cebpd Search Results


93
MedChemExpress cebpd protein expression levels
Cebpd Protein Expression Levels, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cebpd/CEBP+delta%2FCEBPD%2C+Human/pmc12260632__cmh-2024-0948-Supplementary-Figure-12-1-100-155
Average 93 stars, based on 1 article reviews
cebpd protein expression levels - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
OriGene overrepresentation analysis table s3d
Figure 5. HOTAIR-PRC2 regulates developmental pathways in differentiating gluteal preadipocytes (A) Venn diagram showing overlap between PRC2 target genes (from FUMA and CHEA) and shHOTAIR WGCNA DEGs (upregulated at all time points, light-green module). See also Figure S6. (B) qPCR confirmation of PCDH10 expression in shHOTAIR and shControl cells during adipogenesis (n = 3). Data were assessed using 2-way ANOVA; *p < 0.05. (C and D) ChIP to assess (C) SUZ12 and (D) H3K27me3 enrichment at the PCDH10 promoter in gluteal shHOTAIR and shControl cells on differentiation day 0 (n = 3). Mouse IgG antibody was used as a negative control. Data were assessed by Student’s t test; *p < 0.05. (E) Expression heatmap of shHOTAIR DEGs annotated to UniProtKB: Wnt signaling (shHOTAIR versus shControl; rlog normalized fold changes DESeq2). (F) HOTAIR1 gene expression in imGSAT cells expressing the 7TFP TOPflash luciferase vector following 72 h HOTAIR <t>siRNA</t> treatment (n = 3, paired t test). (G) TOPflash promoter activity in Control and siHOTAIR imGSAT cells (n = 5, paired t test). (H) Adipogenesis assessed by AdipoRed staining in control and siHOTAIR cells treated with CHIR99021 1 mM and 3 mM throughout adipogenic differentiation (n = 3, ANOVA). (I) Differential alternative splicing (DAS) events between shControl and shHOTAIR cells determined by SUPPA2:diffSplice. Alternative first (AF) or last (AL) exon, alternative 50 or 30 splice site (A5 and A3), mutually exclusive (MX) and skipped exons (SE), and retained introns (RI). (J) Number of genes that are differentially alternatively spliced at both the isoform (limma) and event (SUPPA2) level across each day of differentiation. (K) The proportion splice-in (PSI) of significantly expressed PPARG (GENCODE) isoforms in shControl and shHOTAIR cells across each day of differentiation. *p < 0.05 (shControl versus shHOTAIR). Data presented as means ± SEMs (B–D and F–H). See also Figure S7. n represents the number of experimental replicates.
Overrepresentation Analysis Table S3d, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cebpd/CEBPD+Human+siRNA+Oligo+Duplex/pm35905723-357-26-35
Average 90 stars, based on 1 article reviews
overrepresentation analysis table s3d - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene antibodies against c ebpδ
Figure 5. HOTAIR-PRC2 regulates developmental pathways in differentiating gluteal preadipocytes (A) Venn diagram showing overlap between PRC2 target genes (from FUMA and CHEA) and shHOTAIR WGCNA DEGs (upregulated at all time points, light-green module). See also Figure S6. (B) qPCR confirmation of PCDH10 expression in shHOTAIR and shControl cells during adipogenesis (n = 3). Data were assessed using 2-way ANOVA; *p < 0.05. (C and D) ChIP to assess (C) SUZ12 and (D) H3K27me3 enrichment at the PCDH10 promoter in gluteal shHOTAIR and shControl cells on differentiation day 0 (n = 3). Mouse IgG antibody was used as a negative control. Data were assessed by Student’s t test; *p < 0.05. (E) Expression heatmap of shHOTAIR DEGs annotated to UniProtKB: Wnt signaling (shHOTAIR versus shControl; rlog normalized fold changes DESeq2). (F) HOTAIR1 gene expression in imGSAT cells expressing the 7TFP TOPflash luciferase vector following 72 h HOTAIR <t>siRNA</t> treatment (n = 3, paired t test). (G) TOPflash promoter activity in Control and siHOTAIR imGSAT cells (n = 5, paired t test). (H) Adipogenesis assessed by AdipoRed staining in control and siHOTAIR cells treated with CHIR99021 1 mM and 3 mM throughout adipogenic differentiation (n = 3, ANOVA). (I) Differential alternative splicing (DAS) events between shControl and shHOTAIR cells determined by SUPPA2:diffSplice. Alternative first (AF) or last (AL) exon, alternative 50 or 30 splice site (A5 and A3), mutually exclusive (MX) and skipped exons (SE), and retained introns (RI). (J) Number of genes that are differentially alternatively spliced at both the isoform (limma) and event (SUPPA2) level across each day of differentiation. (K) The proportion splice-in (PSI) of significantly expressed PPARG (GENCODE) isoforms in shControl and shHOTAIR cells across each day of differentiation. *p < 0.05 (shControl versus shHOTAIR). Data presented as means ± SEMs (B–D and F–H). See also Figure S7. n represents the number of experimental replicates.
Antibodies Against C Ebpδ, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cebpd/CEBPD+Rabbit+Polyclonal+Antibody/us10676455-723-0-5
Average 90 stars, based on 1 article reviews
antibodies against c ebpδ - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

91
Rockland Immunochemicals c ebpδ
Figure 5. HOTAIR-PRC2 regulates developmental pathways in differentiating gluteal preadipocytes (A) Venn diagram showing overlap between PRC2 target genes (from FUMA and CHEA) and shHOTAIR WGCNA DEGs (upregulated at all time points, light-green module). See also Figure S6. (B) qPCR confirmation of PCDH10 expression in shHOTAIR and shControl cells during adipogenesis (n = 3). Data were assessed using 2-way ANOVA; *p < 0.05. (C and D) ChIP to assess (C) SUZ12 and (D) H3K27me3 enrichment at the PCDH10 promoter in gluteal shHOTAIR and shControl cells on differentiation day 0 (n = 3). Mouse IgG antibody was used as a negative control. Data were assessed by Student’s t test; *p < 0.05. (E) Expression heatmap of shHOTAIR DEGs annotated to UniProtKB: Wnt signaling (shHOTAIR versus shControl; rlog normalized fold changes DESeq2). (F) HOTAIR1 gene expression in imGSAT cells expressing the 7TFP TOPflash luciferase vector following 72 h HOTAIR <t>siRNA</t> treatment (n = 3, paired t test). (G) TOPflash promoter activity in Control and siHOTAIR imGSAT cells (n = 5, paired t test). (H) Adipogenesis assessed by AdipoRed staining in control and siHOTAIR cells treated with CHIR99021 1 mM and 3 mM throughout adipogenic differentiation (n = 3, ANOVA). (I) Differential alternative splicing (DAS) events between shControl and shHOTAIR cells determined by SUPPA2:diffSplice. Alternative first (AF) or last (AL) exon, alternative 50 or 30 splice site (A5 and A3), mutually exclusive (MX) and skipped exons (SE), and retained introns (RI). (J) Number of genes that are differentially alternatively spliced at both the isoform (limma) and event (SUPPA2) level across each day of differentiation. (K) The proportion splice-in (PSI) of significantly expressed PPARG (GENCODE) isoforms in shControl and shHOTAIR cells across each day of differentiation. *p < 0.05 (shControl versus shHOTAIR). Data presented as means ± SEMs (B–D and F–H). See also Figure S7. n represents the number of experimental replicates.
C Ebpδ, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cebpd/CEBP+Delta+Antibody/pmc07206087-275-7-9
Average 91 stars, based on 1 article reviews
c ebpδ - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

90
OriGene anti cebpd
Figure 5. HOTAIR-PRC2 regulates developmental pathways in differentiating gluteal preadipocytes (A) Venn diagram showing overlap between PRC2 target genes (from FUMA and CHEA) and shHOTAIR WGCNA DEGs (upregulated at all time points, light-green module). See also Figure S6. (B) qPCR confirmation of PCDH10 expression in shHOTAIR and shControl cells during adipogenesis (n = 3). Data were assessed using 2-way ANOVA; *p < 0.05. (C and D) ChIP to assess (C) SUZ12 and (D) H3K27me3 enrichment at the PCDH10 promoter in gluteal shHOTAIR and shControl cells on differentiation day 0 (n = 3). Mouse IgG antibody was used as a negative control. Data were assessed by Student’s t test; *p < 0.05. (E) Expression heatmap of shHOTAIR DEGs annotated to UniProtKB: Wnt signaling (shHOTAIR versus shControl; rlog normalized fold changes DESeq2). (F) HOTAIR1 gene expression in imGSAT cells expressing the 7TFP TOPflash luciferase vector following 72 h HOTAIR <t>siRNA</t> treatment (n = 3, paired t test). (G) TOPflash promoter activity in Control and siHOTAIR imGSAT cells (n = 5, paired t test). (H) Adipogenesis assessed by AdipoRed staining in control and siHOTAIR cells treated with CHIR99021 1 mM and 3 mM throughout adipogenic differentiation (n = 3, ANOVA). (I) Differential alternative splicing (DAS) events between shControl and shHOTAIR cells determined by SUPPA2:diffSplice. Alternative first (AF) or last (AL) exon, alternative 50 or 30 splice site (A5 and A3), mutually exclusive (MX) and skipped exons (SE), and retained introns (RI). (J) Number of genes that are differentially alternatively spliced at both the isoform (limma) and event (SUPPA2) level across each day of differentiation. (K) The proportion splice-in (PSI) of significantly expressed PPARG (GENCODE) isoforms in shControl and shHOTAIR cells across each day of differentiation. *p < 0.05 (shControl versus shHOTAIR). Data presented as means ± SEMs (B–D and F–H). See also Figure S7. n represents the number of experimental replicates.
Anti Cebpd, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cebpd/CEBPD+Rabbit+Polyclonal+Antibody/pmc08216458-108-22-23
Average 90 stars, based on 1 article reviews
anti cebpd - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene mcebpd 3 utr fw 5 gcagagctcagaattctgcctttctactaagatactggttg
Figure 5. HOTAIR-PRC2 regulates developmental pathways in differentiating gluteal preadipocytes (A) Venn diagram showing overlap between PRC2 target genes (from FUMA and CHEA) and shHOTAIR WGCNA DEGs (upregulated at all time points, light-green module). See also Figure S6. (B) qPCR confirmation of PCDH10 expression in shHOTAIR and shControl cells during adipogenesis (n = 3). Data were assessed using 2-way ANOVA; *p < 0.05. (C and D) ChIP to assess (C) SUZ12 and (D) H3K27me3 enrichment at the PCDH10 promoter in gluteal shHOTAIR and shControl cells on differentiation day 0 (n = 3). Mouse IgG antibody was used as a negative control. Data were assessed by Student’s t test; *p < 0.05. (E) Expression heatmap of shHOTAIR DEGs annotated to UniProtKB: Wnt signaling (shHOTAIR versus shControl; rlog normalized fold changes DESeq2). (F) HOTAIR1 gene expression in imGSAT cells expressing the 7TFP TOPflash luciferase vector following 72 h HOTAIR <t>siRNA</t> treatment (n = 3, paired t test). (G) TOPflash promoter activity in Control and siHOTAIR imGSAT cells (n = 5, paired t test). (H) Adipogenesis assessed by AdipoRed staining in control and siHOTAIR cells treated with CHIR99021 1 mM and 3 mM throughout adipogenic differentiation (n = 3, ANOVA). (I) Differential alternative splicing (DAS) events between shControl and shHOTAIR cells determined by SUPPA2:diffSplice. Alternative first (AF) or last (AL) exon, alternative 50 or 30 splice site (A5 and A3), mutually exclusive (MX) and skipped exons (SE), and retained introns (RI). (J) Number of genes that are differentially alternatively spliced at both the isoform (limma) and event (SUPPA2) level across each day of differentiation. (K) The proportion splice-in (PSI) of significantly expressed PPARG (GENCODE) isoforms in shControl and shHOTAIR cells across each day of differentiation. *p < 0.05 (shControl versus shHOTAIR). Data presented as means ± SEMs (B–D and F–H). See also Figure S7. n represents the number of experimental replicates.
Mcebpd 3 Utr Fw 5 Gcagagctcagaattctgcctttctactaagatactggttg, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cebpd/Cebpd+(NM_007679)+Mouse+Untagged+Clone/pmc07184748-144-27-65
Average 90 stars, based on 1 article reviews
mcebpd 3 utr fw 5 gcagagctcagaattctgcctttctactaagatactggttg - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
ProSci Incorporated anti cebpd
Figure 5. HOTAIR-PRC2 regulates developmental pathways in differentiating gluteal preadipocytes (A) Venn diagram showing overlap between PRC2 target genes (from FUMA and CHEA) and shHOTAIR WGCNA DEGs (upregulated at all time points, light-green module). See also Figure S6. (B) qPCR confirmation of PCDH10 expression in shHOTAIR and shControl cells during adipogenesis (n = 3). Data were assessed using 2-way ANOVA; *p < 0.05. (C and D) ChIP to assess (C) SUZ12 and (D) H3K27me3 enrichment at the PCDH10 promoter in gluteal shHOTAIR and shControl cells on differentiation day 0 (n = 3). Mouse IgG antibody was used as a negative control. Data were assessed by Student’s t test; *p < 0.05. (E) Expression heatmap of shHOTAIR DEGs annotated to UniProtKB: Wnt signaling (shHOTAIR versus shControl; rlog normalized fold changes DESeq2). (F) HOTAIR1 gene expression in imGSAT cells expressing the 7TFP TOPflash luciferase vector following 72 h HOTAIR <t>siRNA</t> treatment (n = 3, paired t test). (G) TOPflash promoter activity in Control and siHOTAIR imGSAT cells (n = 5, paired t test). (H) Adipogenesis assessed by AdipoRed staining in control and siHOTAIR cells treated with CHIR99021 1 mM and 3 mM throughout adipogenic differentiation (n = 3, ANOVA). (I) Differential alternative splicing (DAS) events between shControl and shHOTAIR cells determined by SUPPA2:diffSplice. Alternative first (AF) or last (AL) exon, alternative 50 or 30 splice site (A5 and A3), mutually exclusive (MX) and skipped exons (SE), and retained introns (RI). (J) Number of genes that are differentially alternatively spliced at both the isoform (limma) and event (SUPPA2) level across each day of differentiation. (K) The proportion splice-in (PSI) of significantly expressed PPARG (GENCODE) isoforms in shControl and shHOTAIR cells across each day of differentiation. *p < 0.05 (shControl versus shHOTAIR). Data presented as means ± SEMs (B–D and F–H). See also Figure S7. n represents the number of experimental replicates.
Anti Cebpd, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cebpd/CEBPD+Antibody/pmc07184748-147-5-7
Average 90 stars, based on 1 article reviews
anti cebpd - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene rat c ebpd
Figure 5. HOTAIR-PRC2 regulates developmental pathways in differentiating gluteal preadipocytes (A) Venn diagram showing overlap between PRC2 target genes (from FUMA and CHEA) and shHOTAIR WGCNA DEGs (upregulated at all time points, light-green module). See also Figure S6. (B) qPCR confirmation of PCDH10 expression in shHOTAIR and shControl cells during adipogenesis (n = 3). Data were assessed using 2-way ANOVA; *p < 0.05. (C and D) ChIP to assess (C) SUZ12 and (D) H3K27me3 enrichment at the PCDH10 promoter in gluteal shHOTAIR and shControl cells on differentiation day 0 (n = 3). Mouse IgG antibody was used as a negative control. Data were assessed by Student’s t test; *p < 0.05. (E) Expression heatmap of shHOTAIR DEGs annotated to UniProtKB: Wnt signaling (shHOTAIR versus shControl; rlog normalized fold changes DESeq2). (F) HOTAIR1 gene expression in imGSAT cells expressing the 7TFP TOPflash luciferase vector following 72 h HOTAIR <t>siRNA</t> treatment (n = 3, paired t test). (G) TOPflash promoter activity in Control and siHOTAIR imGSAT cells (n = 5, paired t test). (H) Adipogenesis assessed by AdipoRed staining in control and siHOTAIR cells treated with CHIR99021 1 mM and 3 mM throughout adipogenic differentiation (n = 3, ANOVA). (I) Differential alternative splicing (DAS) events between shControl and shHOTAIR cells determined by SUPPA2:diffSplice. Alternative first (AF) or last (AL) exon, alternative 50 or 30 splice site (A5 and A3), mutually exclusive (MX) and skipped exons (SE), and retained introns (RI). (J) Number of genes that are differentially alternatively spliced at both the isoform (limma) and event (SUPPA2) level across each day of differentiation. (K) The proportion splice-in (PSI) of significantly expressed PPARG (GENCODE) isoforms in shControl and shHOTAIR cells across each day of differentiation. *p < 0.05 (shControl versus shHOTAIR). Data presented as means ± SEMs (B–D and F–H). See also Figure S7. n represents the number of experimental replicates.
Rat C Ebpd, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cebpd/Cebpd+(NM_013154)+Rat+Untagged+Clone/pm22347430-277-2-15
Average 90 stars, based on 1 article reviews
rat c ebpd - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene pcmv c ebpd
Figure 5. HOTAIR-PRC2 regulates developmental pathways in differentiating gluteal preadipocytes (A) Venn diagram showing overlap between PRC2 target genes (from FUMA and CHEA) and shHOTAIR WGCNA DEGs (upregulated at all time points, light-green module). See also Figure S6. (B) qPCR confirmation of PCDH10 expression in shHOTAIR and shControl cells during adipogenesis (n = 3). Data were assessed using 2-way ANOVA; *p < 0.05. (C and D) ChIP to assess (C) SUZ12 and (D) H3K27me3 enrichment at the PCDH10 promoter in gluteal shHOTAIR and shControl cells on differentiation day 0 (n = 3). Mouse IgG antibody was used as a negative control. Data were assessed by Student’s t test; *p < 0.05. (E) Expression heatmap of shHOTAIR DEGs annotated to UniProtKB: Wnt signaling (shHOTAIR versus shControl; rlog normalized fold changes DESeq2). (F) HOTAIR1 gene expression in imGSAT cells expressing the 7TFP TOPflash luciferase vector following 72 h HOTAIR <t>siRNA</t> treatment (n = 3, paired t test). (G) TOPflash promoter activity in Control and siHOTAIR imGSAT cells (n = 5, paired t test). (H) Adipogenesis assessed by AdipoRed staining in control and siHOTAIR cells treated with CHIR99021 1 mM and 3 mM throughout adipogenic differentiation (n = 3, ANOVA). (I) Differential alternative splicing (DAS) events between shControl and shHOTAIR cells determined by SUPPA2:diffSplice. Alternative first (AF) or last (AL) exon, alternative 50 or 30 splice site (A5 and A3), mutually exclusive (MX) and skipped exons (SE), and retained introns (RI). (J) Number of genes that are differentially alternatively spliced at both the isoform (limma) and event (SUPPA2) level across each day of differentiation. (K) The proportion splice-in (PSI) of significantly expressed PPARG (GENCODE) isoforms in shControl and shHOTAIR cells across each day of differentiation. *p < 0.05 (shControl versus shHOTAIR). Data presented as means ± SEMs (B–D and F–H). See also Figure S7. n represents the number of experimental replicates.
Pcmv C Ebpd, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cebpd/CEBPD+(NM_005195)+Human+Tagged+ORF+Clone/pm22347430-277-10-15
Average 90 stars, based on 1 article reviews
pcmv c ebpd - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

91
Biorbyt anti human cebpd
Figure 5. HOTAIR-PRC2 regulates developmental pathways in differentiating gluteal preadipocytes (A) Venn diagram showing overlap between PRC2 target genes (from FUMA and CHEA) and shHOTAIR WGCNA DEGs (upregulated at all time points, light-green module). See also Figure S6. (B) qPCR confirmation of PCDH10 expression in shHOTAIR and shControl cells during adipogenesis (n = 3). Data were assessed using 2-way ANOVA; *p < 0.05. (C and D) ChIP to assess (C) SUZ12 and (D) H3K27me3 enrichment at the PCDH10 promoter in gluteal shHOTAIR and shControl cells on differentiation day 0 (n = 3). Mouse IgG antibody was used as a negative control. Data were assessed by Student’s t test; *p < 0.05. (E) Expression heatmap of shHOTAIR DEGs annotated to UniProtKB: Wnt signaling (shHOTAIR versus shControl; rlog normalized fold changes DESeq2). (F) HOTAIR1 gene expression in imGSAT cells expressing the 7TFP TOPflash luciferase vector following 72 h HOTAIR <t>siRNA</t> treatment (n = 3, paired t test). (G) TOPflash promoter activity in Control and siHOTAIR imGSAT cells (n = 5, paired t test). (H) Adipogenesis assessed by AdipoRed staining in control and siHOTAIR cells treated with CHIR99021 1 mM and 3 mM throughout adipogenic differentiation (n = 3, ANOVA). (I) Differential alternative splicing (DAS) events between shControl and shHOTAIR cells determined by SUPPA2:diffSplice. Alternative first (AF) or last (AL) exon, alternative 50 or 30 splice site (A5 and A3), mutually exclusive (MX) and skipped exons (SE), and retained introns (RI). (J) Number of genes that are differentially alternatively spliced at both the isoform (limma) and event (SUPPA2) level across each day of differentiation. (K) The proportion splice-in (PSI) of significantly expressed PPARG (GENCODE) isoforms in shControl and shHOTAIR cells across each day of differentiation. *p < 0.05 (shControl versus shHOTAIR). Data presented as means ± SEMs (B–D and F–H). See also Figure S7. n represents the number of experimental replicates.
Anti Human Cebpd, supplied by Biorbyt, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cebpd/Cebpd+antibody/pm37059730-101-3-6
Average 91 stars, based on 1 article reviews
anti human cebpd - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

90
OriGene human c ebpd expression vector
Figure 5. HOTAIR-PRC2 regulates developmental pathways in differentiating gluteal preadipocytes (A) Venn diagram showing overlap between PRC2 target genes (from FUMA and CHEA) and shHOTAIR WGCNA DEGs (upregulated at all time points, light-green module). See also Figure S6. (B) qPCR confirmation of PCDH10 expression in shHOTAIR and shControl cells during adipogenesis (n = 3). Data were assessed using 2-way ANOVA; *p < 0.05. (C and D) ChIP to assess (C) SUZ12 and (D) H3K27me3 enrichment at the PCDH10 promoter in gluteal shHOTAIR and shControl cells on differentiation day 0 (n = 3). Mouse IgG antibody was used as a negative control. Data were assessed by Student’s t test; *p < 0.05. (E) Expression heatmap of shHOTAIR DEGs annotated to UniProtKB: Wnt signaling (shHOTAIR versus shControl; rlog normalized fold changes DESeq2). (F) HOTAIR1 gene expression in imGSAT cells expressing the 7TFP TOPflash luciferase vector following 72 h HOTAIR <t>siRNA</t> treatment (n = 3, paired t test). (G) TOPflash promoter activity in Control and siHOTAIR imGSAT cells (n = 5, paired t test). (H) Adipogenesis assessed by AdipoRed staining in control and siHOTAIR cells treated with CHIR99021 1 mM and 3 mM throughout adipogenic differentiation (n = 3, ANOVA). (I) Differential alternative splicing (DAS) events between shControl and shHOTAIR cells determined by SUPPA2:diffSplice. Alternative first (AF) or last (AL) exon, alternative 50 or 30 splice site (A5 and A3), mutually exclusive (MX) and skipped exons (SE), and retained introns (RI). (J) Number of genes that are differentially alternatively spliced at both the isoform (limma) and event (SUPPA2) level across each day of differentiation. (K) The proportion splice-in (PSI) of significantly expressed PPARG (GENCODE) isoforms in shControl and shHOTAIR cells across each day of differentiation. *p < 0.05 (shControl versus shHOTAIR). Data presented as means ± SEMs (B–D and F–H). See also Figure S7. n represents the number of experimental replicates.
Human C Ebpd Expression Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cebpd/CEBPD+(NM_005195)+Human+Untagged+Clone/pmc04521790-109-1-9
Average 90 stars, based on 1 article reviews
human c ebpd expression vector - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Figure 5. HOTAIR-PRC2 regulates developmental pathways in differentiating gluteal preadipocytes (A) Venn diagram showing overlap between PRC2 target genes (from FUMA and CHEA) and shHOTAIR WGCNA DEGs (upregulated at all time points, light-green module). See also Figure S6. (B) qPCR confirmation of PCDH10 expression in shHOTAIR and shControl cells during adipogenesis (n = 3). Data were assessed using 2-way ANOVA; *p < 0.05. (C and D) ChIP to assess (C) SUZ12 and (D) H3K27me3 enrichment at the PCDH10 promoter in gluteal shHOTAIR and shControl cells on differentiation day 0 (n = 3). Mouse IgG antibody was used as a negative control. Data were assessed by Student’s t test; *p < 0.05. (E) Expression heatmap of shHOTAIR DEGs annotated to UniProtKB: Wnt signaling (shHOTAIR versus shControl; rlog normalized fold changes DESeq2). (F) HOTAIR1 gene expression in imGSAT cells expressing the 7TFP TOPflash luciferase vector following 72 h HOTAIR siRNA treatment (n = 3, paired t test). (G) TOPflash promoter activity in Control and siHOTAIR imGSAT cells (n = 5, paired t test). (H) Adipogenesis assessed by AdipoRed staining in control and siHOTAIR cells treated with CHIR99021 1 mM and 3 mM throughout adipogenic differentiation (n = 3, ANOVA). (I) Differential alternative splicing (DAS) events between shControl and shHOTAIR cells determined by SUPPA2:diffSplice. Alternative first (AF) or last (AL) exon, alternative 50 or 30 splice site (A5 and A3), mutually exclusive (MX) and skipped exons (SE), and retained introns (RI). (J) Number of genes that are differentially alternatively spliced at both the isoform (limma) and event (SUPPA2) level across each day of differentiation. (K) The proportion splice-in (PSI) of significantly expressed PPARG (GENCODE) isoforms in shControl and shHOTAIR cells across each day of differentiation. *p < 0.05 (shControl versus shHOTAIR). Data presented as means ± SEMs (B–D and F–H). See also Figure S7. n represents the number of experimental replicates.

Journal: Cell reports

Article Title: HOTAIR interacts with PRC2 complex regulating the regional preadipocyte transcriptome and human fat distribution.

doi: 10.1016/j.celrep.2022.111136

Figure Lengend Snippet: Figure 5. HOTAIR-PRC2 regulates developmental pathways in differentiating gluteal preadipocytes (A) Venn diagram showing overlap between PRC2 target genes (from FUMA and CHEA) and shHOTAIR WGCNA DEGs (upregulated at all time points, light-green module). See also Figure S6. (B) qPCR confirmation of PCDH10 expression in shHOTAIR and shControl cells during adipogenesis (n = 3). Data were assessed using 2-way ANOVA; *p < 0.05. (C and D) ChIP to assess (C) SUZ12 and (D) H3K27me3 enrichment at the PCDH10 promoter in gluteal shHOTAIR and shControl cells on differentiation day 0 (n = 3). Mouse IgG antibody was used as a negative control. Data were assessed by Student’s t test; *p < 0.05. (E) Expression heatmap of shHOTAIR DEGs annotated to UniProtKB: Wnt signaling (shHOTAIR versus shControl; rlog normalized fold changes DESeq2). (F) HOTAIR1 gene expression in imGSAT cells expressing the 7TFP TOPflash luciferase vector following 72 h HOTAIR siRNA treatment (n = 3, paired t test). (G) TOPflash promoter activity in Control and siHOTAIR imGSAT cells (n = 5, paired t test). (H) Adipogenesis assessed by AdipoRed staining in control and siHOTAIR cells treated with CHIR99021 1 mM and 3 mM throughout adipogenic differentiation (n = 3, ANOVA). (I) Differential alternative splicing (DAS) events between shControl and shHOTAIR cells determined by SUPPA2:diffSplice. Alternative first (AF) or last (AL) exon, alternative 50 or 30 splice site (A5 and A3), mutually exclusive (MX) and skipped exons (SE), and retained introns (RI). (J) Number of genes that are differentially alternatively spliced at both the isoform (limma) and event (SUPPA2) level across each day of differentiation. (K) The proportion splice-in (PSI) of significantly expressed PPARG (GENCODE) isoforms in shControl and shHOTAIR cells across each day of differentiation. *p < 0.05 (shControl versus shHOTAIR). Data presented as means ± SEMs (B–D and F–H). See also Figure S7. n represents the number of experimental replicates.

Article Snippet: Lists of DAS genes were then uploaded to the gProfiler online g:GOSt tool (Raudvere et al., 2019) for overrepresentation analysis (Table S3D). siRNA rescue experiments Human siRNA oligo duplexes were used to transiently suppress CEBPD (Origene SR300761) or PTEN (Origene SR321496) from differentiation day4 (siRNA was added once on day4).

Techniques: Expressing, Negative Control, Gene Expression, Luciferase, Plasmid Preparation, Activity Assay, Control, Staining, Alternative Splicing