91
|
Revvity
caffeine Caffeine, supplied by Revvity, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caffeine/product/Revvity Average 91 stars, based on 1 article reviews
caffeine - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |
94
|
Thermo Fisher
tgcagcctggagatgaacta exon 8 znrf3 10008r 5 Tgcagcctggagatgaacta Exon 8 Znrf3 10008r 5, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tgcagcctggagatgaacta exon 8 znrf3 10008r 5/product/Thermo Fisher Average 94 stars, based on 1 article reviews
tgcagcctggagatgaacta exon 8 znrf3 10008r 5 - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
93
|
LKT Laboratories
caffeine Caffeine, supplied by LKT Laboratories, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caffeine/product/LKT Laboratories Average 93 stars, based on 1 article reviews
caffeine - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
91
|
ChromaDex
caffeine Caffeine, supplied by ChromaDex, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caffeine/product/ChromaDex Average 91 stars, based on 1 article reviews
caffeine - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |
94
|
Valiant Co Ltd
caffeine Caffeine, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caffeine/product/Valiant Co Ltd Average 94 stars, based on 1 article reviews
caffeine - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
93
|
Santa Cruz Biotechnology
d9 caffeine D9 Caffeine, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/d9 caffeine/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
d9 caffeine - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
93
|
Cambridge Isotope Laboratories
caffeine d3 Caffeine D3, supplied by Cambridge Isotope Laboratories, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caffeine d3/product/Cambridge Isotope Laboratories Average 93 stars, based on 1 article reviews
caffeine d3 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
86
|
Valiant Co Ltd
caffeine citrate Caffeine Citrate, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caffeine citrate/product/Valiant Co Ltd Average 86 stars, based on 1 article reviews
caffeine citrate - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
94
|
Tocris
caffeine Caffeine, supplied by Tocris, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caffeine/product/Tocris Average 94 stars, based on 1 article reviews
caffeine - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
88
|
Revvity
caffeine standards Caffeine Standards, supplied by Revvity, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caffeine standards/product/Revvity Average 88 stars, based on 1 article reviews
caffeine standards - by Bioz Stars,
2026-03
88/100 stars
|
Buy from Supplier |
93
|
CDN Isotopes
caffeine d3 Caffeine D3, supplied by CDN Isotopes, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caffeine d3/product/CDN Isotopes Average 93 stars, based on 1 article reviews
caffeine d3 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
91
|
Cerilliant Corporation
caffeine Caffeine, supplied by Cerilliant Corporation, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caffeine/product/Cerilliant Corporation Average 91 stars, based on 1 article reviews
caffeine - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |