cat Search Results


merck cat  (Merck & Co)
86
Merck & Co merck cat
Merck Cat, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/merck cat/product/Merck & Co
Average 86 stars, based on 1 article reviews
merck cat - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
thermo fisher scientific cat  (Fisher Scientific)
86
Fisher Scientific thermo fisher scientific cat
Thermo Fisher Scientific Cat, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/thermo fisher scientific cat/product/Fisher Scientific
Average 86 stars, based on 1 article reviews
thermo fisher scientific cat - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
caggtgatactatcaaccaaa merck cat  (Merck & Co)
86
Merck & Co caggtgatactatcaaccaaa merck cat
Caggtgatactatcaaccaaa Merck Cat, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caggtgatactatcaaccaaa merck cat/product/Merck & Co
Average 86 stars, based on 1 article reviews
caggtgatactatcaaccaaa merck cat - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
uric acid ua test kit jiancheng bioengineering cat c012 2 1  (Jiancheng Inc)
86
Jiancheng Inc uric acid ua test kit jiancheng bioengineering cat c012 2 1
Uric Acid Ua Test Kit Jiancheng Bioengineering Cat C012 2 1, supplied by Jiancheng Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/uric acid ua test kit jiancheng bioengineering cat c012 2 1/product/Jiancheng Inc
Average 86 stars, based on 1 article reviews
uric acid ua test kit jiancheng bioengineering cat c012 2 1 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
etoposide cat  (Merck & Co)
86
Merck & Co etoposide cat
A. Ctrl-KO and SNX9-KO MCF10A cells were treated with <t>etoposide</t> at 25 and 50 μM (indicated by triangles) and analyzed by IB for total and phosphorylated (p53 ser15 ) p53, and the p53 target genes MDM2 and CDKN1A. Vinculin (VCL), loading control. B . RT-qPCR analysis of MDM2 and CDKN1A expression in the samples described in “A”. Data are from three independent experiments and expressed as mean ± SD. *, p<0.05; **, p<0.01. C. 3D reconstruction of MCF10A-p53-KO recipient cells treated for 8 h with EVs purified from the conditioned medium of HEK-293 cells transfected with p53-HA. Recipient cells were treated with etoposide (50 μM for 8 h) and analyzed by IF using an anti-p53 antibody (green) and DAPI (blue). Bar, 20 μm. D. MCF10A-p53-KO recipient cells were treated for 8 h with etoposide (50 μM) and EVs purified from HEK-293 WT (EV) or HEK-293 p53-HA (EV p53-HA) cells as indicated. After treatment cells were harvested and analyzed by RT-qPCR for CDKN1A levels. Data are from three independent experiments and expressed as mean ± SD. * p<0.05, ** p<0.01 and *** p<0.001 vs . same condition in cells not treated with EVs (only the most relevant statistical comparisons are shown). E. Scheme of the co-culture experiment shown in in panel F. a) MCF10A-p53-KO-H2B-Cherry cells were plated onto coverslips. b) After 24 h, coverslips were harvested and seeded (c) in plates in which the indicated cell lines had been previously seeded. Cells were then treated with etoposide (50 μM) or mock-treatment for 8 h. d) Coverslips were harvested and analyzed for purity of H2B-Cherry labeled cells (Fig. S10D) and for the levels of CDKN1A mRNA (panel F). Details are in Materials and Methods. F . RT-qPCR analysis of CDKN1A levels in harvested H2B-Cherry labeled MCF10A-p53-KO cells, co-cultured as described in panel “ E ”. Data are from three independent experiments and expressed as mean ± SD. **, p<0.01; n.s., not significant (only the most relevant statistical comparisons are shown). G . SAOS2 cells were treated with EVs purified from the indicated MCF10A cell lines (see experimental scheme in Fig. S10F), and cell viability/growth was assessed indirectly by quantifying intracellular ATP levels using a luminescence-based assay. Data are from ten samples/condition from two independent experiments and expressed as mean ± SD. One-way ANOVA test: *, and ***, p < 0.05 and < 0.001, respectively, vs . SAOS2 treated with EVs derived from MCF10A-p53-KO cells.
Etoposide Cat, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/etoposide cat/product/Merck & Co
Average 86 stars, based on 1 article reviews
etoposide cat - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
fisher scientific cat  (Fisher Scientific)
86
Fisher Scientific fisher scientific cat
A. Ctrl-KO and SNX9-KO MCF10A cells were treated with <t>etoposide</t> at 25 and 50 μM (indicated by triangles) and analyzed by IB for total and phosphorylated (p53 ser15 ) p53, and the p53 target genes MDM2 and CDKN1A. Vinculin (VCL), loading control. B . RT-qPCR analysis of MDM2 and CDKN1A expression in the samples described in “A”. Data are from three independent experiments and expressed as mean ± SD. *, p<0.05; **, p<0.01. C. 3D reconstruction of MCF10A-p53-KO recipient cells treated for 8 h with EVs purified from the conditioned medium of HEK-293 cells transfected with p53-HA. Recipient cells were treated with etoposide (50 μM for 8 h) and analyzed by IF using an anti-p53 antibody (green) and DAPI (blue). Bar, 20 μm. D. MCF10A-p53-KO recipient cells were treated for 8 h with etoposide (50 μM) and EVs purified from HEK-293 WT (EV) or HEK-293 p53-HA (EV p53-HA) cells as indicated. After treatment cells were harvested and analyzed by RT-qPCR for CDKN1A levels. Data are from three independent experiments and expressed as mean ± SD. * p<0.05, ** p<0.01 and *** p<0.001 vs . same condition in cells not treated with EVs (only the most relevant statistical comparisons are shown). E. Scheme of the co-culture experiment shown in in panel F. a) MCF10A-p53-KO-H2B-Cherry cells were plated onto coverslips. b) After 24 h, coverslips were harvested and seeded (c) in plates in which the indicated cell lines had been previously seeded. Cells were then treated with etoposide (50 μM) or mock-treatment for 8 h. d) Coverslips were harvested and analyzed for purity of H2B-Cherry labeled cells (Fig. S10D) and for the levels of CDKN1A mRNA (panel F). Details are in Materials and Methods. F . RT-qPCR analysis of CDKN1A levels in harvested H2B-Cherry labeled MCF10A-p53-KO cells, co-cultured as described in panel “ E ”. Data are from three independent experiments and expressed as mean ± SD. **, p<0.01; n.s., not significant (only the most relevant statistical comparisons are shown). G . SAOS2 cells were treated with EVs purified from the indicated MCF10A cell lines (see experimental scheme in Fig. S10F), and cell viability/growth was assessed indirectly by quantifying intracellular ATP levels using a luminescence-based assay. Data are from ten samples/condition from two independent experiments and expressed as mean ± SD. One-way ANOVA test: *, and ***, p < 0.05 and < 0.001, respectively, vs . SAOS2 treated with EVs derived from MCF10A-p53-KO cells.
Fisher Scientific Cat, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fisher scientific cat/product/Fisher Scientific
Average 86 stars, based on 1 article reviews
fisher scientific cat - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
trehalose dihydrate cat  (Merck & Co)
86
Merck & Co trehalose dihydrate cat
A. Ctrl-KO and SNX9-KO MCF10A cells were treated with <t>etoposide</t> at 25 and 50 μM (indicated by triangles) and analyzed by IB for total and phosphorylated (p53 ser15 ) p53, and the p53 target genes MDM2 and CDKN1A. Vinculin (VCL), loading control. B . RT-qPCR analysis of MDM2 and CDKN1A expression in the samples described in “A”. Data are from three independent experiments and expressed as mean ± SD. *, p<0.05; **, p<0.01. C. 3D reconstruction of MCF10A-p53-KO recipient cells treated for 8 h with EVs purified from the conditioned medium of HEK-293 cells transfected with p53-HA. Recipient cells were treated with etoposide (50 μM for 8 h) and analyzed by IF using an anti-p53 antibody (green) and DAPI (blue). Bar, 20 μm. D. MCF10A-p53-KO recipient cells were treated for 8 h with etoposide (50 μM) and EVs purified from HEK-293 WT (EV) or HEK-293 p53-HA (EV p53-HA) cells as indicated. After treatment cells were harvested and analyzed by RT-qPCR for CDKN1A levels. Data are from three independent experiments and expressed as mean ± SD. * p<0.05, ** p<0.01 and *** p<0.001 vs . same condition in cells not treated with EVs (only the most relevant statistical comparisons are shown). E. Scheme of the co-culture experiment shown in in panel F. a) MCF10A-p53-KO-H2B-Cherry cells were plated onto coverslips. b) After 24 h, coverslips were harvested and seeded (c) in plates in which the indicated cell lines had been previously seeded. Cells were then treated with etoposide (50 μM) or mock-treatment for 8 h. d) Coverslips were harvested and analyzed for purity of H2B-Cherry labeled cells (Fig. S10D) and for the levels of CDKN1A mRNA (panel F). Details are in Materials and Methods. F . RT-qPCR analysis of CDKN1A levels in harvested H2B-Cherry labeled MCF10A-p53-KO cells, co-cultured as described in panel “ E ”. Data are from three independent experiments and expressed as mean ± SD. **, p<0.01; n.s., not significant (only the most relevant statistical comparisons are shown). G . SAOS2 cells were treated with EVs purified from the indicated MCF10A cell lines (see experimental scheme in Fig. S10F), and cell viability/growth was assessed indirectly by quantifying intracellular ATP levels using a luminescence-based assay. Data are from ten samples/condition from two independent experiments and expressed as mean ± SD. One-way ANOVA test: *, and ***, p < 0.05 and < 0.001, respectively, vs . SAOS2 treated with EVs derived from MCF10A-p53-KO cells.
Trehalose Dihydrate Cat, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trehalose dihydrate cat/product/Merck & Co
Average 86 stars, based on 1 article reviews
trehalose dihydrate cat - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
recombinant proteins paraformaldehyde servicebio cat  (Sangon Biotech)
86
Sangon Biotech recombinant proteins paraformaldehyde servicebio cat
A. Ctrl-KO and SNX9-KO MCF10A cells were treated with <t>etoposide</t> at 25 and 50 μM (indicated by triangles) and analyzed by IB for total and phosphorylated (p53 ser15 ) p53, and the p53 target genes MDM2 and CDKN1A. Vinculin (VCL), loading control. B . RT-qPCR analysis of MDM2 and CDKN1A expression in the samples described in “A”. Data are from three independent experiments and expressed as mean ± SD. *, p<0.05; **, p<0.01. C. 3D reconstruction of MCF10A-p53-KO recipient cells treated for 8 h with EVs purified from the conditioned medium of HEK-293 cells transfected with p53-HA. Recipient cells were treated with etoposide (50 μM for 8 h) and analyzed by IF using an anti-p53 antibody (green) and DAPI (blue). Bar, 20 μm. D. MCF10A-p53-KO recipient cells were treated for 8 h with etoposide (50 μM) and EVs purified from HEK-293 WT (EV) or HEK-293 p53-HA (EV p53-HA) cells as indicated. After treatment cells were harvested and analyzed by RT-qPCR for CDKN1A levels. Data are from three independent experiments and expressed as mean ± SD. * p<0.05, ** p<0.01 and *** p<0.001 vs . same condition in cells not treated with EVs (only the most relevant statistical comparisons are shown). E. Scheme of the co-culture experiment shown in in panel F. a) MCF10A-p53-KO-H2B-Cherry cells were plated onto coverslips. b) After 24 h, coverslips were harvested and seeded (c) in plates in which the indicated cell lines had been previously seeded. Cells were then treated with etoposide (50 μM) or mock-treatment for 8 h. d) Coverslips were harvested and analyzed for purity of H2B-Cherry labeled cells (Fig. S10D) and for the levels of CDKN1A mRNA (panel F). Details are in Materials and Methods. F . RT-qPCR analysis of CDKN1A levels in harvested H2B-Cherry labeled MCF10A-p53-KO cells, co-cultured as described in panel “ E ”. Data are from three independent experiments and expressed as mean ± SD. **, p<0.01; n.s., not significant (only the most relevant statistical comparisons are shown). G . SAOS2 cells were treated with EVs purified from the indicated MCF10A cell lines (see experimental scheme in Fig. S10F), and cell viability/growth was assessed indirectly by quantifying intracellular ATP levels using a luminescence-based assay. Data are from ten samples/condition from two independent experiments and expressed as mean ± SD. One-way ANOVA test: *, and ***, p < 0.05 and < 0.001, respectively, vs . SAOS2 treated with EVs derived from MCF10A-p53-KO cells.
Recombinant Proteins Paraformaldehyde Servicebio Cat, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant proteins paraformaldehyde servicebio cat/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
recombinant proteins paraformaldehyde servicebio cat - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
cell signaling cat 8690  (Cell Signaling Technology Inc)
86
Cell Signaling Technology Inc cell signaling cat 8690
A. Ctrl-KO and SNX9-KO MCF10A cells were treated with <t>etoposide</t> at 25 and 50 μM (indicated by triangles) and analyzed by IB for total and phosphorylated (p53 ser15 ) p53, and the p53 target genes MDM2 and CDKN1A. Vinculin (VCL), loading control. B . RT-qPCR analysis of MDM2 and CDKN1A expression in the samples described in “A”. Data are from three independent experiments and expressed as mean ± SD. *, p<0.05; **, p<0.01. C. 3D reconstruction of MCF10A-p53-KO recipient cells treated for 8 h with EVs purified from the conditioned medium of HEK-293 cells transfected with p53-HA. Recipient cells were treated with etoposide (50 μM for 8 h) and analyzed by IF using an anti-p53 antibody (green) and DAPI (blue). Bar, 20 μm. D. MCF10A-p53-KO recipient cells were treated for 8 h with etoposide (50 μM) and EVs purified from HEK-293 WT (EV) or HEK-293 p53-HA (EV p53-HA) cells as indicated. After treatment cells were harvested and analyzed by RT-qPCR for CDKN1A levels. Data are from three independent experiments and expressed as mean ± SD. * p<0.05, ** p<0.01 and *** p<0.001 vs . same condition in cells not treated with EVs (only the most relevant statistical comparisons are shown). E. Scheme of the co-culture experiment shown in in panel F. a) MCF10A-p53-KO-H2B-Cherry cells were plated onto coverslips. b) After 24 h, coverslips were harvested and seeded (c) in plates in which the indicated cell lines had been previously seeded. Cells were then treated with etoposide (50 μM) or mock-treatment for 8 h. d) Coverslips were harvested and analyzed for purity of H2B-Cherry labeled cells (Fig. S10D) and for the levels of CDKN1A mRNA (panel F). Details are in Materials and Methods. F . RT-qPCR analysis of CDKN1A levels in harvested H2B-Cherry labeled MCF10A-p53-KO cells, co-cultured as described in panel “ E ”. Data are from three independent experiments and expressed as mean ± SD. **, p<0.01; n.s., not significant (only the most relevant statistical comparisons are shown). G . SAOS2 cells were treated with EVs purified from the indicated MCF10A cell lines (see experimental scheme in Fig. S10F), and cell viability/growth was assessed indirectly by quantifying intracellular ATP levels using a luminescence-based assay. Data are from ten samples/condition from two independent experiments and expressed as mean ± SD. One-way ANOVA test: *, and ***, p < 0.05 and < 0.001, respectively, vs . SAOS2 treated with EVs derived from MCF10A-p53-KO cells.
Cell Signaling Cat 8690, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cell signaling cat 8690/product/Cell Signaling Technology Inc
Average 86 stars, based on 1 article reviews
cell signaling cat 8690 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
cat 9102 rrid ab 330744 phospho p44 42 mapk  (Cell Signaling Technology Inc)
86
Cell Signaling Technology Inc cat 9102 rrid ab 330744 phospho p44 42 mapk
A. Ctrl-KO and SNX9-KO MCF10A cells were treated with <t>etoposide</t> at 25 and 50 μM (indicated by triangles) and analyzed by IB for total and phosphorylated (p53 ser15 ) p53, and the p53 target genes MDM2 and CDKN1A. Vinculin (VCL), loading control. B . RT-qPCR analysis of MDM2 and CDKN1A expression in the samples described in “A”. Data are from three independent experiments and expressed as mean ± SD. *, p<0.05; **, p<0.01. C. 3D reconstruction of MCF10A-p53-KO recipient cells treated for 8 h with EVs purified from the conditioned medium of HEK-293 cells transfected with p53-HA. Recipient cells were treated with etoposide (50 μM for 8 h) and analyzed by IF using an anti-p53 antibody (green) and DAPI (blue). Bar, 20 μm. D. MCF10A-p53-KO recipient cells were treated for 8 h with etoposide (50 μM) and EVs purified from HEK-293 WT (EV) or HEK-293 p53-HA (EV p53-HA) cells as indicated. After treatment cells were harvested and analyzed by RT-qPCR for CDKN1A levels. Data are from three independent experiments and expressed as mean ± SD. * p<0.05, ** p<0.01 and *** p<0.001 vs . same condition in cells not treated with EVs (only the most relevant statistical comparisons are shown). E. Scheme of the co-culture experiment shown in in panel F. a) MCF10A-p53-KO-H2B-Cherry cells were plated onto coverslips. b) After 24 h, coverslips were harvested and seeded (c) in plates in which the indicated cell lines had been previously seeded. Cells were then treated with etoposide (50 μM) or mock-treatment for 8 h. d) Coverslips were harvested and analyzed for purity of H2B-Cherry labeled cells (Fig. S10D) and for the levels of CDKN1A mRNA (panel F). Details are in Materials and Methods. F . RT-qPCR analysis of CDKN1A levels in harvested H2B-Cherry labeled MCF10A-p53-KO cells, co-cultured as described in panel “ E ”. Data are from three independent experiments and expressed as mean ± SD. **, p<0.01; n.s., not significant (only the most relevant statistical comparisons are shown). G . SAOS2 cells were treated with EVs purified from the indicated MCF10A cell lines (see experimental scheme in Fig. S10F), and cell viability/growth was assessed indirectly by quantifying intracellular ATP levels using a luminescence-based assay. Data are from ten samples/condition from two independent experiments and expressed as mean ± SD. One-way ANOVA test: *, and ***, p < 0.05 and < 0.001, respectively, vs . SAOS2 treated with EVs derived from MCF10A-p53-KO cells.
Cat 9102 Rrid Ab 330744 Phospho P44 42 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cat 9102 rrid ab 330744 phospho p44 42 mapk/product/Cell Signaling Technology Inc
Average 86 stars, based on 1 article reviews
cat 9102 rrid ab 330744 phospho p44 42 mapk - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
cell signaling cat 4970  (Cell Signaling Technology Inc)
86
Cell Signaling Technology Inc cell signaling cat 4970
A. Ctrl-KO and SNX9-KO MCF10A cells were treated with <t>etoposide</t> at 25 and 50 μM (indicated by triangles) and analyzed by IB for total and phosphorylated (p53 ser15 ) p53, and the p53 target genes MDM2 and CDKN1A. Vinculin (VCL), loading control. B . RT-qPCR analysis of MDM2 and CDKN1A expression in the samples described in “A”. Data are from three independent experiments and expressed as mean ± SD. *, p<0.05; **, p<0.01. C. 3D reconstruction of MCF10A-p53-KO recipient cells treated for 8 h with EVs purified from the conditioned medium of HEK-293 cells transfected with p53-HA. Recipient cells were treated with etoposide (50 μM for 8 h) and analyzed by IF using an anti-p53 antibody (green) and DAPI (blue). Bar, 20 μm. D. MCF10A-p53-KO recipient cells were treated for 8 h with etoposide (50 μM) and EVs purified from HEK-293 WT (EV) or HEK-293 p53-HA (EV p53-HA) cells as indicated. After treatment cells were harvested and analyzed by RT-qPCR for CDKN1A levels. Data are from three independent experiments and expressed as mean ± SD. * p<0.05, ** p<0.01 and *** p<0.001 vs . same condition in cells not treated with EVs (only the most relevant statistical comparisons are shown). E. Scheme of the co-culture experiment shown in in panel F. a) MCF10A-p53-KO-H2B-Cherry cells were plated onto coverslips. b) After 24 h, coverslips were harvested and seeded (c) in plates in which the indicated cell lines had been previously seeded. Cells were then treated with etoposide (50 μM) or mock-treatment for 8 h. d) Coverslips were harvested and analyzed for purity of H2B-Cherry labeled cells (Fig. S10D) and for the levels of CDKN1A mRNA (panel F). Details are in Materials and Methods. F . RT-qPCR analysis of CDKN1A levels in harvested H2B-Cherry labeled MCF10A-p53-KO cells, co-cultured as described in panel “ E ”. Data are from three independent experiments and expressed as mean ± SD. **, p<0.01; n.s., not significant (only the most relevant statistical comparisons are shown). G . SAOS2 cells were treated with EVs purified from the indicated MCF10A cell lines (see experimental scheme in Fig. S10F), and cell viability/growth was assessed indirectly by quantifying intracellular ATP levels using a luminescence-based assay. Data are from ten samples/condition from two independent experiments and expressed as mean ± SD. One-way ANOVA test: *, and ***, p < 0.05 and < 0.001, respectively, vs . SAOS2 treated with EVs derived from MCF10A-p53-KO cells.
Cell Signaling Cat 4970, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cell signaling cat 4970/product/Cell Signaling Technology Inc
Average 86 stars, based on 1 article reviews
cell signaling cat 4970 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
vacuette tube serum separator clot activator  (Greiner Bio)
96
Greiner Bio vacuette tube serum separator clot activator
A. Ctrl-KO and SNX9-KO MCF10A cells were treated with <t>etoposide</t> at 25 and 50 μM (indicated by triangles) and analyzed by IB for total and phosphorylated (p53 ser15 ) p53, and the p53 target genes MDM2 and CDKN1A. Vinculin (VCL), loading control. B . RT-qPCR analysis of MDM2 and CDKN1A expression in the samples described in “A”. Data are from three independent experiments and expressed as mean ± SD. *, p<0.05; **, p<0.01. C. 3D reconstruction of MCF10A-p53-KO recipient cells treated for 8 h with EVs purified from the conditioned medium of HEK-293 cells transfected with p53-HA. Recipient cells were treated with etoposide (50 μM for 8 h) and analyzed by IF using an anti-p53 antibody (green) and DAPI (blue). Bar, 20 μm. D. MCF10A-p53-KO recipient cells were treated for 8 h with etoposide (50 μM) and EVs purified from HEK-293 WT (EV) or HEK-293 p53-HA (EV p53-HA) cells as indicated. After treatment cells were harvested and analyzed by RT-qPCR for CDKN1A levels. Data are from three independent experiments and expressed as mean ± SD. * p<0.05, ** p<0.01 and *** p<0.001 vs . same condition in cells not treated with EVs (only the most relevant statistical comparisons are shown). E. Scheme of the co-culture experiment shown in in panel F. a) MCF10A-p53-KO-H2B-Cherry cells were plated onto coverslips. b) After 24 h, coverslips were harvested and seeded (c) in plates in which the indicated cell lines had been previously seeded. Cells were then treated with etoposide (50 μM) or mock-treatment for 8 h. d) Coverslips were harvested and analyzed for purity of H2B-Cherry labeled cells (Fig. S10D) and for the levels of CDKN1A mRNA (panel F). Details are in Materials and Methods. F . RT-qPCR analysis of CDKN1A levels in harvested H2B-Cherry labeled MCF10A-p53-KO cells, co-cultured as described in panel “ E ”. Data are from three independent experiments and expressed as mean ± SD. **, p<0.01; n.s., not significant (only the most relevant statistical comparisons are shown). G . SAOS2 cells were treated with EVs purified from the indicated MCF10A cell lines (see experimental scheme in Fig. S10F), and cell viability/growth was assessed indirectly by quantifying intracellular ATP levels using a luminescence-based assay. Data are from ten samples/condition from two independent experiments and expressed as mean ± SD. One-way ANOVA test: *, and ***, p < 0.05 and < 0.001, respectively, vs . SAOS2 treated with EVs derived from MCF10A-p53-KO cells.
Vacuette Tube Serum Separator Clot Activator, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vacuette tube serum separator clot activator/product/Greiner Bio
Average 96 stars, based on 1 article reviews
vacuette tube serum separator clot activator - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

Image Search Results


A. Ctrl-KO and SNX9-KO MCF10A cells were treated with etoposide at 25 and 50 μM (indicated by triangles) and analyzed by IB for total and phosphorylated (p53 ser15 ) p53, and the p53 target genes MDM2 and CDKN1A. Vinculin (VCL), loading control. B . RT-qPCR analysis of MDM2 and CDKN1A expression in the samples described in “A”. Data are from three independent experiments and expressed as mean ± SD. *, p<0.05; **, p<0.01. C. 3D reconstruction of MCF10A-p53-KO recipient cells treated for 8 h with EVs purified from the conditioned medium of HEK-293 cells transfected with p53-HA. Recipient cells were treated with etoposide (50 μM for 8 h) and analyzed by IF using an anti-p53 antibody (green) and DAPI (blue). Bar, 20 μm. D. MCF10A-p53-KO recipient cells were treated for 8 h with etoposide (50 μM) and EVs purified from HEK-293 WT (EV) or HEK-293 p53-HA (EV p53-HA) cells as indicated. After treatment cells were harvested and analyzed by RT-qPCR for CDKN1A levels. Data are from three independent experiments and expressed as mean ± SD. * p<0.05, ** p<0.01 and *** p<0.001 vs . same condition in cells not treated with EVs (only the most relevant statistical comparisons are shown). E. Scheme of the co-culture experiment shown in in panel F. a) MCF10A-p53-KO-H2B-Cherry cells were plated onto coverslips. b) After 24 h, coverslips were harvested and seeded (c) in plates in which the indicated cell lines had been previously seeded. Cells were then treated with etoposide (50 μM) or mock-treatment for 8 h. d) Coverslips were harvested and analyzed for purity of H2B-Cherry labeled cells (Fig. S10D) and for the levels of CDKN1A mRNA (panel F). Details are in Materials and Methods. F . RT-qPCR analysis of CDKN1A levels in harvested H2B-Cherry labeled MCF10A-p53-KO cells, co-cultured as described in panel “ E ”. Data are from three independent experiments and expressed as mean ± SD. **, p<0.01; n.s., not significant (only the most relevant statistical comparisons are shown). G . SAOS2 cells were treated with EVs purified from the indicated MCF10A cell lines (see experimental scheme in Fig. S10F), and cell viability/growth was assessed indirectly by quantifying intracellular ATP levels using a luminescence-based assay. Data are from ten samples/condition from two independent experiments and expressed as mean ± SD. One-way ANOVA test: *, and ***, p < 0.05 and < 0.001, respectively, vs . SAOS2 treated with EVs derived from MCF10A-p53-KO cells.

Journal: bioRxiv

Article Title: Endocytic control of cell-autonomous and non-cell-autonomous functions of p53

doi: 10.1101/2025.08.16.670648

Figure Lengend Snippet: A. Ctrl-KO and SNX9-KO MCF10A cells were treated with etoposide at 25 and 50 μM (indicated by triangles) and analyzed by IB for total and phosphorylated (p53 ser15 ) p53, and the p53 target genes MDM2 and CDKN1A. Vinculin (VCL), loading control. B . RT-qPCR analysis of MDM2 and CDKN1A expression in the samples described in “A”. Data are from three independent experiments and expressed as mean ± SD. *, p<0.05; **, p<0.01. C. 3D reconstruction of MCF10A-p53-KO recipient cells treated for 8 h with EVs purified from the conditioned medium of HEK-293 cells transfected with p53-HA. Recipient cells were treated with etoposide (50 μM for 8 h) and analyzed by IF using an anti-p53 antibody (green) and DAPI (blue). Bar, 20 μm. D. MCF10A-p53-KO recipient cells were treated for 8 h with etoposide (50 μM) and EVs purified from HEK-293 WT (EV) or HEK-293 p53-HA (EV p53-HA) cells as indicated. After treatment cells were harvested and analyzed by RT-qPCR for CDKN1A levels. Data are from three independent experiments and expressed as mean ± SD. * p<0.05, ** p<0.01 and *** p<0.001 vs . same condition in cells not treated with EVs (only the most relevant statistical comparisons are shown). E. Scheme of the co-culture experiment shown in in panel F. a) MCF10A-p53-KO-H2B-Cherry cells were plated onto coverslips. b) After 24 h, coverslips were harvested and seeded (c) in plates in which the indicated cell lines had been previously seeded. Cells were then treated with etoposide (50 μM) or mock-treatment for 8 h. d) Coverslips were harvested and analyzed for purity of H2B-Cherry labeled cells (Fig. S10D) and for the levels of CDKN1A mRNA (panel F). Details are in Materials and Methods. F . RT-qPCR analysis of CDKN1A levels in harvested H2B-Cherry labeled MCF10A-p53-KO cells, co-cultured as described in panel “ E ”. Data are from three independent experiments and expressed as mean ± SD. **, p<0.01; n.s., not significant (only the most relevant statistical comparisons are shown). G . SAOS2 cells were treated with EVs purified from the indicated MCF10A cell lines (see experimental scheme in Fig. S10F), and cell viability/growth was assessed indirectly by quantifying intracellular ATP levels using a luminescence-based assay. Data are from ten samples/condition from two independent experiments and expressed as mean ± SD. One-way ANOVA test: *, and ***, p < 0.05 and < 0.001, respectively, vs . SAOS2 treated with EVs derived from MCF10A-p53-KO cells.

Article Snippet: Chemicals were: FLAG peptide, cat. F3290 (Merck Life Science); HA peptide, cat. 11666975001 (Merck Life Science); NUMB peptide corresponding to amino acids 537-551 of hNUMB (Genscript); Etoposide, cat. E1383 (Merck Life Science); Trehalose Dihydrate, cat. T9531 (Merck Life Science); Chloroquine, cat. C6628 (Merck Life Science); Ionomycin, cat. I0634 (Merck Life Science); Proteinase K, P4850 (Merck Life Science); MG132, cat. 474790 (Merck Life Science); U73122, cat. 6756 (Merck Life Science); GW4869, cat. S7609 (Selleck Chemicals); brain PI(4,5)P2, cat. 840046P; brain PI(4)P, cat. 840045P; brain PS, cat. 840032C; brain PC, cat. 840053C (all from Merck Life Science).

Techniques: Control, Quantitative RT-PCR, Expressing, Purification, Transfection, Co-Culture Assay, Labeling, Cell Culture, Luminescence Assay, Derivative Assay