proteome of stable and unstable carotid atherosclerotic plaques using data-independent acquisition mass spectrometry

doi: 10.1186/s12967-023-04723-1

Figure Lengend Snippet: Hypothetical characterization of altered molecular mechanisms in cells in the fibrous cap and lipid core regions of unstable carotid plaques. The expression of key proteins of ferroptosis and lipid metabolism is significantly increased in patients with unstable plaques, and there are mechanisms associated with both the promotion and inhibition of iron death. This possibly indicates that cells in different regions of the plaque are regulated by key proteins of ferroptosis that subsequently lead to increased plaque instability and expansion of the necrotic core. TFR1 transferrin receptor protein 1; TF transferrin; AIFM2 apoptosis-inducing factor 2; DPP4 dipeptidyl peptidase 4; GCLC glutamate-cysteine ligase catalytic; SLC1A5 solute carrier family 1, member 5; BID BH3 interacting-domain death agonist; APOA5 apolipoprotein A-V; CETP cholesteryl ester transfer protein; GPX4 glutathione peroxidase 4; GSH glutathione; CoQ10 coenzyme Q10; ROS reactive oxygen species; HDL high-density lipoprotein; ox-LDL oxidized low-density lipoprotein

Article Snippet: Primary antibodies for IHC against solute carrier family 1, member 5 (SLC1A5) (rabbit polyclonal, 20350-1-AP), apoptosis-inducing factor 2 (AIFM2) (rabbit polyclonal, 20886–1-AP), BH3 interacting-domain death agonist (BID) (rabbit polyclonal, 10988-1-AP), dipeptidyl peptidase 4 (DPP4) (rabbit polyclonal, 29403-1-AP), transferrin receptor protein 1 (TFR1) (mouse monoclonal, 66180–1-Ig), transferrin (TF) (rabbit polyclonal, 17435-1-AP), glutamate–cysteine ligase catalytic (GCLC) (rabbit polyclonal, 12601–1-AP), cholesteryl ester transfer protein (CETP) (rabbit polyclonal, 13459-1-AP), and apolipoprotein A-V (APOA5) (rabbit polyclonal, 18019-1-AP) were purchased from Proteintech (China).

Techniques: Expressing, Inhibition

Journal: Nutrients

Article Title: Interaction of CETP rs708272 Polymorphism on Trans Fatty Acid Intake and Glucose Metabolism Markers

doi: 10.3390/nu16213683

Figure Lengend Snippet: Sociodemographic Characteristics and CETP rs708272 Genotypes.

Article Snippet: DNA samples were genotyped using TaqMan SNP genotyping assays (CETP rs708272, assay ID 4351379 C___9615318_10, Context Sequence [VIC/FAM] CTGAGACCCAGAATCACTGGGGTTC[A/G]AGTTAGGGTTCAGATCTGAGCCAGG, Thermo Fisher Scientific: https://www.thermofisher.com accessed on 12 September 2021) in a 96-well format, and analyzed with a Roche LightCycler 96 system (Roche, Mannheim, Germany).

Techniques:

Journal: Nutrients

Article Title: Interaction of CETP rs708272 Polymorphism on Trans Fatty Acid Intake and Glucose Metabolism Markers

doi: 10.3390/nu16213683

Figure Lengend Snippet: Impact of CETP rs708272 genotypes on the interactions of baseline trans-fatty acid intake on glucose, insulin, and HOMA index. ( A ) Interaction between CETP rs708272 genotypes and baseline trans-fatty acid intake concerning the change (∆) in insulin. ( B ) Interaction between CETP rs708272 genotypes and baseline trans-fatty acid intake concerning the ∆ in glucose. ( C ) Interaction between CETP rs708272 genotypes and baseline trans-fatty acid intake concerning the ∆ HOMA-IR. The interactions were adjusted for age, sex, BMI, and total energy intake.

Article Snippet: DNA samples were genotyped using TaqMan SNP genotyping assays (CETP rs708272, assay ID 4351379 C___9615318_10, Context Sequence [VIC/FAM] CTGAGACCCAGAATCACTGGGGTTC[A/G]AGTTAGGGTTCAGATCTGAGCCAGG, Thermo Fisher Scientific: https://www.thermofisher.com accessed on 12 September 2021) in a 96-well format, and analyzed with a Roche LightCycler 96 system (Roche, Mannheim, Germany).

Techniques:

Journal: Scientific Reports

Article Title: Trimethylamine N-oxide and the reverse cholesterol transport in cardiovascular disease: a cross-sectional study

doi: 10.1038/s41598-020-75633-1

Figure Lengend Snippet: Differences in genotypic and allelic distributions between controls and CAD patients.

Article Snippet: Genomic DNA was extracted from blood using the kit for genomic DNA purification (A&A Biotechnology, Gdynia, Poland) and it was quantified by NanoDrop 2000 (Thermo Scientific, MA, USA) CETP rs12720922 and rs247616 were assessed in real-time PCR by TaqMan assays (Thermo Fisher Scientific, MA, USA), according to the manufacturer instructions.

Techniques: Control

Journal: Scientific Reports

Article Title: Trimethylamine N-oxide and the reverse cholesterol transport in cardiovascular disease: a cross-sectional study

doi: 10.1038/s41598-020-75633-1

Figure Lengend Snippet: Effect of rs12720922 genotype on plasma TMAO concentrations ( A ) and TMAO/TMA ratio ( B ) in controls and CAD patients. Scatter dot plot with lines as median values. *p < 0.05, **p < 0.01.

Article Snippet: Genomic DNA was extracted from blood using the kit for genomic DNA purification (A&A Biotechnology, Gdynia, Poland) and it was quantified by NanoDrop 2000 (Thermo Scientific, MA, USA) CETP rs12720922 and rs247616 were assessed in real-time PCR by TaqMan assays (Thermo Fisher Scientific, MA, USA), according to the manufacturer instructions.

Techniques: Clinical Proteomics

Journal: Scientific Reports

Article Title: Trimethylamine N-oxide and the reverse cholesterol transport in cardiovascular disease: a cross-sectional study

doi: 10.1038/s41598-020-75633-1

Figure Lengend Snippet: Haplotype frequencies estimation (n = 547) in the total population, in controls and CAD groups.

Article Snippet: Genomic DNA was extracted from blood using the kit for genomic DNA purification (A&A Biotechnology, Gdynia, Poland) and it was quantified by NanoDrop 2000 (Thermo Scientific, MA, USA) CETP rs12720922 and rs247616 were assessed in real-time PCR by TaqMan assays (Thermo Fisher Scientific, MA, USA), according to the manufacturer instructions.

Techniques:

Journal: Scientific Reports

Article Title: Trimethylamine N-oxide and the reverse cholesterol transport in cardiovascular disease: a cross-sectional study

doi: 10.1038/s41598-020-75633-1

Figure Lengend Snippet: Haplotype association with TMAO and TMA in the total population.

Article Snippet: Genomic DNA was extracted from blood using the kit for genomic DNA purification (A&A Biotechnology, Gdynia, Poland) and it was quantified by NanoDrop 2000 (Thermo Scientific, MA, USA) CETP rs12720922 and rs247616 were assessed in real-time PCR by TaqMan assays (Thermo Fisher Scientific, MA, USA), according to the manufacturer instructions.

Techniques:

Journal: Journal of Lipid Research

Article Title: The lipid substrate preference of CETP controls the biochemical properties of HDL in fat/cholesterol-fed hamsters

doi: 10.1016/j.jlr.2021.100027

Figure Lengend Snippet: Plasma CETP mass and activity

Article Snippet: In vivo quality, recombinant E1/E3-deleted adenovirus (serotype 5) constructs containing the CMV promoter alone (Ad-null), hamster CETP (Ad-haCETP), human CETP (Ad-huCETP) were custom synthesized by Vector Biolabs (Malvern, PA).

Techniques: Clinical Proteomics

Journal: Journal of Lipid Research

Article Title: The lipid substrate preference of CETP controls the biochemical properties of HDL in fat/cholesterol-fed hamsters

doi: 10.1016/j.jlr.2021.100027

Figure Lengend Snippet: Plasma cholesterol and lipoprotein levels in fat/cholesterol-fed hamsters with altered CETP expression. A: Plasma cholesterol concentrations. B–E: Typical FPLC cholesterol profile for null (B), haCETP (C), haCETP (D), and Hi huCETP (E) animals. Dashed lines in each profile show the peak retention time for null LDL and HDL. F: Lipoprotein cholesterol concentrations in the plasma of the indicated adenovirus group. G: LDL/HDL ratios. Values are mean ± SEM of null , haCETP , huCETP , and Hi huCETP animals. ∗P < 0.05 versus null, ∗∗P < 0.01 versus null, # P < 0.05 versus haCETP, ## P < 0.01 versus haCETP, % P < 0.05 versus huCETP, %% P < 0.01 versus huCETP.

Article Snippet: In vivo quality, recombinant E1/E3-deleted adenovirus (serotype 5) constructs containing the CMV promoter alone (Ad-null), hamster CETP (Ad-haCETP), human CETP (Ad-huCETP) were custom synthesized by Vector Biolabs (Malvern, PA).

Techniques: Clinical Proteomics, Expressing