Journal: bioRxiv

Article Title: Castration-resistant prostate cancer cells are addicted to the high activity of cyclin-dependent kinase 2

doi: 10.64898/2026.03.17.712428

Figure Lengend Snippet: A) Schematic representation of RB1-E2F regulation during cell cycle. Phosphorylation of RB1 releases the E2F transcription factor, which activates the genes required for cell cycle progression. B) mRNA expression levels of E-type cyclins ( CCNE1 and CCNE2 ) and Dtype cyclins ( CCND1, CCND2 , and CCND3 ) were analyzed across normal prostate tissue, primary prostate cancer, metastatic prostate cancer, and castration-resistant prostate cancer using patient datasets obtained from accessed through betastasis.com. Error bars represent the standard error of the mean (SEM) and unpaired Mann-Whitney-Wilcoxon test was used to evaluate statistical significance. C and D) Gleason score distribution in prostate tumors over-expression CDK2 and / or CCNE1 and / or CCNE2 (exp > 2) accessed through the cBioPortal in the Prostate Adenocarcinoma (TCGA, Firehose Legacy) dataset and Metastatic Prostate Adenocarcinoma (SU2C/PCF Dream Team, PNAS 2019). Please, note that value of 11 is that recorded from cBioportal. D and E) Cell viability after 4 days of treatment with BLU-222 and Tagtociclib at the indicated concentrations (average of three biological replicates each with three technical replicates). Control samples were set to 100 and treatments were normalized to that. Error bars represent the SEM. F and G) Colony-formation assay after 7 days treatment with BLU-222 and Tagtociclib or CDK2 knockdown in C4-2 (3-4 biological replicates, paired two-tailed Student’s t -test (F) and one-sample t -test (G) were used to evaluate statistical significance and error bars represent the SEM. Western blot was used to confirm successful depletion of CDK2 after the knockdown (representative of three biological replicates).

Article Snippet: LNCaP, C4-2, 22RV1, and RWPE-1 cell lines were obtained from the American Tissue Culture Collection, while PNT1 cells were obtained from Sigma; all were maintained in the RPMI media supplemented with 10% fetal bovine serum (FBS).

Techniques: Phospho-proteomics, Expressing, MANN-WHITNEY, Over Expression, Control, Colony Assay, Knockdown, Two Tailed Test, Western Blot

Journal: bioRxiv

Article Title: Castration-resistant prostate cancer cells are addicted to the high activity of cyclin-dependent kinase 2

doi: 10.64898/2026.03.17.712428

Figure Lengend Snippet: A) Parental and BLU-222-resistant C4-2 cells were treated with BLU-222 as indicated and cell viability was assessed after 4 days of treatment (four biological replicates, each 6 technical replicates and paired two-tailed Student’s t -test was used to assess significance. GraphPad Prism was used to calculate IC 50 -values. Error bars represent the SEM. B and C) Parental and BLU-222-resistant C4-2 cells were treated with the selective CDK2 inhibitor Tagtociclib or the pan-CDK inhibitor AT7519 and viability assessed (the rest is the same as in 2A). D) RT-qPCR analysis of parental and BLU-222 resistant C4-2 cells after the indicated treatments. Data is from 3-4 biological replicates, error bars represent the SEM and statistical significance is evaluated by one sample t -test. E) Parental and BLU-222-resistant C4-2 cells were treated with the CDK4/6 inhibitor Abemaciclib and Palbociclib for 4 days and the rest is the same as in 2A.

Article Snippet: LNCaP, C4-2, 22RV1, and RWPE-1 cell lines were obtained from the American Tissue Culture Collection, while PNT1 cells were obtained from Sigma; all were maintained in the RPMI media supplemented with 10% fetal bovine serum (FBS).

Techniques: Two Tailed Test, Quantitative RT-PCR

Journal: bioRxiv

Article Title: Castration-resistant prostate cancer cells are addicted to the high activity of cyclin-dependent kinase 2

doi: 10.64898/2026.03.17.712428

Figure Lengend Snippet: A) C4-2 cells were treated with BLU-222 (500 nM) and Tagtociclib (500 nM) for 3 days, R-loop accumulation was detected using immunofluorescence (the S9.6 antibody), and TP53BP1 was also detected. Quantification of signal intensity with SEM and significance was assessed by paired two-tailed Student’s t -test. B) CRPC cell lines (C4-2 and 22RV1) and normal prostate epithelial cells (PNT1) were treated for 4 days with CX-5461 or Everolimus alone, or in combination with BLU-222 (500 nM) or Tagtociclib (500 nM), cell viability assessed and data is the mean of four biological replicates (2-3 technical replicates each) with SEM. Paired two-tailed Student’s t -test was used to evaluate statistical significance, which is indicated in comparison between CDK2 inhibitor-alone and compound of interest-alone to combination and is color-coded according to CDK2 inhibitor used. C) Colony-formation assay. Cells were either not radiated (0), first radiated and then treated after 1 day (R>C), first treated and then radiated after 1 day (C>R) or treated and radiated at the same time (CR). After 7 days, the colonies were detected (4 biological replicates with SEM). Paired two-tailed Student’s t -test was used to evaluate statistical significance and the value reported is in comparison to both radiation-alone and CDK2 inhibitor-alone (whichever is higher, is reported).

Article Snippet: LNCaP, C4-2, 22RV1, and RWPE-1 cell lines were obtained from the American Tissue Culture Collection, while PNT1 cells were obtained from Sigma; all were maintained in the RPMI media supplemented with 10% fetal bovine serum (FBS).

Techniques: Immunofluorescence, Two Tailed Test, Comparison, Colony Assay

Journal: bioRxiv

Article Title: Castration-resistant prostate cancer cells are addicted to the high activity of cyclin-dependent kinase 2

doi: 10.64898/2026.03.17.712428

Figure Lengend Snippet: A-D) CRPC cell lines (C4-2 and 22Rv1), cell lines derived from normal prostate epithelia (PNT1 and RWPE-1), and prostate cancer cells (LNCaP) were treated for 4 days as indicated (BLU-222: 500 nM and Tagtociclib: 500 nM), viability assay performed and data is the mean of four biological replicates (2-3 technical replicates each) with SEM. Paired two-tailed Student’s t -test was used to evaluate statistical significance, which is indicated in comparison between CDK2 inhibitor-alone and compound of interest-alone to combination and is color-coded according to CDK2 inhibitor used. E) Colony-formation assay. Cells were treated as indicated and colony-formation assay performed after 7 days (3 biological replicates with SEM and paired two-tailed Student’s t -test was used to assess the significance).

Article Snippet: LNCaP, C4-2, 22RV1, and RWPE-1 cell lines were obtained from the American Tissue Culture Collection, while PNT1 cells were obtained from Sigma; all were maintained in the RPMI media supplemented with 10% fetal bovine serum (FBS).

Techniques: Derivative Assay, Viability Assay, Two Tailed Test, Comparison, Colony Assay

Journal: bioRxiv

Article Title: Castration-resistant prostate cancer cells are addicted to the high activity of cyclin-dependent kinase 2

doi: 10.64898/2026.03.17.712428

Figure Lengend Snippet: A) CRPC cell lines C4-2 and 22Rv1 were treated with BLU-222 or Tagtociclib for 48 hours. mRNA levels of AR and AR target genes were measured by qPCR. For C4-2 cells, AR, KLK3, and TMPRSS2 expression were analyzed, whereas for 22RV1 cells, AR, KLK3, and GAPDH expression were analyzed. Boxplots represent data from 2-3 biological replicates. Error bars represent the SEM. B) mRNA levels of AR and AR target genes, KLK3, and GAPDH were quantified by qPCR in parental and BLU-222-resistant C4-2 cells. Data is from four biological replicates with SEM. C) Pathology classification of prostate tumors over-expressing CDK2 and / or CCNE1 and / or CCNE2 (exp > 2) accessed through the cBioPortal in the Metastatic Prostate Adenocarcinoma (SU2C/PCF Dream Team, PNAS 2019).

Article Snippet: LNCaP, C4-2, 22RV1, and RWPE-1 cell lines were obtained from the American Tissue Culture Collection, while PNT1 cells were obtained from Sigma; all were maintained in the RPMI media supplemented with 10% fetal bovine serum (FBS).

Techniques: Expressing

Journal: Molecular Cancer Research

Article Title: CTCF and BORIS Regulate Rb2/p130 Gene Transcription: A Novel Mechanism and a New Paradigm for Understanding the Biology of Lung Cancer

doi: 10.1158/1541-7786.mcr-10-0493

Figure Lengend Snippet: Figure 1. A, schematic representation of Rb2/p130 gene region containing CTCF putative binding sites. B, nucleotide sequence of the primers spanning theRb2/p130regioninvestigated.C,invivobinding(XChIP)ofCTCF andBoristoRb2/p130(RBL2/P130)promoterinMRC-5lungfibroblasts,andH358(NCSCL) and H69 (SCLC)lung cancer cell lines. The XChIPs were performed using the ChIP-IT Express Enzymatic kit (Active Motif). For each immunoprecipitation, 10 mg of sheared chromatin was incubated overnight with 2 mg of polyclonal antibody specific for CTCF (Millipore, DAM1421463), BORIS (Rockland, 600–401- 907) or normal rabbit IgG (Santa Cruz, sc-2027). PCR was then performed on 1/10 of immunoprecipitated DNA using specific primers for Rb2/p130 core promoter region (B). As positive control for CTCF and BORIS DNA–protein binding, PCR was performed amplyfing the H19/DMR locus (Nguyen, 2008; ref. 21). Input represents the 0.25% of total preimmunoprecipitated chromatin. The results were confirmed by three independent experiments.

Article Snippet: For each immunoprecipitation, 10 mg of sheared chromatin was incubated overnight with 2 mg of polyclonal antibody specific for CTCF, BORIS (Rockland, 600–401-907) or normal rabbit IgG.

Techniques: Binding Assay, Sequencing, Immunoprecipitation, Incubation, Positive Control, Protein Binding

Journal: Molecular Cancer Research

Article Title: CTCF and BORIS Regulate Rb2/p130 Gene Transcription: A Novel Mechanism and a New Paradigm for Understanding the Biology of Lung Cancer

doi: 10.1158/1541-7786.mcr-10-0493

Figure Lengend Snippet: Figure 2. Protein expression level of (A) CTCF, and Rb2/p130 (RBL2/ p130), and (B) BORIS, in nonimmortalized lung fibroblast (MRC-5), in A549 and H358 (NSCLC), and in H82 and H69 (SCLC) cells. The relative protein levels were detected by Western blotting using whole lysate. The expression of HSP70 and Actin protein was assessed to normalize protein loading.

Article Snippet: For each immunoprecipitation, 10 mg of sheared chromatin was incubated overnight with 2 mg of polyclonal antibody specific for CTCF, BORIS (Rockland, 600–401-907) or normal rabbit IgG.

Techniques: Expressing, Western Blot

Journal: Molecular Cancer Research

Article Title: CTCF and BORIS Regulate Rb2/p130 Gene Transcription: A Novel Mechanism and a New Paradigm for Understanding the Biology of Lung Cancer

doi: 10.1158/1541-7786.mcr-10-0493

Figure Lengend Snippet: Figure 3. Ectopic overexpression of Boris and its effect on CTCF and Rb2/ p130 protein expression in MRC-5 lung fibroblasts. MRC-5 lung fibroblasts were transfected with CMV-BORIS plasmid. After 72 hours from transfection the level of CTCF and RB2/p130 proteins were detected by Western analysis. The expression of Actin protein was assessed to normalize protein loading.

Article Snippet: For each immunoprecipitation, 10 mg of sheared chromatin was incubated overnight with 2 mg of polyclonal antibody specific for CTCF, BORIS (Rockland, 600–401-907) or normal rabbit IgG.

Techniques: Over Expression, Expressing, Transfection, Plasmid Preparation, Western Blot

Journal: Molecular Cancer Research

Article Title: CTCF and BORIS Regulate Rb2/p130 Gene Transcription: A Novel Mechanism and a New Paradigm for Understanding the Biology of Lung Cancer

doi: 10.1158/1541-7786.mcr-10-0493

Figure Lengend Snippet: Figure 4. Effect of CTCT and BORIS on Rb2/p130 promoter activity. A, Rb2/p130 Plasmids r1, r12, r123, and r23 were generated by PCR-amplification of different regions of Rb2/p130 promoter, by digestion with BglII and HindIII and by cloning into pGL3 basic (Promega) vector. The following primers have been used: agatctgtttaaaatgcggggaaggt and gcccaagcttccattcaaacggcgaagc (r1), agatctgtttaaaatgcggggaaggt and cggtaagcttactggtcacctcccgacg (r12), agatctgtttaaaatgcggggaaggt and aagcttgctggatctgaggggtg (r123), ggcagatctgcttcgccgtttgaatgg, and aagcttgctggatctgaggggtg (r23). Plasmids r123D1 and r123D2 were generated by site-directed mutagenesis with the QuickChange II site-directed Mutagenesis Kit (Stratagene), following manufacturer's instructions. r123 plasmid was used as template and primers used were gcggggaaggtgcttttatttgaaactaggggagc and gctcccctagtttcaaataaaagcaccttccccgc (r123D1), ggaggaggaggacgacaagacgccgcgccgcctgc and gcaggcggcgcggcgtcttgtcgtcctcctcctcc (r123D2). B, plasmid CMV-CTCF, containing the complete cDNA of CTCF, was generated by digestion of pOTB7/CTCF with EcoRI and XhoI and ligation with pCI-neo (Promega) digested with EcoRI and SalI. Plasmid CMV-BORIS, containing the complete cDNA of CTCFL/BORIS, was generated by digestion of pCR4-TOPO/BORIS with EcoRI and ligation with pCI-neo (Promega) digested with EcoRI. All plasmid constructs were checked by DNA sequencing. The expression of proteins following transient transfection was confirmed by Western blot analysis. Dual luciferase reporter assay (Promega) was used to measure the firefly luciferase and renilla luciferase activity within the transfected cells. pRL-TK renilla luciferase vector was used in each transfection as internal control of transfection efficiency in a ratio 1:20 respect to firefly luciferase vector. Each experiments was conducted as suggested by the manufacturer. Luciferase assays were performed with Sirius Luminometer (Berthold detection systems). Relative light units (RLU) of firefly luciferase acitiviy was normalized against that of the renilla luciferase, and this ration was set to 1 for the control (basal activity of each promoter). Results represent the average of at least three separate biological experiments standard error.

Article Snippet: For each immunoprecipitation, 10 mg of sheared chromatin was incubated overnight with 2 mg of polyclonal antibody specific for CTCF, BORIS (Rockland, 600–401-907) or normal rabbit IgG.

Techniques: Activity Assay, Generated, Amplification, Cloning, Plasmid Preparation, Mutagenesis, Ligation, Construct, DNA Sequencing, Expressing, Transfection, Western Blot, Luciferase, Reporter Assay, Control

Journal: Nucleic Acids Research

Article Title: The CDK5 repressor CDK5RAP1 is a methylthiotransferase acting on nuclear and mitochondrial RNA

doi: 10.1093/nar/gks240

Figure Lengend Snippet: Subcelluar distribution of CDK5RAP1 variants. ( a ) Representation of the two investigated CDK5RAP1 variants with mitochondrial import sequence and catalytic domain. ( b ) Live-cell images of HeLa cells transfected with C-terminally GFP-tagged CDK5RAP1-v1 and CDK5RAP1-v2. For the counterstain of mitochondria, cells were incubated with MitoTracker Red dye. The merge shows that CDK5RAP1-v1 colocalizes with mitochondria, while CDK5RAP1-v2 is distributed in both cytoplasm and nucleus. ( c ) Formaldehyde-fixed HeLa cells were stained with an antibody against the N-terminal region of CDK5RAP1-v2 (Alexa-488, green) and against CDK5 (Alexa-555, red). The localization of CDK5RAP1 is predominantly nuclear with little overlap to CDK5. ( d ) Again, fixed HeLa cells were stained with anti-CDK5RAP1 (green). For localization of nucleic acids, propidium iodide (red) was used. CDK5RAP1 shows an association with the mitotic spindle.

Article Snippet: GFP-reporter plasmids for the subcellular localization of the human CDK5RAP1 variants were obtained from Origene (RG216600 and RG208724).

Techniques: Sequencing, Transfection, Incubation, Staining

Journal: Nucleic Acids Research

Article Title: The CDK5 repressor CDK5RAP1 is a methylthiotransferase acting on nuclear and mitochondrial RNA

doi: 10.1093/nar/gks240

Figure Lengend Snippet: CDK5RAP1 is the human homolog of the bacterial protein MiaB. ( a ) Complementation assay in E. coli. Quantification of m 6 A, i 6 A and ms 2 i 6 A in tRNA of wild-type E. coli , a MiaB-deficient strain and a MiaB-deficient strain complemented with CDK5RAP1. m 6 A was used as internal standard and levels did not change during the experiment. i 6 A level increased in ΔMiaB and compared to WT, because of lack of conversion to ms 2 i 6 A. ΔMiaB + CDK5RAP1 shows a decreased i 6 A level in comparison to ΔMiaB, generated by the complementation. By the expression of CDK5RAP1, the ms 2 i 6 A level increases 15-fold in comparison to ΔMiaB. ( b ) siRNA knockdown in HeLa cells. Cells were transfected twice with esiRNA against CDK5RAP1. Non-coding esiRNA against EGFP served as a control. After 72 h, total RNA was extracted and the modification content was determined by LC-MS. m 6 A and i 6 A remain constant, while ms 2 i 6 A decreased ∼78%.

Article Snippet: GFP-reporter plasmids for the subcellular localization of the human CDK5RAP1 variants were obtained from Origene (RG216600 and RG208724).

Techniques: Comparison, Generated, Expressing, Knockdown, Transfection, esiRNA, Control, Modification, Liquid Chromatography with Mass Spectroscopy