cagctgagcagtgaccacat3 Search Results

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen long range pcr kit
    Long Range Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 281 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more range pcr kit/product/Qiagen
    Average 99 stars, based on 281 article reviews
    Price from $9.99 to $1999.99
    long range pcr kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Illumina Inc ngs platform
    Ngs Platform, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 289 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more platform/product/Illumina Inc
    Average 92 stars, based on 289 article reviews
    Price from $9.99 to $1999.99
    ngs platform - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    Illumina Inc pcr fragments
    Pcr Fragments, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 486 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more fragments/product/Illumina Inc
    Average 92 stars, based on 486 article reviews
    Price from $9.99 to $1999.99
    pcr fragments - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    Image Search Results