caffeine Search Results


91
Revvity caffeine
Caffeine, supplied by Revvity, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caffeine/product/Revvity
Average 91 stars, based on 1 article reviews
caffeine - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

94
Thermo Fisher tgcagcctggagatgaacta exon 8 znrf3 10008r 5
Tgcagcctggagatgaacta Exon 8 Znrf3 10008r 5, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tgcagcctggagatgaacta exon 8 znrf3 10008r 5/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
tgcagcctggagatgaacta exon 8 znrf3 10008r 5 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
LKT Laboratories caffeine
Caffeine, supplied by LKT Laboratories, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caffeine/product/LKT Laboratories
Average 93 stars, based on 1 article reviews
caffeine - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

91
ChromaDex caffeine
Caffeine, supplied by ChromaDex, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caffeine/product/ChromaDex
Average 91 stars, based on 1 article reviews
caffeine - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

94
Valiant Co Ltd caffeine
Caffeine, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caffeine/product/Valiant Co Ltd
Average 94 stars, based on 1 article reviews
caffeine - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology d9 caffeine
D9 Caffeine, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/d9 caffeine/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
d9 caffeine - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Cambridge Isotope Laboratories caffeine d3
Caffeine D3, supplied by Cambridge Isotope Laboratories, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caffeine d3/product/Cambridge Isotope Laboratories
Average 93 stars, based on 1 article reviews
caffeine d3 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

86
Valiant Co Ltd caffeine citrate
Caffeine Citrate, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caffeine citrate/product/Valiant Co Ltd
Average 86 stars, based on 1 article reviews
caffeine citrate - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

94
Tocris caffeine
Caffeine, supplied by Tocris, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caffeine/product/Tocris
Average 94 stars, based on 1 article reviews
caffeine - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

88
Revvity caffeine standards
Caffeine Standards, supplied by Revvity, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caffeine standards/product/Revvity
Average 88 stars, based on 1 article reviews
caffeine standards - by Bioz Stars, 2026-03
88/100 stars
  Buy from Supplier

93
CDN Isotopes caffeine d3
Caffeine D3, supplied by CDN Isotopes, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caffeine d3/product/CDN Isotopes
Average 93 stars, based on 1 article reviews
caffeine d3 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

91
Cerilliant Corporation caffeine
Caffeine, supplied by Cerilliant Corporation, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caffeine/product/Cerilliant Corporation
Average 91 stars, based on 1 article reviews
caffeine - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

Image Search Results