ccn4 Search Results


91
R&D Systems mouse anti mouse wisp
Mouse Anti Mouse Wisp, supplied by R&D Systems, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse anti mouse wisp/product/R&D Systems
Average 91 stars, based on 1 article reviews
mouse anti mouse wisp - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

93
Sino Biological recombinant human wisp1 protein
A Cluster analysis of MPA-regulated genes encoding secretory proteins in ESCs. ESCs were treated with 10 μM MPA or ethanol (EtOH) for 6 h before RNA sequencing. B mRNA levels of NrCAM , BMP2 , <t>WISP1</t> , and ITGA10 were significantly upregulated in ESCs after MPA treatment. Silencing PR expression with si PGR in ESCs weakened MPA-induced upregulation of these four proteins. ESCs or ESCs-si PGR were treated with or without 10 μM MPA for 6 h. Eleven candidate gene mRNA levels were reevaluated by real-time PCR. C Exogenous NrCAM inhibited EC cell proliferation in a dose-dependent manner. Ishikawa and ECC-1 cells were treated with 0, 1, 10, 100, and 1000 ng/mL NrCAM for 48 h before CCK-8 assays. D Exogenous NrCAM inhibited EC cell proliferation in a time-dependent manner. Ishikawa and ECC-1 cells were treated with 1000 ng/mL NrCAM for 24, 48, and 72 h before CCK-8 assays. E MPA promoted NrCAM protein expression in ESCs in a dose-dependent manner. NrCAM expression was detected by western blotting. ESCs were treated with 0, 5, 10, and 20 μM MPA for 48 h. F MPA promoted NrCAM secretion in ESCs by ELISA. ESCs were treated with MPA at the indicated dose for 48 h (left) or 10 μM MPA for 24, 48, or 72 h (right). The CM extracted from ESCs was collected to measure NrCAM concentration by ELISA. G MPA-induced NrCAM protein expression was attenuated by silencing PGR in ESCs. ESCs or ESCs-si PGR were treated with 10 μM MPA for 48 h before western blotting analysis. H NrCAM and MPA cotreatment had a stronger inhibitory effect on EC cell proliferation than MPA or NrCAM alone. Ishikawa and ECC-1 cells were treated with 1000 ng/mL NrCAM and/or 10 μM MPA for 48 h before CCK-8 assays. I Transfection efficiency of siRNAs targeting NrCAM was confirmed by real-time PCR and western blotting. J The inhibitory effect of ESCs on EC cell proliferation was blocked by silencing NrCAM expression in ESCs. After transfection with si NrCAM or siCtrl for 8 h, ESCs were treated with or without 10 μM MPA for 48 h, then for CM collection. Ishikawa and ECC-1 cells were treated with 10 μM MPA, CM (ESCs-si NrCAM -2) and CM (ESCs-si NrCAM -2 + MPA) for 48 h before CCK-8 assays. * P < 0.05; ** P < 0.01; *** P < 0.001; n.s. not significant.
Recombinant Human Wisp1 Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant human wisp1 protein/product/Sino Biological
Average 93 stars, based on 1 article reviews
recombinant human wisp1 protein - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
R&D Systems anti wisp1
A Cluster analysis of MPA-regulated genes encoding secretory proteins in ESCs. ESCs were treated with 10 μM MPA or ethanol (EtOH) for 6 h before RNA sequencing. B mRNA levels of NrCAM , BMP2 , <t>WISP1</t> , and ITGA10 were significantly upregulated in ESCs after MPA treatment. Silencing PR expression with si PGR in ESCs weakened MPA-induced upregulation of these four proteins. ESCs or ESCs-si PGR were treated with or without 10 μM MPA for 6 h. Eleven candidate gene mRNA levels were reevaluated by real-time PCR. C Exogenous NrCAM inhibited EC cell proliferation in a dose-dependent manner. Ishikawa and ECC-1 cells were treated with 0, 1, 10, 100, and 1000 ng/mL NrCAM for 48 h before CCK-8 assays. D Exogenous NrCAM inhibited EC cell proliferation in a time-dependent manner. Ishikawa and ECC-1 cells were treated with 1000 ng/mL NrCAM for 24, 48, and 72 h before CCK-8 assays. E MPA promoted NrCAM protein expression in ESCs in a dose-dependent manner. NrCAM expression was detected by western blotting. ESCs were treated with 0, 5, 10, and 20 μM MPA for 48 h. F MPA promoted NrCAM secretion in ESCs by ELISA. ESCs were treated with MPA at the indicated dose for 48 h (left) or 10 μM MPA for 24, 48, or 72 h (right). The CM extracted from ESCs was collected to measure NrCAM concentration by ELISA. G MPA-induced NrCAM protein expression was attenuated by silencing PGR in ESCs. ESCs or ESCs-si PGR were treated with 10 μM MPA for 48 h before western blotting analysis. H NrCAM and MPA cotreatment had a stronger inhibitory effect on EC cell proliferation than MPA or NrCAM alone. Ishikawa and ECC-1 cells were treated with 1000 ng/mL NrCAM and/or 10 μM MPA for 48 h before CCK-8 assays. I Transfection efficiency of siRNAs targeting NrCAM was confirmed by real-time PCR and western blotting. J The inhibitory effect of ESCs on EC cell proliferation was blocked by silencing NrCAM expression in ESCs. After transfection with si NrCAM or siCtrl for 8 h, ESCs were treated with or without 10 μM MPA for 48 h, then for CM collection. Ishikawa and ECC-1 cells were treated with 10 μM MPA, CM (ESCs-si NrCAM -2) and CM (ESCs-si NrCAM -2 + MPA) for 48 h before CCK-8 assays. * P < 0.05; ** P < 0.01; *** P < 0.001; n.s. not significant.
Anti Wisp1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti wisp1/product/R&D Systems
Average 93 stars, based on 1 article reviews
anti wisp1 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
R&D Systems ccn4
AngII increased blood pressure in <t>CCN4</t> +/+ ApoE −/− and the CCN4 −/− ApoE −/− mice. CCN4 −/− ApoE −/− and wild type CCN4 +/+ ApoE −/− mice were infused with Angiotensin II (AngII) for 28 days using mini-osmotic pumps. Blood pressure was measured on day 0 (before AngII) and day 28 (after AngII). Data is presented as mean ± sem, CCN4 −/− ApoE −/− n = 13 and CCN4 +/+ ApoE −/− n = 14, * indicates p < 0.001 compared to before AngII controls, ANOVA
Ccn4, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ccn4/product/R&D Systems
Average 90 stars, based on 1 article reviews
ccn4 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Proteintech wisp1
AngII increased blood pressure in <t>CCN4</t> +/+ ApoE −/− and the CCN4 −/− ApoE −/− mice. CCN4 −/− ApoE −/− and wild type CCN4 +/+ ApoE −/− mice were infused with Angiotensin II (AngII) for 28 days using mini-osmotic pumps. Blood pressure was measured on day 0 (before AngII) and day 28 (after AngII). Data is presented as mean ± sem, CCN4 −/− ApoE −/− n = 13 and CCN4 +/+ ApoE −/− n = 14, * indicates p < 0.001 compared to before AngII controls, ANOVA
Wisp1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wisp1/product/Proteintech
Average 93 stars, based on 1 article reviews
wisp1 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

92
R&D Systems recombinant human wisp
AngII increased blood pressure in <t>CCN4</t> +/+ ApoE −/− and the CCN4 −/− ApoE −/− mice. CCN4 −/− ApoE −/− and wild type CCN4 +/+ ApoE −/− mice were infused with Angiotensin II (AngII) for 28 days using mini-osmotic pumps. Blood pressure was measured on day 0 (before AngII) and day 28 (after AngII). Data is presented as mean ± sem, CCN4 −/− ApoE −/− n = 13 and CCN4 +/+ ApoE −/− n = 14, * indicates p < 0.001 compared to before AngII controls, ANOVA
Recombinant Human Wisp, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant human wisp/product/R&D Systems
Average 92 stars, based on 1 article reviews
recombinant human wisp - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

92
R&D Systems recombinant mouse wisp1
<t>WISP1</t> expression is increased in melanoma and is associated with reduced overall survival of patients diagnosed with primary melanoma. A, Comparison of WISP1 mRNA expression in benign skin conditions (normal skin and benign melanocytic skin nevus) to primary melanoma. Original expression profiles were from . P-values calculated using ANOVA with post-hoc Tukey HSD test. B, Representative original and deconvoluted color images derived from human normal skin and melanoma tissue microarray probed using a WISP1 antibody (HPA007121) and imaged using 3,3’ diaminobenzidine and stained using hematoxylin for a normal skin (left) and two melanoma (right) tissue samples (original tissue microarray images were obtained from www.proteinatlas.org ) . Deconvoluted intensity of WISP1 staining is shown in red while cellular structures stained using hematoxylin are shown in blue. Arrows indicate melanocytes in epidermis and arrowheads indicate fibroblasts in dermis (stroma). C, The average WISP1 staining within normal skin and primary melanoma tissue samples. D, Distributions in non-zero pixel intensity values of WISP1 staining for normal skin (black curves) and primary melanoma (red curves) tissue samples. Numbers indicate the percentage of the distribution that have normalized pixel intensity values greater than 0.2. E, Kaplan-Meier estimate of overall survival of patients diagnosed with primary melanoma stratified by WISP1 transcript abundance (data from TCGA). Sample numbers and p-values calculated using the Peto & Peto modification of the Gehan-Wilcoxon test are indicated. F, Patient population characteristics of WISP1 high and WISP1 low groups. Statistical differences among categorical data and age were assessed using Fisher’s Exact test and Student’s t-Test, respectively (n.s. indicates p-value > 0.05).
Recombinant Mouse Wisp1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant mouse wisp1/product/R&D Systems
Average 92 stars, based on 1 article reviews
recombinant mouse wisp1 - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

92
R&D Systems nih3t3 mwisp1
WISP1 knockout in mouse and human melanoma cells inhibited tumor cell migration and invasion. A, 48-hour 2D growth of mouse metastatic melanoma cell line B16F10 and two B16F10 Wisp1-knockout cells (-KO1 and -KO2). B, Anchorage-independent growth assay of B16F10 and the two knockout cells in soft agar. Colonies were fixed and counted after 14 days. A representative staining image for each sample is shown on left, colony counts is plotted on the right. C, Wound healing assay of B16F10 and the two knockout cells. Scratches were created on 6-well plates in biological triplicate and the healing rate was calculated after 24 hours. D, Boyden transwell migration assay of B16F10 and the two knockout cells. A representative staining image for each sample is shown on left, relative migration efficiency is graphed on the right. E, Boyden transwell invasion assay of B16F10 and the two knockout cells. F, Boyden transwell invasion assay of human metastatic melanoma cell line RPMI-7951 and its two Wisp1-knockout cells (-KO1 and -KO2). G, Transwell migration assay of B16F10 and its knockout cell (-KO1) using conditioned media with different concentration of Wisp1 as chemoattractant. B16F10 migrated cells with conditioned medium from <t>NIH3T3-Babe</t> were set up as 100% of relative migration efficiency and compared with other cells. H, Transwell invasion assay of B16F10 and the two knockout cells using conditioned media with different concentration of Wisp1 as chemoattractant. B16F10 invaded cells with conditioned medium from NIH3T3-Babe were set up as 100% of relative invasion efficiency and compared with other cells. Statistical significance was determined by Student’s t test, where a p-value < 0.05 was considered significant and asterisks was used to indicate calculated range in p-values. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; and ns: not significant.
Nih3t3 Mwisp1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nih3t3 mwisp1/product/R&D Systems
Average 92 stars, based on 1 article reviews
nih3t3 mwisp1 - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

91
R&D Systems wisp1 quantikine
ELISA analysis of secreted biomarkers. SB525334, nintedanib, and sorafenib suppressed secretion of hyaluronic acid (HA), insulin-like growth factor binding protein 5 (IGFBP5), and WNT1-inducible signaling pathway protein 1 <t>(WISP1)</t> in the conditioned medium after 48 h of incubation. Data are means ± SE; n = 3 rats for both sham and bile duct ligation (BDL); n = 8–10 liver slices for each condition. **P < 0.01 and ***P < 0.001.
Wisp1 Quantikine, supplied by R&D Systems, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wisp1 quantikine/product/R&D Systems
Average 91 stars, based on 1 article reviews
wisp1 quantikine - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

92
R&D Systems human wisp
Stepwise linear regression analysis of association between <t> WISP-1/CCN4 </t> levels and metabolic parameters
Human Wisp, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human wisp/product/R&D Systems
Average 92 stars, based on 1 article reviews
human wisp - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

91
R&D Systems mouse recombinant wisp1
Stepwise linear regression analysis of association between <t> WISP-1/CCN4 </t> levels and metabolic parameters
Mouse Recombinant Wisp1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse recombinant wisp1/product/R&D Systems
Average 91 stars, based on 1 article reviews
mouse recombinant wisp1 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

90
OriGene wisp 1 sirnas
(A) <t>WISP-1</t> levels were measured in supernatants from grid-wounded intestinal epithelial monolayers with and without incubation with hrIL-10 (100 nM) and/or the CREB inhibitor 92-78-4 (inh) for 24 hours (***P < 0.001, n = 3, mean ± SEM). (B) SKCO-15 cells transfected with a WISP1 promoter coupled to luciferase (Luc) with or without the CREB-binding site were treated with TNF-α, IFN-γ, IL-10, or BSA (100 nM) (***P < 0.001, n = 8, mean ± SEM). bs, binding site. (C) Lysates from intact colon and wounds harvested on day 3 from IL-10fl/flCD11c Cre and IL-10fl/fl mice (***P < 0.001 and **P < 0.01, n = 3, mean ± SEM). All statistical comparisons were performed using ANOVA with Tukey’s multiple comparisons post test. inh, inhibitor.
Wisp 1 Sirnas, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wisp 1 sirnas/product/OriGene
Average 90 stars, based on 1 article reviews
wisp 1 sirnas - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


A Cluster analysis of MPA-regulated genes encoding secretory proteins in ESCs. ESCs were treated with 10 μM MPA or ethanol (EtOH) for 6 h before RNA sequencing. B mRNA levels of NrCAM , BMP2 , WISP1 , and ITGA10 were significantly upregulated in ESCs after MPA treatment. Silencing PR expression with si PGR in ESCs weakened MPA-induced upregulation of these four proteins. ESCs or ESCs-si PGR were treated with or without 10 μM MPA for 6 h. Eleven candidate gene mRNA levels were reevaluated by real-time PCR. C Exogenous NrCAM inhibited EC cell proliferation in a dose-dependent manner. Ishikawa and ECC-1 cells were treated with 0, 1, 10, 100, and 1000 ng/mL NrCAM for 48 h before CCK-8 assays. D Exogenous NrCAM inhibited EC cell proliferation in a time-dependent manner. Ishikawa and ECC-1 cells were treated with 1000 ng/mL NrCAM for 24, 48, and 72 h before CCK-8 assays. E MPA promoted NrCAM protein expression in ESCs in a dose-dependent manner. NrCAM expression was detected by western blotting. ESCs were treated with 0, 5, 10, and 20 μM MPA for 48 h. F MPA promoted NrCAM secretion in ESCs by ELISA. ESCs were treated with MPA at the indicated dose for 48 h (left) or 10 μM MPA for 24, 48, or 72 h (right). The CM extracted from ESCs was collected to measure NrCAM concentration by ELISA. G MPA-induced NrCAM protein expression was attenuated by silencing PGR in ESCs. ESCs or ESCs-si PGR were treated with 10 μM MPA for 48 h before western blotting analysis. H NrCAM and MPA cotreatment had a stronger inhibitory effect on EC cell proliferation than MPA or NrCAM alone. Ishikawa and ECC-1 cells were treated with 1000 ng/mL NrCAM and/or 10 μM MPA for 48 h before CCK-8 assays. I Transfection efficiency of siRNAs targeting NrCAM was confirmed by real-time PCR and western blotting. J The inhibitory effect of ESCs on EC cell proliferation was blocked by silencing NrCAM expression in ESCs. After transfection with si NrCAM or siCtrl for 8 h, ESCs were treated with or without 10 μM MPA for 48 h, then for CM collection. Ishikawa and ECC-1 cells were treated with 10 μM MPA, CM (ESCs-si NrCAM -2) and CM (ESCs-si NrCAM -2 + MPA) for 48 h before CCK-8 assays. * P < 0.05; ** P < 0.01; *** P < 0.001; n.s. not significant.

Journal: Cancer Gene Therapy

Article Title: NrCAM secreted by endometrial stromal cells enhances the progestin sensitivity of endometrial cancer cells through epigenetic modulation of PRB

doi: 10.1038/s41417-022-00467-0

Figure Lengend Snippet: A Cluster analysis of MPA-regulated genes encoding secretory proteins in ESCs. ESCs were treated with 10 μM MPA or ethanol (EtOH) for 6 h before RNA sequencing. B mRNA levels of NrCAM , BMP2 , WISP1 , and ITGA10 were significantly upregulated in ESCs after MPA treatment. Silencing PR expression with si PGR in ESCs weakened MPA-induced upregulation of these four proteins. ESCs or ESCs-si PGR were treated with or without 10 μM MPA for 6 h. Eleven candidate gene mRNA levels were reevaluated by real-time PCR. C Exogenous NrCAM inhibited EC cell proliferation in a dose-dependent manner. Ishikawa and ECC-1 cells were treated with 0, 1, 10, 100, and 1000 ng/mL NrCAM for 48 h before CCK-8 assays. D Exogenous NrCAM inhibited EC cell proliferation in a time-dependent manner. Ishikawa and ECC-1 cells were treated with 1000 ng/mL NrCAM for 24, 48, and 72 h before CCK-8 assays. E MPA promoted NrCAM protein expression in ESCs in a dose-dependent manner. NrCAM expression was detected by western blotting. ESCs were treated with 0, 5, 10, and 20 μM MPA for 48 h. F MPA promoted NrCAM secretion in ESCs by ELISA. ESCs were treated with MPA at the indicated dose for 48 h (left) or 10 μM MPA for 24, 48, or 72 h (right). The CM extracted from ESCs was collected to measure NrCAM concentration by ELISA. G MPA-induced NrCAM protein expression was attenuated by silencing PGR in ESCs. ESCs or ESCs-si PGR were treated with 10 μM MPA for 48 h before western blotting analysis. H NrCAM and MPA cotreatment had a stronger inhibitory effect on EC cell proliferation than MPA or NrCAM alone. Ishikawa and ECC-1 cells were treated with 1000 ng/mL NrCAM and/or 10 μM MPA for 48 h before CCK-8 assays. I Transfection efficiency of siRNAs targeting NrCAM was confirmed by real-time PCR and western blotting. J The inhibitory effect of ESCs on EC cell proliferation was blocked by silencing NrCAM expression in ESCs. After transfection with si NrCAM or siCtrl for 8 h, ESCs were treated with or without 10 μM MPA for 48 h, then for CM collection. Ishikawa and ECC-1 cells were treated with 10 μM MPA, CM (ESCs-si NrCAM -2) and CM (ESCs-si NrCAM -2 + MPA) for 48 h before CCK-8 assays. * P < 0.05; ** P < 0.01; *** P < 0.001; n.s. not significant.

Article Snippet: Drugs used in this study included MPA (Sigma-Aldrich, St. Louis, MO, USA), recombinant human NrCAM protein (CC04, NovoProtein, Shanghai, China), recombinant human BMP2 protein (C012, NovoProtein), recombinant human WISP1 protein (10442-H08H, Sino Biological, Beijing, China), and recombinant human ITGA10 protein (5895-AB-050, R&D Systems, Minneapolis, MN, USA) at the indicated doses for the indicated periods.

Techniques: RNA Sequencing Assay, Expressing, Real-time Polymerase Chain Reaction, CCK-8 Assay, Western Blot, Enzyme-linked Immunosorbent Assay, Concentration Assay, Transfection

AngII increased blood pressure in CCN4 +/+ ApoE −/− and the CCN4 −/− ApoE −/− mice. CCN4 −/− ApoE −/− and wild type CCN4 +/+ ApoE −/− mice were infused with Angiotensin II (AngII) for 28 days using mini-osmotic pumps. Blood pressure was measured on day 0 (before AngII) and day 28 (after AngII). Data is presented as mean ± sem, CCN4 −/− ApoE −/− n = 13 and CCN4 +/+ ApoE −/− n = 14, * indicates p < 0.001 compared to before AngII controls, ANOVA

Journal: Journal of Cell Communication and Signaling

Article Title: Aneurysm severity is suppressed by deletion of CCN4

doi: 10.1007/s12079-021-00623-5

Figure Lengend Snippet: AngII increased blood pressure in CCN4 +/+ ApoE −/− and the CCN4 −/− ApoE −/− mice. CCN4 −/− ApoE −/− and wild type CCN4 +/+ ApoE −/− mice were infused with Angiotensin II (AngII) for 28 days using mini-osmotic pumps. Blood pressure was measured on day 0 (before AngII) and day 28 (after AngII). Data is presented as mean ± sem, CCN4 −/− ApoE −/− n = 13 and CCN4 +/+ ApoE −/− n = 14, * indicates p < 0.001 compared to before AngII controls, ANOVA

Article Snippet: For dual staining sections were first immunostained for apoptosis (Cleaved PARP, Abcam, ab32064, 4.8 μg/ml), proliferation (PCNA, Abcam, 18197, 1 μg/ml) or CCN4 (R&D, AF1680 1 ug/ml) before double staining for VSMCs (α-smooth muscle actin, Sigma, A2547, 3.1 μg/ml) sing the Vector MOM kit (Vector Laboratories BMK-2202).

Techniques:

CCN4 deletion reduced rupture incidence, aortic size, and vessel thickness. Thoracic and abdominal aortae sections from CCN4 −/− ApoE −/− and CCN4 +/+ ApoE −/− mice exposed to AngII for 28 days were stained with EVG and aortic area measured by image analysis. CCN4 deletion reduced the rupture rate ( a ), number of ruptured aortae ( b ), average thoracic ( c ) and average abdominal ( d ) aortic size and average vessel thickness ( e ). Representative images of transverse sections through thoracic and abdominal aortae and images of gross anatomy ( f ) are included. Data is presented as mean ± sem, CCN4 +/+ ApoE −/− n = 13 and CCN4 −/− ApoE −/− n = 12, * indicates p < 0.05 compared to CCN4+/+ controls, all Mann–Whitney test except (B) Chi squared test

Journal: Journal of Cell Communication and Signaling

Article Title: Aneurysm severity is suppressed by deletion of CCN4

doi: 10.1007/s12079-021-00623-5

Figure Lengend Snippet: CCN4 deletion reduced rupture incidence, aortic size, and vessel thickness. Thoracic and abdominal aortae sections from CCN4 −/− ApoE −/− and CCN4 +/+ ApoE −/− mice exposed to AngII for 28 days were stained with EVG and aortic area measured by image analysis. CCN4 deletion reduced the rupture rate ( a ), number of ruptured aortae ( b ), average thoracic ( c ) and average abdominal ( d ) aortic size and average vessel thickness ( e ). Representative images of transverse sections through thoracic and abdominal aortae and images of gross anatomy ( f ) are included. Data is presented as mean ± sem, CCN4 +/+ ApoE −/− n = 13 and CCN4 −/− ApoE −/− n = 12, * indicates p < 0.05 compared to CCN4+/+ controls, all Mann–Whitney test except (B) Chi squared test

Article Snippet: For dual staining sections were first immunostained for apoptosis (Cleaved PARP, Abcam, ab32064, 4.8 μg/ml), proliferation (PCNA, Abcam, 18197, 1 μg/ml) or CCN4 (R&D, AF1680 1 ug/ml) before double staining for VSMCs (α-smooth muscle actin, Sigma, A2547, 3.1 μg/ml) sing the Vector MOM kit (Vector Laboratories BMK-2202).

Techniques: Staining, MANN-WHITNEY

CCN4 deletion reduced AAA formation. Aneurysm grade score—representative images of aortic sections stained with EVG and identified as grade 0–4. ApoE −/− CCN4 −/− and ApoE −/− CCN4 +/+ mice were exposed to AngII for 28 days and aortic sections stained with EVG ( a) . The mean aneurysm grade score was calculated from the aortic segment exhibiting the highest degree of aneurysm (most dilated/diseased section per aorta graded) ( b) . The presence (grey/black bars) and absence (white bars) of vessel wall remodelling on the aorta (presence of fibrous adventitial thickening, as seen in grade 3 example, in any of the sections along the aorta) was noted ( c ). The number of elastin breaks was quantified from the average of 4 thoracic or 4 abdominal aortic segments ( d ). Representative images of EVG stained aortae to illustrate vessel wall remodelling ( e) and elastin breaks ( f) , indicated by arrowheads at both low and high power. g Physical parameters of the average thoracic and abdominal aortic sections. CCN4 +/+ ApoE −/− n = 13 and CCN4 −/− ApoE −/− n = 12, * indicates p < 0.05 compared to CCN4 + / + controls. Mann–Whitney test for aneurysm score, elastin breaks and physical parameters, data is presented as mean ± sem (B and D); Fisher’s Exact test for adventitial thickening (C)

Journal: Journal of Cell Communication and Signaling

Article Title: Aneurysm severity is suppressed by deletion of CCN4

doi: 10.1007/s12079-021-00623-5

Figure Lengend Snippet: CCN4 deletion reduced AAA formation. Aneurysm grade score—representative images of aortic sections stained with EVG and identified as grade 0–4. ApoE −/− CCN4 −/− and ApoE −/− CCN4 +/+ mice were exposed to AngII for 28 days and aortic sections stained with EVG ( a) . The mean aneurysm grade score was calculated from the aortic segment exhibiting the highest degree of aneurysm (most dilated/diseased section per aorta graded) ( b) . The presence (grey/black bars) and absence (white bars) of vessel wall remodelling on the aorta (presence of fibrous adventitial thickening, as seen in grade 3 example, in any of the sections along the aorta) was noted ( c ). The number of elastin breaks was quantified from the average of 4 thoracic or 4 abdominal aortic segments ( d ). Representative images of EVG stained aortae to illustrate vessel wall remodelling ( e) and elastin breaks ( f) , indicated by arrowheads at both low and high power. g Physical parameters of the average thoracic and abdominal aortic sections. CCN4 +/+ ApoE −/− n = 13 and CCN4 −/− ApoE −/− n = 12, * indicates p < 0.05 compared to CCN4 + / + controls. Mann–Whitney test for aneurysm score, elastin breaks and physical parameters, data is presented as mean ± sem (B and D); Fisher’s Exact test for adventitial thickening (C)

Article Snippet: For dual staining sections were first immunostained for apoptosis (Cleaved PARP, Abcam, ab32064, 4.8 μg/ml), proliferation (PCNA, Abcam, 18197, 1 μg/ml) or CCN4 (R&D, AF1680 1 ug/ml) before double staining for VSMCs (α-smooth muscle actin, Sigma, A2547, 3.1 μg/ml) sing the Vector MOM kit (Vector Laboratories BMK-2202).

Techniques: Staining, MANN-WHITNEY

Effect of CCN4 deletion on macrophage and VSMC content, desmin, proliferation and apoptosis markers. ApoE −/− CCN4 −/− and ApoE −/− CCN4 +/+ mice were exposed to AngII for 28 days. Macrophage content was quantified by GSL staining ( a ) and VSMC content was quantified by α-smooth muscle actin immunofluorescence ( b ) in aortic sections. Desmin protein was quantified and as a percentage of the amount of desmin in CCN4 +/+ mice ( c ). Proliferation was quantified by PCNA immunohistochemistry ( d ) and apoptosis was quantified by cleaved PARP immunohistochemistry ( e ) in aortae sections. * indicates p < 0.05 compared to CCN4 +/+ controls, Mann–Whitney test. CCN4 +/+ ApoE −/− n = 13 and CCN4 −/− ApoE −/− n = 12. Positive cells are brown and indicated with arrowheads, except for actin where positive cells are green, in the shown representative images

Journal: Journal of Cell Communication and Signaling

Article Title: Aneurysm severity is suppressed by deletion of CCN4

doi: 10.1007/s12079-021-00623-5

Figure Lengend Snippet: Effect of CCN4 deletion on macrophage and VSMC content, desmin, proliferation and apoptosis markers. ApoE −/− CCN4 −/− and ApoE −/− CCN4 +/+ mice were exposed to AngII for 28 days. Macrophage content was quantified by GSL staining ( a ) and VSMC content was quantified by α-smooth muscle actin immunofluorescence ( b ) in aortic sections. Desmin protein was quantified and as a percentage of the amount of desmin in CCN4 +/+ mice ( c ). Proliferation was quantified by PCNA immunohistochemistry ( d ) and apoptosis was quantified by cleaved PARP immunohistochemistry ( e ) in aortae sections. * indicates p < 0.05 compared to CCN4 +/+ controls, Mann–Whitney test. CCN4 +/+ ApoE −/− n = 13 and CCN4 −/− ApoE −/− n = 12. Positive cells are brown and indicated with arrowheads, except for actin where positive cells are green, in the shown representative images

Article Snippet: For dual staining sections were first immunostained for apoptosis (Cleaved PARP, Abcam, ab32064, 4.8 μg/ml), proliferation (PCNA, Abcam, 18197, 1 μg/ml) or CCN4 (R&D, AF1680 1 ug/ml) before double staining for VSMCs (α-smooth muscle actin, Sigma, A2547, 3.1 μg/ml) sing the Vector MOM kit (Vector Laboratories BMK-2202).

Techniques: Staining, Immunofluorescence, Immunohistochemistry, MANN-WHITNEY

Induction of monocyte adhesion and macrophage migration in vitro by recombinant CCN4 protein. a Monocyte adhesion to endothelial cells was quantified following treatment of HUVECs with recombinant CCN4 protein. Representative images are shown beneath. * indicates p < 0.05 compared to control, Student’s t-test, n = 3. b Monocyte migration was quantified in the presence and absence of recombinant CCN4 protein. Representative images are shown beneath. * indicates p < 0.05 compared to control, one sample t test, n = 4

Journal: Journal of Cell Communication and Signaling

Article Title: Aneurysm severity is suppressed by deletion of CCN4

doi: 10.1007/s12079-021-00623-5

Figure Lengend Snippet: Induction of monocyte adhesion and macrophage migration in vitro by recombinant CCN4 protein. a Monocyte adhesion to endothelial cells was quantified following treatment of HUVECs with recombinant CCN4 protein. Representative images are shown beneath. * indicates p < 0.05 compared to control, Student’s t-test, n = 3. b Monocyte migration was quantified in the presence and absence of recombinant CCN4 protein. Representative images are shown beneath. * indicates p < 0.05 compared to control, one sample t test, n = 4

Article Snippet: For dual staining sections were first immunostained for apoptosis (Cleaved PARP, Abcam, ab32064, 4.8 μg/ml), proliferation (PCNA, Abcam, 18197, 1 μg/ml) or CCN4 (R&D, AF1680 1 ug/ml) before double staining for VSMCs (α-smooth muscle actin, Sigma, A2547, 3.1 μg/ml) sing the Vector MOM kit (Vector Laboratories BMK-2202).

Techniques: Migration, In Vitro, Recombinant

WISP1 expression is increased in melanoma and is associated with reduced overall survival of patients diagnosed with primary melanoma. A, Comparison of WISP1 mRNA expression in benign skin conditions (normal skin and benign melanocytic skin nevus) to primary melanoma. Original expression profiles were from . P-values calculated using ANOVA with post-hoc Tukey HSD test. B, Representative original and deconvoluted color images derived from human normal skin and melanoma tissue microarray probed using a WISP1 antibody (HPA007121) and imaged using 3,3’ diaminobenzidine and stained using hematoxylin for a normal skin (left) and two melanoma (right) tissue samples (original tissue microarray images were obtained from www.proteinatlas.org ) . Deconvoluted intensity of WISP1 staining is shown in red while cellular structures stained using hematoxylin are shown in blue. Arrows indicate melanocytes in epidermis and arrowheads indicate fibroblasts in dermis (stroma). C, The average WISP1 staining within normal skin and primary melanoma tissue samples. D, Distributions in non-zero pixel intensity values of WISP1 staining for normal skin (black curves) and primary melanoma (red curves) tissue samples. Numbers indicate the percentage of the distribution that have normalized pixel intensity values greater than 0.2. E, Kaplan-Meier estimate of overall survival of patients diagnosed with primary melanoma stratified by WISP1 transcript abundance (data from TCGA). Sample numbers and p-values calculated using the Peto & Peto modification of the Gehan-Wilcoxon test are indicated. F, Patient population characteristics of WISP1 high and WISP1 low groups. Statistical differences among categorical data and age were assessed using Fisher’s Exact test and Student’s t-Test, respectively (n.s. indicates p-value > 0.05).

Journal: bioRxiv

Article Title: WNT1 Inducible Signaling Pathway Protein 1 (WISP1) stimulates melanoma cell invasion and metastasis by promoting epithelial – mesenchymal transition

doi: 10.1101/427088

Figure Lengend Snippet: WISP1 expression is increased in melanoma and is associated with reduced overall survival of patients diagnosed with primary melanoma. A, Comparison of WISP1 mRNA expression in benign skin conditions (normal skin and benign melanocytic skin nevus) to primary melanoma. Original expression profiles were from . P-values calculated using ANOVA with post-hoc Tukey HSD test. B, Representative original and deconvoluted color images derived from human normal skin and melanoma tissue microarray probed using a WISP1 antibody (HPA007121) and imaged using 3,3’ diaminobenzidine and stained using hematoxylin for a normal skin (left) and two melanoma (right) tissue samples (original tissue microarray images were obtained from www.proteinatlas.org ) . Deconvoluted intensity of WISP1 staining is shown in red while cellular structures stained using hematoxylin are shown in blue. Arrows indicate melanocytes in epidermis and arrowheads indicate fibroblasts in dermis (stroma). C, The average WISP1 staining within normal skin and primary melanoma tissue samples. D, Distributions in non-zero pixel intensity values of WISP1 staining for normal skin (black curves) and primary melanoma (red curves) tissue samples. Numbers indicate the percentage of the distribution that have normalized pixel intensity values greater than 0.2. E, Kaplan-Meier estimate of overall survival of patients diagnosed with primary melanoma stratified by WISP1 transcript abundance (data from TCGA). Sample numbers and p-values calculated using the Peto & Peto modification of the Gehan-Wilcoxon test are indicated. F, Patient population characteristics of WISP1 high and WISP1 low groups. Statistical differences among categorical data and age were assessed using Fisher’s Exact test and Student’s t-Test, respectively (n.s. indicates p-value > 0.05).

Article Snippet: Recombinant mouse Wisp1 (rmWisp1, 1680-WS-050) was from R&D Systems and used at a final concentration of 5μg/ml following manufacturer’s instructions.

Techniques: Expressing, Comparison, Derivative Assay, Microarray, Staining, Modification

WISP1 knockout in mouse and human melanoma cells inhibited tumor cell migration and invasion. A, 48-hour 2D growth of mouse metastatic melanoma cell line B16F10 and two B16F10 Wisp1-knockout cells (-KO1 and -KO2). B, Anchorage-independent growth assay of B16F10 and the two knockout cells in soft agar. Colonies were fixed and counted after 14 days. A representative staining image for each sample is shown on left, colony counts is plotted on the right. C, Wound healing assay of B16F10 and the two knockout cells. Scratches were created on 6-well plates in biological triplicate and the healing rate was calculated after 24 hours. D, Boyden transwell migration assay of B16F10 and the two knockout cells. A representative staining image for each sample is shown on left, relative migration efficiency is graphed on the right. E, Boyden transwell invasion assay of B16F10 and the two knockout cells. F, Boyden transwell invasion assay of human metastatic melanoma cell line RPMI-7951 and its two Wisp1-knockout cells (-KO1 and -KO2). G, Transwell migration assay of B16F10 and its knockout cell (-KO1) using conditioned media with different concentration of Wisp1 as chemoattractant. B16F10 migrated cells with conditioned medium from NIH3T3-Babe were set up as 100% of relative migration efficiency and compared with other cells. H, Transwell invasion assay of B16F10 and the two knockout cells using conditioned media with different concentration of Wisp1 as chemoattractant. B16F10 invaded cells with conditioned medium from NIH3T3-Babe were set up as 100% of relative invasion efficiency and compared with other cells. Statistical significance was determined by Student’s t test, where a p-value < 0.05 was considered significant and asterisks was used to indicate calculated range in p-values. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; and ns: not significant.

Journal: bioRxiv

Article Title: WNT1 Inducible Signaling Pathway Protein 1 (WISP1) stimulates melanoma cell invasion and metastasis by promoting epithelial – mesenchymal transition

doi: 10.1101/427088

Figure Lengend Snippet: WISP1 knockout in mouse and human melanoma cells inhibited tumor cell migration and invasion. A, 48-hour 2D growth of mouse metastatic melanoma cell line B16F10 and two B16F10 Wisp1-knockout cells (-KO1 and -KO2). B, Anchorage-independent growth assay of B16F10 and the two knockout cells in soft agar. Colonies were fixed and counted after 14 days. A representative staining image for each sample is shown on left, colony counts is plotted on the right. C, Wound healing assay of B16F10 and the two knockout cells. Scratches were created on 6-well plates in biological triplicate and the healing rate was calculated after 24 hours. D, Boyden transwell migration assay of B16F10 and the two knockout cells. A representative staining image for each sample is shown on left, relative migration efficiency is graphed on the right. E, Boyden transwell invasion assay of B16F10 and the two knockout cells. F, Boyden transwell invasion assay of human metastatic melanoma cell line RPMI-7951 and its two Wisp1-knockout cells (-KO1 and -KO2). G, Transwell migration assay of B16F10 and its knockout cell (-KO1) using conditioned media with different concentration of Wisp1 as chemoattractant. B16F10 migrated cells with conditioned medium from NIH3T3-Babe were set up as 100% of relative migration efficiency and compared with other cells. H, Transwell invasion assay of B16F10 and the two knockout cells using conditioned media with different concentration of Wisp1 as chemoattractant. B16F10 invaded cells with conditioned medium from NIH3T3-Babe were set up as 100% of relative invasion efficiency and compared with other cells. Statistical significance was determined by Student’s t test, where a p-value < 0.05 was considered significant and asterisks was used to indicate calculated range in p-values. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; and ns: not significant.

Article Snippet: Recombinant mouse Wisp1 (rmWisp1, 1680-WS-050) was from R&D Systems and used at a final concentration of 5μg/ml following manufacturer’s instructions.

Techniques: Knock-Out, Migration, Growth Assay, Staining, Wound Healing Assay, Transwell Migration Assay, Transwell Invasion Assay, Concentration Assay

Real time genomic qPCR revealed that Wisp1 knockout repressed the spontaneous metastasis of melanoma cell line B16F10 in C57BL/6Ncrl mice. Growth of tumors derived from B16F10 or its knockout cell (-KO2) were monitored following subcutaneous injection in NSG mice (A: B16F10 (n = 5) or WISP1 KO cell (n = 5)) or in C57BL/6Ncrl mice (B: B16F10 (n=6) or WISP1 KO cell (n=6)). After 21 days, remaining C57BL/6crl mice (n = 4 in each group) were euthanized and lungs and livers were assayed for B16F10 tumor cells using real time genomic qPCR, as described in Materials and Methods. (C) Representative lungs and livers from C57BL/6Ncrl mice with B16F10 or knockout cell at day 21. (D) Real time genomic qPCR results showed quantitative tumor lung and liver metastatic burden in spontaneous metastasis assays, n.d., not detected.

Journal: bioRxiv

Article Title: WNT1 Inducible Signaling Pathway Protein 1 (WISP1) stimulates melanoma cell invasion and metastasis by promoting epithelial – mesenchymal transition

doi: 10.1101/427088

Figure Lengend Snippet: Real time genomic qPCR revealed that Wisp1 knockout repressed the spontaneous metastasis of melanoma cell line B16F10 in C57BL/6Ncrl mice. Growth of tumors derived from B16F10 or its knockout cell (-KO2) were monitored following subcutaneous injection in NSG mice (A: B16F10 (n = 5) or WISP1 KO cell (n = 5)) or in C57BL/6Ncrl mice (B: B16F10 (n=6) or WISP1 KO cell (n=6)). After 21 days, remaining C57BL/6crl mice (n = 4 in each group) were euthanized and lungs and livers were assayed for B16F10 tumor cells using real time genomic qPCR, as described in Materials and Methods. (C) Representative lungs and livers from C57BL/6Ncrl mice with B16F10 or knockout cell at day 21. (D) Real time genomic qPCR results showed quantitative tumor lung and liver metastatic burden in spontaneous metastasis assays, n.d., not detected.

Article Snippet: Recombinant mouse Wisp1 (rmWisp1, 1680-WS-050) was from R&D Systems and used at a final concentration of 5μg/ml following manufacturer’s instructions.

Techniques: Knock-Out, Derivative Assay, Injection

Wisp1 knockout repressed the experimental metastasis of melanoma cell line B16F10 in immunodeficient NSG mice and immunocompetent C57BL/6Ncrl mice. Experimental metastasis assays were performed in NSG mice ( A-F ) and C57BL/6Ncrl mice ( G-I ) using B16F10 and indicated knockout cells with injection through mouse tail veins. Each group contained five duplicates (N=5) and three representative images were shown. These experiments were repeated and similar results were achieved. A, Bioluminescence imaging performed one day before NSG mice were euthanized. All animals were compared with the same bioluminescence scale. B-C, Tumor lung metastases (black colonies) of NSG mice as captured by photography ( B ) and real time genomic qPCR ( C ). Quantitative tumor lung metastatic burden was assayed and presented as tumor cell number within 10,000 mouse tissue cells. D-E , Tumor liver metastases (black and white nodules) of NSG mice as captured by photography ( D ) and real time genomic qPCR ( E ). Quantitative tumor liver metastatic burden was assayed and presented as tumor cell number within 10,000 mouse tissue cells. F, Tumor kidney metastases (black colonies) of NSG mice as captured by photography. G, Bioluminescence imaging performed one day before C57BL/6Ncrl mice were euthanized. All animals were compared with the same bioluminescence scale. H-I, Tumor lung metastases of C57BL/6Ncrl mice as captured by photography ( H ) and real time genomic qPCR ( I ). *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001.

Journal: bioRxiv

Article Title: WNT1 Inducible Signaling Pathway Protein 1 (WISP1) stimulates melanoma cell invasion and metastasis by promoting epithelial – mesenchymal transition

doi: 10.1101/427088

Figure Lengend Snippet: Wisp1 knockout repressed the experimental metastasis of melanoma cell line B16F10 in immunodeficient NSG mice and immunocompetent C57BL/6Ncrl mice. Experimental metastasis assays were performed in NSG mice ( A-F ) and C57BL/6Ncrl mice ( G-I ) using B16F10 and indicated knockout cells with injection through mouse tail veins. Each group contained five duplicates (N=5) and three representative images were shown. These experiments were repeated and similar results were achieved. A, Bioluminescence imaging performed one day before NSG mice were euthanized. All animals were compared with the same bioluminescence scale. B-C, Tumor lung metastases (black colonies) of NSG mice as captured by photography ( B ) and real time genomic qPCR ( C ). Quantitative tumor lung metastatic burden was assayed and presented as tumor cell number within 10,000 mouse tissue cells. D-E , Tumor liver metastases (black and white nodules) of NSG mice as captured by photography ( D ) and real time genomic qPCR ( E ). Quantitative tumor liver metastatic burden was assayed and presented as tumor cell number within 10,000 mouse tissue cells. F, Tumor kidney metastases (black colonies) of NSG mice as captured by photography. G, Bioluminescence imaging performed one day before C57BL/6Ncrl mice were euthanized. All animals were compared with the same bioluminescence scale. H-I, Tumor lung metastases of C57BL/6Ncrl mice as captured by photography ( H ) and real time genomic qPCR ( I ). *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001.

Article Snippet: Recombinant mouse Wisp1 (rmWisp1, 1680-WS-050) was from R&D Systems and used at a final concentration of 5μg/ml following manufacturer’s instructions.

Techniques: Knock-Out, Injection, Imaging

Wisp1 knockout repressed the experimental metastasis of melanoma cell line YUMM1.7 in NSG and C57BL/6Ncrl mice. Experimental metastasis assays were performed in NSG ( A-D ) and C57BL/6Ncrl ( E-H ) mice using YUMM1.7 and indicated knockout cells with injection through mouse tail veins. Each group contained five duplicates (N=5) and two representative images were shown. A, Bioluminescence imaging performed one day before NSG mice were euthanized. All animals were compared with the same bioluminescence scale. B, Tumor lung metastases (white nodules) of NSG mice as captured by photography. C, Real time genomic qPCR quantitatively comparing tumor lung metastatic burdens (tumor cell number within 10,000 mouse tissue cells). D, The whole-body metastasis of tumor cells in NSG mice were plotted and compared using bioluminescence intensity detected in panel (A). Total flux is presented as photon/second (p/s). E, Bioluminescence imaging performed one day before C57BL/6Ncrl mice were euthanized. All animals were compared with the same bioluminescence scale. F, Tumor lung metastases (white nodules) of C57BL/6Ncrl mice as captured by photography. G, Real time genomic qPCR quantitatively comparing tumor lung metastatic burdens. H, The whole-body metastasis of tumor cells in C57BL/6Ncrl mice were plotted and compared using bioluminescence intensity detected in panel (E). *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001.

Journal: bioRxiv

Article Title: WNT1 Inducible Signaling Pathway Protein 1 (WISP1) stimulates melanoma cell invasion and metastasis by promoting epithelial – mesenchymal transition

doi: 10.1101/427088

Figure Lengend Snippet: Wisp1 knockout repressed the experimental metastasis of melanoma cell line YUMM1.7 in NSG and C57BL/6Ncrl mice. Experimental metastasis assays were performed in NSG ( A-D ) and C57BL/6Ncrl ( E-H ) mice using YUMM1.7 and indicated knockout cells with injection through mouse tail veins. Each group contained five duplicates (N=5) and two representative images were shown. A, Bioluminescence imaging performed one day before NSG mice were euthanized. All animals were compared with the same bioluminescence scale. B, Tumor lung metastases (white nodules) of NSG mice as captured by photography. C, Real time genomic qPCR quantitatively comparing tumor lung metastatic burdens (tumor cell number within 10,000 mouse tissue cells). D, The whole-body metastasis of tumor cells in NSG mice were plotted and compared using bioluminescence intensity detected in panel (A). Total flux is presented as photon/second (p/s). E, Bioluminescence imaging performed one day before C57BL/6Ncrl mice were euthanized. All animals were compared with the same bioluminescence scale. F, Tumor lung metastases (white nodules) of C57BL/6Ncrl mice as captured by photography. G, Real time genomic qPCR quantitatively comparing tumor lung metastatic burdens. H, The whole-body metastasis of tumor cells in C57BL/6Ncrl mice were plotted and compared using bioluminescence intensity detected in panel (E). *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001.

Article Snippet: Recombinant mouse Wisp1 (rmWisp1, 1680-WS-050) was from R&D Systems and used at a final concentration of 5μg/ml following manufacturer’s instructions.

Techniques: Knock-Out, Injection, Imaging

WISP1 induced an EMT gene signature in mouse/human melanoma cells. Unless otherwise specified, all cells were plated on 6-well plates in complete growth medium for 48 hours before harvested for RNA analysis or treated with indicated conditioned medium or recombinant protein. A, mRNA expression, revealed by real-time quantitative RT-PCR, of select EMT marker genes and Mitf in uninvaded and invaded B16F10 cells from Boyden transwell invasion assay. B, Immunoblot analysis of Wisp1 protein to confirm the disruption of Wisp1 gene in B16F10 and YUMM1.7 knockout cells. 20μg of whole cells lysate was load in each lane and P-actin was used as internal loading control. B16F10-KO1-mWisp1 cell, in which mouse Wisp1 expression was resumed with retroviral transduction, was used as a positive control. C, Immunoblot analysis of certain EMT marker proteins in B16F10 and YUMM1.7 knockout cells. 20μg of whole cells lysate was load in each lane and all cells were compared on the same gel to reveal the relative intensity of each protein. D, Comparison of EMT marker gene expression in mouse melanoma B16F10 and its two Wisp1-knockout cells (-KO1 and -KO2). E Comparison of EMT marker gene expression in mouse melanoma YUMM1.7 and its two Wisp1-knockout cells (-KO1 and - KO2). F, Comparison of EMT marker gene expression in human melanoma RPMI-7951 and its two Wisp1-knockout cells (-KO1 and -KO2). G, Stimulation of EMT marker gene expression with recombinant mouse Wisp1 protein (rmWisp1). B16F10-KO1 cells were treated with rmWisp1 (final 5μg/ml) and harvested at indicated time point for real-time quantitative RT-PCR analysis. H, Stimulation of EMT marker gene expression with Wisp1-overexpressed or Wisp1-immunodepleted conditioned medium. The conditioned media were pre-treated with indicated antibodies for 30 minutes before used on Wisp1-knockout B16F10 cells (-KO1). The cells were collected for real-time qRT-PCR after 3 hour treatment. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; ns: not significant.

Journal: bioRxiv

Article Title: WNT1 Inducible Signaling Pathway Protein 1 (WISP1) stimulates melanoma cell invasion and metastasis by promoting epithelial – mesenchymal transition

doi: 10.1101/427088

Figure Lengend Snippet: WISP1 induced an EMT gene signature in mouse/human melanoma cells. Unless otherwise specified, all cells were plated on 6-well plates in complete growth medium for 48 hours before harvested for RNA analysis or treated with indicated conditioned medium or recombinant protein. A, mRNA expression, revealed by real-time quantitative RT-PCR, of select EMT marker genes and Mitf in uninvaded and invaded B16F10 cells from Boyden transwell invasion assay. B, Immunoblot analysis of Wisp1 protein to confirm the disruption of Wisp1 gene in B16F10 and YUMM1.7 knockout cells. 20μg of whole cells lysate was load in each lane and P-actin was used as internal loading control. B16F10-KO1-mWisp1 cell, in which mouse Wisp1 expression was resumed with retroviral transduction, was used as a positive control. C, Immunoblot analysis of certain EMT marker proteins in B16F10 and YUMM1.7 knockout cells. 20μg of whole cells lysate was load in each lane and all cells were compared on the same gel to reveal the relative intensity of each protein. D, Comparison of EMT marker gene expression in mouse melanoma B16F10 and its two Wisp1-knockout cells (-KO1 and -KO2). E Comparison of EMT marker gene expression in mouse melanoma YUMM1.7 and its two Wisp1-knockout cells (-KO1 and - KO2). F, Comparison of EMT marker gene expression in human melanoma RPMI-7951 and its two Wisp1-knockout cells (-KO1 and -KO2). G, Stimulation of EMT marker gene expression with recombinant mouse Wisp1 protein (rmWisp1). B16F10-KO1 cells were treated with rmWisp1 (final 5μg/ml) and harvested at indicated time point for real-time quantitative RT-PCR analysis. H, Stimulation of EMT marker gene expression with Wisp1-overexpressed or Wisp1-immunodepleted conditioned medium. The conditioned media were pre-treated with indicated antibodies for 30 minutes before used on Wisp1-knockout B16F10 cells (-KO1). The cells were collected for real-time qRT-PCR after 3 hour treatment. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; ns: not significant.

Article Snippet: Recombinant mouse Wisp1 (rmWisp1, 1680-WS-050) was from R&D Systems and used at a final concentration of 5μg/ml following manufacturer’s instructions.

Techniques: Recombinant, Expressing, Quantitative RT-PCR, Marker, Transwell Invasion Assay, Western Blot, Disruption, Knock-Out, Transduction, Positive Control, Comparison

Snai1 overexpression in B16F10 Wisp1-knockout cell rescued the repression on tumor invasion in vitro and metastasis in vivo. A, Immunoblot analysis of Wisp1 and Snai1 using B16F10-KO1 cell that were transduced with retroviral vector control (-pBabe), or retrovirus expressing either mouse Wisp1 (-mWisp1) or human Snai1 (-hSnai1). B, Comparison of EMT marker gene expression after overexpression of Snai1 or reintroduction of Wisp1 in B16F10-KO1 cells. Cells were plated on 6-well plates in complete growth medium for 48 hours before harvested for RNA analysis. C, Boyden transwell invasion assay after overexpression of Snai1 or reintroduction of Wisp1 in B16F10-KO1 cells. A representative staining image for each sample is shown on left, relative invasion efficiency is graphed on the right. D, Experimental metastasis assay in NSG mice using indicated cells. Each group contained 3-4 mice. All mice were imaged one day before the end of the assay and representative bioluminescence images were shown. E, Representative lung and liver images from NSG mice in experimental metastasis assay described in panel ( D ). Metastatic tumor colonies on lung surface from mice with (-mWisp1) or (-hSnai1) cells were pointed by arrows. F, Real time genomic qPCR for lungs and livers from experimental metastasis assay in panel ( D ). The quantitative tumor metastatic burdens were presented as tumor cell number within 10,000 mouse tissue cells. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; ns: not significant.

Journal: bioRxiv

Article Title: WNT1 Inducible Signaling Pathway Protein 1 (WISP1) stimulates melanoma cell invasion and metastasis by promoting epithelial – mesenchymal transition

doi: 10.1101/427088

Figure Lengend Snippet: Snai1 overexpression in B16F10 Wisp1-knockout cell rescued the repression on tumor invasion in vitro and metastasis in vivo. A, Immunoblot analysis of Wisp1 and Snai1 using B16F10-KO1 cell that were transduced with retroviral vector control (-pBabe), or retrovirus expressing either mouse Wisp1 (-mWisp1) or human Snai1 (-hSnai1). B, Comparison of EMT marker gene expression after overexpression of Snai1 or reintroduction of Wisp1 in B16F10-KO1 cells. Cells were plated on 6-well plates in complete growth medium for 48 hours before harvested for RNA analysis. C, Boyden transwell invasion assay after overexpression of Snai1 or reintroduction of Wisp1 in B16F10-KO1 cells. A representative staining image for each sample is shown on left, relative invasion efficiency is graphed on the right. D, Experimental metastasis assay in NSG mice using indicated cells. Each group contained 3-4 mice. All mice were imaged one day before the end of the assay and representative bioluminescence images were shown. E, Representative lung and liver images from NSG mice in experimental metastasis assay described in panel ( D ). Metastatic tumor colonies on lung surface from mice with (-mWisp1) or (-hSnai1) cells were pointed by arrows. F, Real time genomic qPCR for lungs and livers from experimental metastasis assay in panel ( D ). The quantitative tumor metastatic burdens were presented as tumor cell number within 10,000 mouse tissue cells. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; ns: not significant.

Article Snippet: Recombinant mouse Wisp1 (rmWisp1, 1680-WS-050) was from R&D Systems and used at a final concentration of 5μg/ml following manufacturer’s instructions.

Techniques: Over Expression, Knock-Out, In Vitro, In Vivo, Western Blot, Transduction, Plasmid Preparation, Expressing, Comparison, Marker, Transwell Invasion Assay, Staining

Wisp1 activated Akt/MAPK signaling and promoted EMT marker gene expression in mouse melanoma cells. Unless otherwise specified, cell treatment for kinase immunoblot analysis maintained for 30 minutes before cells were lysed for protein extraction while cells were treated for 3 hours prior to RNA extraction for comparing EMT marker gene expression. A, EMT marker gene expression after inhibiting Akt and/or MAPK signaling in B16F10 cells. Cells were treated with specific phospho-Akt inhibitor MK-2206 and/or phospho-MAPK inhibitor U0126. Immunoblot for phospho-Akt and phospho-Erk1/2 inhibition was shown on the right upper corner. Pan-Akt and total Erk1/2 were also probed as loading control. B, EMT marker gene expression after inhibiting Akt and/or MAPK signaling in YUMM1.7 cells, with DMSO as control. C, Immunoblot for phospho-Akt and phospho-Erk1/2 in indicated mouse melanoma cells with treatment of recombinant mouse Wisp1 protein (rmWisp1, final 5μg/ml). Cells grown on 6-well plates in complete DMEM for 48 hours and serum-free DMEM (SFM) for another 48 hours before rmWISP1 was added. Pan-Akt and total Erk1/2 were probed as loading control. D, Immunoblot analysis of Akt/MAPK activation in B16F10 knockout cell (-KO1) by rmWisp1 under different basal phospho-kinase levels. All cells were grown on 6-well plates in complete DMEM for 48 hours (0 hour point for SFM) and switched to SFM for 24 hour or 48 hours. Indicated cells were treated with rmWisp1 for 30 minutes following 0, 24, or 48 hours in SFM before analyzed for kinase activation. The first lane loaded with YUMM 1.7 at 0 hour to compare the relative kinase level between B16F10 and YUMM1.7 cells. E, Immunoblot for Akt/MAPK activation in YUMM1.7 knockout cell (-KO1) by rmWisp1 under different basal phospho-kinase levels. All cells were treated similarly as described in panel (D). The first lane loaded with B16F10 at 0 hour to compare the relative kinase level between B16F10 and YUMM1.7 cells. F Snai1 activation and E-cadherin repression in B16F10 knockout cell (-KO1) by rmWisp1 under different basal phospho-kinase levels. All cells were treated similarly as described in panel (D) except that rmWisp1 treatment at each point maintained for 3 hours. G-H, EMT marker gene expression after Akt/MAPK activation in B16F10-KO1 (G) or YUMM1.7-KO1 (H) by rmWisp1 was blocked by Akt/MAPK inhibitors. rmWisp1 with DMSO or inhibitors was added after indicated cells were grown on 6-well plates in complete DMEM for 48 hours and in SFM for 24 hours. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; ns: not significant.

Journal: bioRxiv

Article Title: WNT1 Inducible Signaling Pathway Protein 1 (WISP1) stimulates melanoma cell invasion and metastasis by promoting epithelial – mesenchymal transition

doi: 10.1101/427088

Figure Lengend Snippet: Wisp1 activated Akt/MAPK signaling and promoted EMT marker gene expression in mouse melanoma cells. Unless otherwise specified, cell treatment for kinase immunoblot analysis maintained for 30 minutes before cells were lysed for protein extraction while cells were treated for 3 hours prior to RNA extraction for comparing EMT marker gene expression. A, EMT marker gene expression after inhibiting Akt and/or MAPK signaling in B16F10 cells. Cells were treated with specific phospho-Akt inhibitor MK-2206 and/or phospho-MAPK inhibitor U0126. Immunoblot for phospho-Akt and phospho-Erk1/2 inhibition was shown on the right upper corner. Pan-Akt and total Erk1/2 were also probed as loading control. B, EMT marker gene expression after inhibiting Akt and/or MAPK signaling in YUMM1.7 cells, with DMSO as control. C, Immunoblot for phospho-Akt and phospho-Erk1/2 in indicated mouse melanoma cells with treatment of recombinant mouse Wisp1 protein (rmWisp1, final 5μg/ml). Cells grown on 6-well plates in complete DMEM for 48 hours and serum-free DMEM (SFM) for another 48 hours before rmWISP1 was added. Pan-Akt and total Erk1/2 were probed as loading control. D, Immunoblot analysis of Akt/MAPK activation in B16F10 knockout cell (-KO1) by rmWisp1 under different basal phospho-kinase levels. All cells were grown on 6-well plates in complete DMEM for 48 hours (0 hour point for SFM) and switched to SFM for 24 hour or 48 hours. Indicated cells were treated with rmWisp1 for 30 minutes following 0, 24, or 48 hours in SFM before analyzed for kinase activation. The first lane loaded with YUMM 1.7 at 0 hour to compare the relative kinase level between B16F10 and YUMM1.7 cells. E, Immunoblot for Akt/MAPK activation in YUMM1.7 knockout cell (-KO1) by rmWisp1 under different basal phospho-kinase levels. All cells were treated similarly as described in panel (D). The first lane loaded with B16F10 at 0 hour to compare the relative kinase level between B16F10 and YUMM1.7 cells. F Snai1 activation and E-cadherin repression in B16F10 knockout cell (-KO1) by rmWisp1 under different basal phospho-kinase levels. All cells were treated similarly as described in panel (D) except that rmWisp1 treatment at each point maintained for 3 hours. G-H, EMT marker gene expression after Akt/MAPK activation in B16F10-KO1 (G) or YUMM1.7-KO1 (H) by rmWisp1 was blocked by Akt/MAPK inhibitors. rmWisp1 with DMSO or inhibitors was added after indicated cells were grown on 6-well plates in complete DMEM for 48 hours and in SFM for 24 hours. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; ns: not significant.

Article Snippet: Recombinant mouse Wisp1 (rmWisp1, 1680-WS-050) was from R&D Systems and used at a final concentration of 5μg/ml following manufacturer’s instructions.

Techniques: Marker, Expressing, Western Blot, Protein Extraction, RNA Extraction, Inhibition, Recombinant, Activation Assay, Knock-Out

WISP1 knockout in mouse and human melanoma cells inhibited tumor cell migration and invasion. A, 48-hour 2D growth of mouse metastatic melanoma cell line B16F10 and two B16F10 Wisp1-knockout cells (-KO1 and -KO2). B, Anchorage-independent growth assay of B16F10 and the two knockout cells in soft agar. Colonies were fixed and counted after 14 days. A representative staining image for each sample is shown on left, colony counts is plotted on the right. C, Wound healing assay of B16F10 and the two knockout cells. Scratches were created on 6-well plates in biological triplicate and the healing rate was calculated after 24 hours. D, Boyden transwell migration assay of B16F10 and the two knockout cells. A representative staining image for each sample is shown on left, relative migration efficiency is graphed on the right. E, Boyden transwell invasion assay of B16F10 and the two knockout cells. F, Boyden transwell invasion assay of human metastatic melanoma cell line RPMI-7951 and its two Wisp1-knockout cells (-KO1 and -KO2). G, Transwell migration assay of B16F10 and its knockout cell (-KO1) using conditioned media with different concentration of Wisp1 as chemoattractant. B16F10 migrated cells with conditioned medium from NIH3T3-Babe were set up as 100% of relative migration efficiency and compared with other cells. H, Transwell invasion assay of B16F10 and the two knockout cells using conditioned media with different concentration of Wisp1 as chemoattractant. B16F10 invaded cells with conditioned medium from NIH3T3-Babe were set up as 100% of relative invasion efficiency and compared with other cells. Statistical significance was determined by Student’s t test, where a p-value < 0.05 was considered significant and asterisks was used to indicate calculated range in p-values. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; and ns: not significant.

Journal: bioRxiv

Article Title: WNT1 Inducible Signaling Pathway Protein 1 (WISP1) stimulates melanoma cell invasion and metastasis by promoting epithelial – mesenchymal transition

doi: 10.1101/427088

Figure Lengend Snippet: WISP1 knockout in mouse and human melanoma cells inhibited tumor cell migration and invasion. A, 48-hour 2D growth of mouse metastatic melanoma cell line B16F10 and two B16F10 Wisp1-knockout cells (-KO1 and -KO2). B, Anchorage-independent growth assay of B16F10 and the two knockout cells in soft agar. Colonies were fixed and counted after 14 days. A representative staining image for each sample is shown on left, colony counts is plotted on the right. C, Wound healing assay of B16F10 and the two knockout cells. Scratches were created on 6-well plates in biological triplicate and the healing rate was calculated after 24 hours. D, Boyden transwell migration assay of B16F10 and the two knockout cells. A representative staining image for each sample is shown on left, relative migration efficiency is graphed on the right. E, Boyden transwell invasion assay of B16F10 and the two knockout cells. F, Boyden transwell invasion assay of human metastatic melanoma cell line RPMI-7951 and its two Wisp1-knockout cells (-KO1 and -KO2). G, Transwell migration assay of B16F10 and its knockout cell (-KO1) using conditioned media with different concentration of Wisp1 as chemoattractant. B16F10 migrated cells with conditioned medium from NIH3T3-Babe were set up as 100% of relative migration efficiency and compared with other cells. H, Transwell invasion assay of B16F10 and the two knockout cells using conditioned media with different concentration of Wisp1 as chemoattractant. B16F10 invaded cells with conditioned medium from NIH3T3-Babe were set up as 100% of relative invasion efficiency and compared with other cells. Statistical significance was determined by Student’s t test, where a p-value < 0.05 was considered significant and asterisks was used to indicate calculated range in p-values. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; and ns: not significant.

Article Snippet: The third group was conditioned media from Wisp1-overexpressed NIH3T3-mWisp1, with rat anti-Wisp1 (MAB1680, R&D Systems) at a final concentration of 20μg/ml.

Techniques: Knock-Out, Migration, Growth Assay, Staining, Wound Healing Assay, Transwell Migration Assay, Transwell Invasion Assay, Concentration Assay

WISP1 induced an EMT gene signature in mouse/human melanoma cells. Unless otherwise specified, all cells were plated on 6-well plates in complete growth medium for 48 hours before harvested for RNA analysis or treated with indicated conditioned medium or recombinant protein. A, mRNA expression, revealed by real-time quantitative RT-PCR, of select EMT marker genes and Mitf in uninvaded and invaded B16F10 cells from Boyden transwell invasion assay. B, Immunoblot analysis of Wisp1 protein to confirm the disruption of Wisp1 gene in B16F10 and YUMM1.7 knockout cells. 20μg of whole cells lysate was load in each lane and P-actin was used as internal loading control. B16F10-KO1-mWisp1 cell, in which mouse Wisp1 expression was resumed with retroviral transduction, was used as a positive control. C, Immunoblot analysis of certain EMT marker proteins in B16F10 and YUMM1.7 knockout cells. 20μg of whole cells lysate was load in each lane and all cells were compared on the same gel to reveal the relative intensity of each protein. D, Comparison of EMT marker gene expression in mouse melanoma B16F10 and its two Wisp1-knockout cells (-KO1 and -KO2). E Comparison of EMT marker gene expression in mouse melanoma YUMM1.7 and its two Wisp1-knockout cells (-KO1 and - KO2). F, Comparison of EMT marker gene expression in human melanoma RPMI-7951 and its two Wisp1-knockout cells (-KO1 and -KO2). G, Stimulation of EMT marker gene expression with recombinant mouse Wisp1 protein (rmWisp1). B16F10-KO1 cells were treated with rmWisp1 (final 5μg/ml) and harvested at indicated time point for real-time quantitative RT-PCR analysis. H, Stimulation of EMT marker gene expression with Wisp1-overexpressed or Wisp1-immunodepleted conditioned medium. The conditioned media were pre-treated with indicated antibodies for 30 minutes before used on Wisp1-knockout B16F10 cells (-KO1). The cells were collected for real-time qRT-PCR after 3 hour treatment. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; ns: not significant.

Journal: bioRxiv

Article Title: WNT1 Inducible Signaling Pathway Protein 1 (WISP1) stimulates melanoma cell invasion and metastasis by promoting epithelial – mesenchymal transition

doi: 10.1101/427088

Figure Lengend Snippet: WISP1 induced an EMT gene signature in mouse/human melanoma cells. Unless otherwise specified, all cells were plated on 6-well plates in complete growth medium for 48 hours before harvested for RNA analysis or treated with indicated conditioned medium or recombinant protein. A, mRNA expression, revealed by real-time quantitative RT-PCR, of select EMT marker genes and Mitf in uninvaded and invaded B16F10 cells from Boyden transwell invasion assay. B, Immunoblot analysis of Wisp1 protein to confirm the disruption of Wisp1 gene in B16F10 and YUMM1.7 knockout cells. 20μg of whole cells lysate was load in each lane and P-actin was used as internal loading control. B16F10-KO1-mWisp1 cell, in which mouse Wisp1 expression was resumed with retroviral transduction, was used as a positive control. C, Immunoblot analysis of certain EMT marker proteins in B16F10 and YUMM1.7 knockout cells. 20μg of whole cells lysate was load in each lane and all cells were compared on the same gel to reveal the relative intensity of each protein. D, Comparison of EMT marker gene expression in mouse melanoma B16F10 and its two Wisp1-knockout cells (-KO1 and -KO2). E Comparison of EMT marker gene expression in mouse melanoma YUMM1.7 and its two Wisp1-knockout cells (-KO1 and - KO2). F, Comparison of EMT marker gene expression in human melanoma RPMI-7951 and its two Wisp1-knockout cells (-KO1 and -KO2). G, Stimulation of EMT marker gene expression with recombinant mouse Wisp1 protein (rmWisp1). B16F10-KO1 cells were treated with rmWisp1 (final 5μg/ml) and harvested at indicated time point for real-time quantitative RT-PCR analysis. H, Stimulation of EMT marker gene expression with Wisp1-overexpressed or Wisp1-immunodepleted conditioned medium. The conditioned media were pre-treated with indicated antibodies for 30 minutes before used on Wisp1-knockout B16F10 cells (-KO1). The cells were collected for real-time qRT-PCR after 3 hour treatment. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; ns: not significant.

Article Snippet: The third group was conditioned media from Wisp1-overexpressed NIH3T3-mWisp1, with rat anti-Wisp1 (MAB1680, R&D Systems) at a final concentration of 20μg/ml.

Techniques: Recombinant, Expressing, Quantitative RT-PCR, Marker, Transwell Invasion Assay, Western Blot, Disruption, Knock-Out, Transduction, Positive Control, Comparison

Snai1 overexpression in B16F10 Wisp1-knockout cell rescued the repression on tumor invasion in vitro and metastasis in vivo. A, Immunoblot analysis of Wisp1 and Snai1 using B16F10-KO1 cell that were transduced with retroviral vector control (-pBabe), or retrovirus expressing either mouse Wisp1 (-mWisp1) or human Snai1 (-hSnai1). B, Comparison of EMT marker gene expression after overexpression of Snai1 or reintroduction of Wisp1 in B16F10-KO1 cells. Cells were plated on 6-well plates in complete growth medium for 48 hours before harvested for RNA analysis. C, Boyden transwell invasion assay after overexpression of Snai1 or reintroduction of Wisp1 in B16F10-KO1 cells. A representative staining image for each sample is shown on left, relative invasion efficiency is graphed on the right. D, Experimental metastasis assay in NSG mice using indicated cells. Each group contained 3-4 mice. All mice were imaged one day before the end of the assay and representative bioluminescence images were shown. E, Representative lung and liver images from NSG mice in experimental metastasis assay described in panel ( D ). Metastatic tumor colonies on lung surface from mice with (-mWisp1) or (-hSnai1) cells were pointed by arrows. F, Real time genomic qPCR for lungs and livers from experimental metastasis assay in panel ( D ). The quantitative tumor metastatic burdens were presented as tumor cell number within 10,000 mouse tissue cells. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; ns: not significant.

Journal: bioRxiv

Article Title: WNT1 Inducible Signaling Pathway Protein 1 (WISP1) stimulates melanoma cell invasion and metastasis by promoting epithelial – mesenchymal transition

doi: 10.1101/427088

Figure Lengend Snippet: Snai1 overexpression in B16F10 Wisp1-knockout cell rescued the repression on tumor invasion in vitro and metastasis in vivo. A, Immunoblot analysis of Wisp1 and Snai1 using B16F10-KO1 cell that were transduced with retroviral vector control (-pBabe), or retrovirus expressing either mouse Wisp1 (-mWisp1) or human Snai1 (-hSnai1). B, Comparison of EMT marker gene expression after overexpression of Snai1 or reintroduction of Wisp1 in B16F10-KO1 cells. Cells were plated on 6-well plates in complete growth medium for 48 hours before harvested for RNA analysis. C, Boyden transwell invasion assay after overexpression of Snai1 or reintroduction of Wisp1 in B16F10-KO1 cells. A representative staining image for each sample is shown on left, relative invasion efficiency is graphed on the right. D, Experimental metastasis assay in NSG mice using indicated cells. Each group contained 3-4 mice. All mice were imaged one day before the end of the assay and representative bioluminescence images were shown. E, Representative lung and liver images from NSG mice in experimental metastasis assay described in panel ( D ). Metastatic tumor colonies on lung surface from mice with (-mWisp1) or (-hSnai1) cells were pointed by arrows. F, Real time genomic qPCR for lungs and livers from experimental metastasis assay in panel ( D ). The quantitative tumor metastatic burdens were presented as tumor cell number within 10,000 mouse tissue cells. *: p-value < 0.05; **: p-value < 0.01; ***: p-value < 0.001; ns: not significant.

Article Snippet: The third group was conditioned media from Wisp1-overexpressed NIH3T3-mWisp1, with rat anti-Wisp1 (MAB1680, R&D Systems) at a final concentration of 20μg/ml.

Techniques: Over Expression, Knock-Out, In Vitro, In Vivo, Western Blot, Transduction, Plasmid Preparation, Expressing, Comparison, Marker, Transwell Invasion Assay, Staining

ELISA analysis of secreted biomarkers. SB525334, nintedanib, and sorafenib suppressed secretion of hyaluronic acid (HA), insulin-like growth factor binding protein 5 (IGFBP5), and WNT1-inducible signaling pathway protein 1 (WISP1) in the conditioned medium after 48 h of incubation. Data are means ± SE; n = 3 rats for both sham and bile duct ligation (BDL); n = 8–10 liver slices for each condition. **P < 0.01 and ***P < 0.001.

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Molecular characterization of a precision-cut rat liver slice model for the evaluation of antifibrotic compounds

doi: 10.1152/ajpgi.00281.2018

Figure Lengend Snippet: ELISA analysis of secreted biomarkers. SB525334, nintedanib, and sorafenib suppressed secretion of hyaluronic acid (HA), insulin-like growth factor binding protein 5 (IGFBP5), and WNT1-inducible signaling pathway protein 1 (WISP1) in the conditioned medium after 48 h of incubation. Data are means ± SE; n = 3 rats for both sham and bile duct ligation (BDL); n = 8–10 liver slices for each condition. **P < 0.01 and ***P < 0.001.

Article Snippet: Secreted biomarkers including procollagen I, HA, IGFBP5, and WISP1 in the conditioned medium were measured using procollagen I ( {"type":"entrez-nucleotide","attrs":{"text":"Ab210579","term_id":"70570352","term_text":"AB210579"}} Ab210579 ; Abcam, Cambridge, UK), hyaluronan quantikine (DHYAL0; R&D Systems, Minneapolis, MN), IGFBP5 ( {"type":"entrez-nucleotide","attrs":{"text":"Ab208345","term_id":"76667415","term_text":"AB208345"}} Ab208345 ; Abcam), and WISP1 quantikine (MWSP10; R&D Systems) ELISA kits following manufacturer's instructions.

Techniques: Enzyme-linked Immunosorbent Assay, Binding Assay, Incubation, Ligation

The small molecule αV integrins inhibitor CWHM12 attenuated fibrotic phenotype in fibrotic precision-cut liver tissue slices (PCLSs) after 48 h of incubation. A: CWHM12 suppressed expression of a panel of fibrotic genes. B: CWHM12 decreased secretion of procollagen I, hyaluronic acid (HA), insulin-like growth factor binding protein 5 (IGFBP5), and WNT1-inducible signaling pathway protein 1 (WISP1) in the conditioned medium. Data are means ± SE; n = 3 rats for both sham and bile duct ligation (BDL); n = 6–8 liver slices for each condition. *P < 0.05, **P < 0.01, ***P < 0.001.

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Molecular characterization of a precision-cut rat liver slice model for the evaluation of antifibrotic compounds

doi: 10.1152/ajpgi.00281.2018

Figure Lengend Snippet: The small molecule αV integrins inhibitor CWHM12 attenuated fibrotic phenotype in fibrotic precision-cut liver tissue slices (PCLSs) after 48 h of incubation. A: CWHM12 suppressed expression of a panel of fibrotic genes. B: CWHM12 decreased secretion of procollagen I, hyaluronic acid (HA), insulin-like growth factor binding protein 5 (IGFBP5), and WNT1-inducible signaling pathway protein 1 (WISP1) in the conditioned medium. Data are means ± SE; n = 3 rats for both sham and bile duct ligation (BDL); n = 6–8 liver slices for each condition. *P < 0.05, **P < 0.01, ***P < 0.001.

Article Snippet: Secreted biomarkers including procollagen I, HA, IGFBP5, and WISP1 in the conditioned medium were measured using procollagen I ( {"type":"entrez-nucleotide","attrs":{"text":"Ab210579","term_id":"70570352","term_text":"AB210579"}} Ab210579 ; Abcam, Cambridge, UK), hyaluronan quantikine (DHYAL0; R&D Systems, Minneapolis, MN), IGFBP5 ( {"type":"entrez-nucleotide","attrs":{"text":"Ab208345","term_id":"76667415","term_text":"AB208345"}} Ab208345 ; Abcam), and WISP1 quantikine (MWSP10; R&D Systems) ELISA kits following manufacturer's instructions.

Techniques: Incubation, Expressing, Binding Assay, Ligation

Stepwise linear regression analysis of association between  WISP-1/CCN4  levels and metabolic parameters

Journal: Journal of Cell Communication and Signaling

Article Title: Assessment of circulating Wnt1 inducible signalling pathway protein 1 (WISP-1)/CCN4 as a novel biomarker of obesity

doi: 10.1007/s12079-017-0427-1

Figure Lengend Snippet: Stepwise linear regression analysis of association between WISP-1/CCN4 levels and metabolic parameters

Article Snippet: According to the supplier, the human WISP-1/CCN4 DuoSet ELISA (R&D Systems, Germany) is validated for analysis of WISP-1/CCN4 levels in cell culture supernatants, serum, and plasma samples.

Techniques: Fat

Characteristics of subjects with  WISP-1/CCN4  over and under detection limit

Journal: Journal of Cell Communication and Signaling

Article Title: Assessment of circulating Wnt1 inducible signalling pathway protein 1 (WISP-1)/CCN4 as a novel biomarker of obesity

doi: 10.1007/s12079-017-0427-1

Figure Lengend Snippet: Characteristics of subjects with WISP-1/CCN4 over and under detection limit

Article Snippet: According to the supplier, the human WISP-1/CCN4 DuoSet ELISA (R&D Systems, Germany) is validated for analysis of WISP-1/CCN4 levels in cell culture supernatants, serum, and plasma samples.

Techniques: Fat

(A) WISP-1 levels were measured in supernatants from grid-wounded intestinal epithelial monolayers with and without incubation with hrIL-10 (100 nM) and/or the CREB inhibitor 92-78-4 (inh) for 24 hours (***P < 0.001, n = 3, mean ± SEM). (B) SKCO-15 cells transfected with a WISP1 promoter coupled to luciferase (Luc) with or without the CREB-binding site were treated with TNF-α, IFN-γ, IL-10, or BSA (100 nM) (***P < 0.001, n = 8, mean ± SEM). bs, binding site. (C) Lysates from intact colon and wounds harvested on day 3 from IL-10fl/flCD11c Cre and IL-10fl/fl mice (***P < 0.001 and **P < 0.01, n = 3, mean ± SEM). All statistical comparisons were performed using ANOVA with Tukey’s multiple comparisons post test. inh, inhibitor.

Journal: The Journal of Clinical Investigation

Article Title: Macrophage-derived IL-10 mediates mucosal repair by epithelial WISP-1 signaling

doi: 10.1172/JCI90229

Figure Lengend Snippet: (A) WISP-1 levels were measured in supernatants from grid-wounded intestinal epithelial monolayers with and without incubation with hrIL-10 (100 nM) and/or the CREB inhibitor 92-78-4 (inh) for 24 hours (***P < 0.001, n = 3, mean ± SEM). (B) SKCO-15 cells transfected with a WISP1 promoter coupled to luciferase (Luc) with or without the CREB-binding site were treated with TNF-α, IFN-γ, IL-10, or BSA (100 nM) (***P < 0.001, n = 8, mean ± SEM). bs, binding site. (C) Lysates from intact colon and wounds harvested on day 3 from IL-10fl/flCD11c Cre and IL-10fl/fl mice (***P < 0.001 and **P < 0.01, n = 3, mean ± SEM). All statistical comparisons were performed using ANOVA with Tukey’s multiple comparisons post test. inh, inhibitor.

Article Snippet: WISP-1 siRNAs (no. 1: GGAGUUUGCAUGGACAAUAGGUGCT; no. 2: ACAUCCAUACACUCAUUAAGGCAGG; no. 3: AGACUAUCGACGUGUCCUUCCAGTG) were purchased from OriGene (catalog SR305836), and IL-10Rα and IL-10β siRNAs (SMARTpool, catalog L-007925-00-0005) were purchased from GE Dharmacon and used for transfection studies with Lipofectamine 2000 (Life Technologies, Thermo Fisher Scientific) according to the manufacturers’ instructions.

Techniques: Incubation, Transfection, Luciferase, Binding Assay

(A) WISP1 mRNA levels were determined in tissue obtained from punch biopsies of intact colon (IT) and wounded colonic mucosa on post-injury days 1, 2, and 3 (***P < 0.001 and *P < 0.05, n = 3, mean ± SEM). (B) Laser confocal micrographs of frozen sections from intact colon and wounds on days 1 and 3 after wounding show WISP-1 expression (green), F-actin (red), and nuclei (blue). Scale bar: 100 μm. Original magnification ×20. (C) WISP1 mRNA levels in colon biopsies from healthy controls and IBD patients with active inflammation in the colon (***P < 0.001, n = 5, mean ± SEM). (D) Laser confocal micrographs of frozen sections from healthy and active IBD tissue show WISP-1 expression (green), F-actin (red), and nuclei (blue). Scale bar: 100 μm. UC, ulcerative colitis; CD, Crohn’s disease. (E) Lysates of healthy and active IBD tissue from human colon samples were immunoblotted to detect WISP-1, IL-10Rα, GBP-1, and GAPDH. B, D, and E show representative images from 3 experiments. Sample information pertaining to patient diagnosis, age, and treatment is provided in Supplemental Table 1. All statistical comparisons were performed using ANOVA with Tukey’s multiple comparisons post test.

Journal: The Journal of Clinical Investigation

Article Title: Macrophage-derived IL-10 mediates mucosal repair by epithelial WISP-1 signaling

doi: 10.1172/JCI90229

Figure Lengend Snippet: (A) WISP1 mRNA levels were determined in tissue obtained from punch biopsies of intact colon (IT) and wounded colonic mucosa on post-injury days 1, 2, and 3 (***P < 0.001 and *P < 0.05, n = 3, mean ± SEM). (B) Laser confocal micrographs of frozen sections from intact colon and wounds on days 1 and 3 after wounding show WISP-1 expression (green), F-actin (red), and nuclei (blue). Scale bar: 100 μm. Original magnification ×20. (C) WISP1 mRNA levels in colon biopsies from healthy controls and IBD patients with active inflammation in the colon (***P < 0.001, n = 5, mean ± SEM). (D) Laser confocal micrographs of frozen sections from healthy and active IBD tissue show WISP-1 expression (green), F-actin (red), and nuclei (blue). Scale bar: 100 μm. UC, ulcerative colitis; CD, Crohn’s disease. (E) Lysates of healthy and active IBD tissue from human colon samples were immunoblotted to detect WISP-1, IL-10Rα, GBP-1, and GAPDH. B, D, and E show representative images from 3 experiments. Sample information pertaining to patient diagnosis, age, and treatment is provided in Supplemental Table 1. All statistical comparisons were performed using ANOVA with Tukey’s multiple comparisons post test.

Article Snippet: WISP-1 siRNAs (no. 1: GGAGUUUGCAUGGACAAUAGGUGCT; no. 2: ACAUCCAUACACUCAUUAAGGCAGG; no. 3: AGACUAUCGACGUGUCCUUCCAGTG) were purchased from OriGene (catalog SR305836), and IL-10Rα and IL-10β siRNAs (SMARTpool, catalog L-007925-00-0005) were purchased from GE Dharmacon and used for transfection studies with Lipofectamine 2000 (Life Technologies, Thermo Fisher Scientific) according to the manufacturers’ instructions.

Techniques: Expressing

(A) Intestinal epithelial wound closure percentage was calculated by measuring wound widths 0, 12, and 24 hours after wounding (***P < 0.001, n = 4, mean ± SEM). Cells were incubated with WISP-1 (500 nM) in the presence of WISP-1–inhibitory Abs (α–WISP-1) (10 μg/wound) and IgG-matched control Abs. (B) Percentage of wound closure in cells after siRNA-mediated downregulation of WISP-1 (WISP-1 siRNA) or scramble control siRNA (*P < 0.05 and **P < 0.01; n = 8, mean ± SEM) and treatment with rhIL-10 (100 nM), WISP-1 (500 nM), or BSA. (C and D) Epithelial cell proliferation was determined by analysis of EdU incorporation in control epithelial cells, cells with siRNA-mediated downregulation of WISP-1 (WISP-1 siRNA), WISP-1–inhibitory Abs with corresponding IgG-matched control (10 μg/well). (C, ***P < 0.001, n = 4, mean ± SEM), and in cells treated with rhIL-10 (100 nM), WISP-1 (500 nM), or BSA (D, *P < 0.05 and ***P < 0.001, n = 4, mean ± SEM). (E) POU5F1 and NANOG qPCR of SKCO-15 cells treated with WISP-1 (500 nM) or BSA (**P < 0.01; n = 3, mean ± SEM). (F) Intestinal epithelial cells from scratch-wounded monolayers were treated with BSA, IL-10 (100 nM), or WISP-1 (500 nM) for 2 hours. Harvested cells were immunoblotted for the pro-proliferative protein c-myc and the loading control GAPDH. Blot is representative of 3 experiments. (G) Endoscopic images of healing mucosal wounds 1 and 3 days after biopsy-induced injury in WT mice that were administered WISP-1–neutralizing Ab or an IgG isotype control into the wound bed (***P < 0.001, n = 5, mean ± SEM). All statistical comparisons were performed using ANOVA with Tukey’s multiple comparisons post test and a 2-tailed Student’s t test.

Journal: The Journal of Clinical Investigation

Article Title: Macrophage-derived IL-10 mediates mucosal repair by epithelial WISP-1 signaling

doi: 10.1172/JCI90229

Figure Lengend Snippet: (A) Intestinal epithelial wound closure percentage was calculated by measuring wound widths 0, 12, and 24 hours after wounding (***P < 0.001, n = 4, mean ± SEM). Cells were incubated with WISP-1 (500 nM) in the presence of WISP-1–inhibitory Abs (α–WISP-1) (10 μg/wound) and IgG-matched control Abs. (B) Percentage of wound closure in cells after siRNA-mediated downregulation of WISP-1 (WISP-1 siRNA) or scramble control siRNA (*P < 0.05 and **P < 0.01; n = 8, mean ± SEM) and treatment with rhIL-10 (100 nM), WISP-1 (500 nM), or BSA. (C and D) Epithelial cell proliferation was determined by analysis of EdU incorporation in control epithelial cells, cells with siRNA-mediated downregulation of WISP-1 (WISP-1 siRNA), WISP-1–inhibitory Abs with corresponding IgG-matched control (10 μg/well). (C, ***P < 0.001, n = 4, mean ± SEM), and in cells treated with rhIL-10 (100 nM), WISP-1 (500 nM), or BSA (D, *P < 0.05 and ***P < 0.001, n = 4, mean ± SEM). (E) POU5F1 and NANOG qPCR of SKCO-15 cells treated with WISP-1 (500 nM) or BSA (**P < 0.01; n = 3, mean ± SEM). (F) Intestinal epithelial cells from scratch-wounded monolayers were treated with BSA, IL-10 (100 nM), or WISP-1 (500 nM) for 2 hours. Harvested cells were immunoblotted for the pro-proliferative protein c-myc and the loading control GAPDH. Blot is representative of 3 experiments. (G) Endoscopic images of healing mucosal wounds 1 and 3 days after biopsy-induced injury in WT mice that were administered WISP-1–neutralizing Ab or an IgG isotype control into the wound bed (***P < 0.001, n = 5, mean ± SEM). All statistical comparisons were performed using ANOVA with Tukey’s multiple comparisons post test and a 2-tailed Student’s t test.

Article Snippet: WISP-1 siRNAs (no. 1: GGAGUUUGCAUGGACAAUAGGUGCT; no. 2: ACAUCCAUACACUCAUUAAGGCAGG; no. 3: AGACUAUCGACGUGUCCUUCCAGTG) were purchased from OriGene (catalog SR305836), and IL-10Rα and IL-10β siRNAs (SMARTpool, catalog L-007925-00-0005) were purchased from GE Dharmacon and used for transfection studies with Lipofectamine 2000 (Life Technologies, Thermo Fisher Scientific) according to the manufacturers’ instructions.

Techniques: Incubation

Macrophages recruited to sites of colonic mucosal injury secrete IL-10, leading to activation of CREB signaling, which increases epithelial WISP-1 secretion that in turn promotes β-catenin/TCF signaling, epithelial cell proliferation, and wound closure in the intestine.

Journal: The Journal of Clinical Investigation

Article Title: Macrophage-derived IL-10 mediates mucosal repair by epithelial WISP-1 signaling

doi: 10.1172/JCI90229

Figure Lengend Snippet: Macrophages recruited to sites of colonic mucosal injury secrete IL-10, leading to activation of CREB signaling, which increases epithelial WISP-1 secretion that in turn promotes β-catenin/TCF signaling, epithelial cell proliferation, and wound closure in the intestine.

Article Snippet: WISP-1 siRNAs (no. 1: GGAGUUUGCAUGGACAAUAGGUGCT; no. 2: ACAUCCAUACACUCAUUAAGGCAGG; no. 3: AGACUAUCGACGUGUCCUUCCAGTG) were purchased from OriGene (catalog SR305836), and IL-10Rα and IL-10β siRNAs (SMARTpool, catalog L-007925-00-0005) were purchased from GE Dharmacon and used for transfection studies with Lipofectamine 2000 (Life Technologies, Thermo Fisher Scientific) according to the manufacturers’ instructions.

Techniques: Activation Assay