c dna Search Results


94
ATCC vaginalis
Lower limit of detection (LLOD) for the Iso-thermal amplification was calculated using the Probit analysis (A). 2% gel image of amplicons of 100-fold serial dilution of Trichomonas <t>vaginalis</t> DNA template (1, 100bp ladder, 2, 10 2 pg/μl, 3, 1 pg/μl, 4, 10 −2 pg/μl, 5, 10 −4 pg/μl, 6, 10 −6 pg/μl, 7, 10 −8 pg/μl and 8, non-template control). The estimated LLOD for the Isothermal assay was 0.0201 pg/μl.
Vaginalis, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vaginalis/product/ATCC
Average 94 stars, based on 1 article reviews
vaginalis - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

95
Chem Impex International glycerol chem impex
Lower limit of detection (LLOD) for the Iso-thermal amplification was calculated using the Probit analysis (A). 2% gel image of amplicons of 100-fold serial dilution of Trichomonas <t>vaginalis</t> DNA template (1, 100bp ladder, 2, 10 2 pg/μl, 3, 1 pg/μl, 4, 10 −2 pg/μl, 5, 10 −4 pg/μl, 6, 10 −6 pg/μl, 7, 10 −8 pg/μl and 8, non-template control). The estimated LLOD for the Isothermal assay was 0.0201 pg/μl.
Glycerol Chem Impex, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/glycerol chem impex/product/Chem Impex International
Average 95 stars, based on 1 article reviews
glycerol chem impex - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

99
Bio-Rad bio rad cdna synthesis kit
Lower limit of detection (LLOD) for the Iso-thermal amplification was calculated using the Probit analysis (A). 2% gel image of amplicons of 100-fold serial dilution of Trichomonas <t>vaginalis</t> DNA template (1, 100bp ladder, 2, 10 2 pg/μl, 3, 1 pg/μl, 4, 10 −2 pg/μl, 5, 10 −4 pg/μl, 6, 10 −6 pg/μl, 7, 10 −8 pg/μl and 8, non-template control). The estimated LLOD for the Isothermal assay was 0.0201 pg/μl.
Bio Rad Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bio rad cdna synthesis kit/product/Bio-Rad
Average 99 stars, based on 1 article reviews
bio rad cdna synthesis kit - by Bioz Stars, 2026-02
99/100 stars
  Buy from Supplier

93
Boster Bio chop
Primers for qPCR
Chop, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chop/product/Boster Bio
Average 93 stars, based on 1 article reviews
chop - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

93
TaKaRa acgcttaacaacaaaaccatagaag
Primers for qPCR
Acgcttaacaacaaaaccatagaag, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/acgcttaacaacaaaaccatagaag/product/TaKaRa
Average 93 stars, based on 1 article reviews
acgcttaacaacaaaaccatagaag - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

93
Proteintech antibodies against ybx2
Figure 8. <t>YBX2</t> expression in pericytes decreased after acute kidney injury. (A) Representative images showing the immunohistochemistry staining of YBX2 in the Ctrl kidneys. Arrows indicate YBX2+ interstitial cells. Scale bars: 25 μm. Original magnification, ×400. (B) Represen- tative images showing Col1a1-GFP+ qPericytes with YBX2 expression in the Ctrl kidney of Col1a1-GFPTg mice. Scale bars: 25 μm. Original magnification, ×400. (C) Representative images showing the immuno histochemistry staining of YBX2 in kidneys on day 7 after IRI-AKI. Arrowheads indicate YBX2+ tubular epithelial cells while asterisks indicate interstitial cells without YBX2. Scale bars: 25 μm. Original magnification, ×400. (D) Dot chart showing the expression of Ybx2 in the Ctrl and day 7 IRI-AKI kidneys. n = 5. (E and F) Dot chart showing the expression of Ybx2 and Acta2 in purified pericytes from the kidneys at the indicated time points after IRI-AKI. Horizontal bars represent the mean, error bars represent the SEM. n = 4. *P < 0.05, **P < 0.01, ***P < 0.001 by 1-way ANOVA with post hoc Tukey’s correction.
Antibodies Against Ybx2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibodies against ybx2/product/Proteintech
Average 93 stars, based on 1 article reviews
antibodies against ybx2 - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

95
Proteintech anti tdp 43
a , Design of Opto-G3BP1 and Opto-Control constructs. b, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were stimulated with a single 5-msec pulse of 488-nm blue light. Representative images are shown from n = 3 independent experiments. c, Quantification of data in cells treated as in b . Five cells with similar expression levels were counted. Granule numbers are shown relative to the granule number at the peak of OptoGranule assembly. Error bars represent s.e.m. d-f, U2OS cells were stably transfected with Opto-Control or Opto-G3BP1, or stable Opto-G3BP1 cells were transiently transfected with G3BP1-GFP, and stimulated with blue light for 3 mins. Regions marked with yellow circles were photobleached and monitored for fluorescence recovery. Data are shown as representative images ( d ), relative fluorescence intensity of photobleached region over time ( e ), and relative mobile fraction derived from e ( f ). For e,f , n = 15 cells for Opto-Control; n = 12 for Opto-G3BP1; n = 14 for G3BP1-GFP. Data are representative of n = 3 independent experiments. Data shown as mean + s.e.m. ns, not significant by one-way ANOVA with Dunnett’s post test. g, U2OS cells were transiently transfected with Opto-G3BP1 and the stress granule marker GFP-TIA1 and stimulated with blue light. Representative images are shown from n = 3 independent experiments. h-j, U2OS cells stably expressing Opto-Control or Opto-G3BP1 constructs without or with blue light stimulation were immunostained with PABP antibody ( h ), <t>TDP-43</t> antibody ( i ), or RNA fluorescence in situ hybridization using FAM-labelled oligo (dT)20 as a probe ( j ). Scale bars, 10 μm in all micrographs.
Anti Tdp 43, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti tdp 43/product/Proteintech
Average 95 stars, based on 1 article reviews
anti tdp 43 - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

91
Boster Bio rabbit polyclonal antibodies against chop gadd153
a , Design of Opto-G3BP1 and Opto-Control constructs. b, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were stimulated with a single 5-msec pulse of 488-nm blue light. Representative images are shown from n = 3 independent experiments. c, Quantification of data in cells treated as in b . Five cells with similar expression levels were counted. Granule numbers are shown relative to the granule number at the peak of OptoGranule assembly. Error bars represent s.e.m. d-f, U2OS cells were stably transfected with Opto-Control or Opto-G3BP1, or stable Opto-G3BP1 cells were transiently transfected with G3BP1-GFP, and stimulated with blue light for 3 mins. Regions marked with yellow circles were photobleached and monitored for fluorescence recovery. Data are shown as representative images ( d ), relative fluorescence intensity of photobleached region over time ( e ), and relative mobile fraction derived from e ( f ). For e,f , n = 15 cells for Opto-Control; n = 12 for Opto-G3BP1; n = 14 for G3BP1-GFP. Data are representative of n = 3 independent experiments. Data shown as mean + s.e.m. ns, not significant by one-way ANOVA with Dunnett’s post test. g, U2OS cells were transiently transfected with Opto-G3BP1 and the stress granule marker GFP-TIA1 and stimulated with blue light. Representative images are shown from n = 3 independent experiments. h-j, U2OS cells stably expressing Opto-Control or Opto-G3BP1 constructs without or with blue light stimulation were immunostained with PABP antibody ( h ), <t>TDP-43</t> antibody ( i ), or RNA fluorescence in situ hybridization using FAM-labelled oligo (dT)20 as a probe ( j ). Scale bars, 10 μm in all micrographs.
Rabbit Polyclonal Antibodies Against Chop Gadd153, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal antibodies against chop gadd153/product/Boster Bio
Average 91 stars, based on 1 article reviews
rabbit polyclonal antibodies against chop gadd153 - by Bioz Stars, 2026-02
91/100 stars
  Buy from Supplier

95
Chem Impex International 34860 acetonitrile acs grade
a , Design of Opto-G3BP1 and Opto-Control constructs. b, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were stimulated with a single 5-msec pulse of 488-nm blue light. Representative images are shown from n = 3 independent experiments. c, Quantification of data in cells treated as in b . Five cells with similar expression levels were counted. Granule numbers are shown relative to the granule number at the peak of OptoGranule assembly. Error bars represent s.e.m. d-f, U2OS cells were stably transfected with Opto-Control or Opto-G3BP1, or stable Opto-G3BP1 cells were transiently transfected with G3BP1-GFP, and stimulated with blue light for 3 mins. Regions marked with yellow circles were photobleached and monitored for fluorescence recovery. Data are shown as representative images ( d ), relative fluorescence intensity of photobleached region over time ( e ), and relative mobile fraction derived from e ( f ). For e,f , n = 15 cells for Opto-Control; n = 12 for Opto-G3BP1; n = 14 for G3BP1-GFP. Data are representative of n = 3 independent experiments. Data shown as mean + s.e.m. ns, not significant by one-way ANOVA with Dunnett’s post test. g, U2OS cells were transiently transfected with Opto-G3BP1 and the stress granule marker GFP-TIA1 and stimulated with blue light. Representative images are shown from n = 3 independent experiments. h-j, U2OS cells stably expressing Opto-Control or Opto-G3BP1 constructs without or with blue light stimulation were immunostained with PABP antibody ( h ), <t>TDP-43</t> antibody ( i ), or RNA fluorescence in situ hybridization using FAM-labelled oligo (dT)20 as a probe ( j ). Scale bars, 10 μm in all micrographs.
34860 Acetonitrile Acs Grade, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/34860 acetonitrile acs grade/product/Chem Impex International
Average 95 stars, based on 1 article reviews
34860 acetonitrile acs grade - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

90
ProSci Incorporated cancer cells 1857 anti chop
a , Design of Opto-G3BP1 and Opto-Control constructs. b, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were stimulated with a single 5-msec pulse of 488-nm blue light. Representative images are shown from n = 3 independent experiments. c, Quantification of data in cells treated as in b . Five cells with similar expression levels were counted. Granule numbers are shown relative to the granule number at the peak of OptoGranule assembly. Error bars represent s.e.m. d-f, U2OS cells were stably transfected with Opto-Control or Opto-G3BP1, or stable Opto-G3BP1 cells were transiently transfected with G3BP1-GFP, and stimulated with blue light for 3 mins. Regions marked with yellow circles were photobleached and monitored for fluorescence recovery. Data are shown as representative images ( d ), relative fluorescence intensity of photobleached region over time ( e ), and relative mobile fraction derived from e ( f ). For e,f , n = 15 cells for Opto-Control; n = 12 for Opto-G3BP1; n = 14 for G3BP1-GFP. Data are representative of n = 3 independent experiments. Data shown as mean + s.e.m. ns, not significant by one-way ANOVA with Dunnett’s post test. g, U2OS cells were transiently transfected with Opto-G3BP1 and the stress granule marker GFP-TIA1 and stimulated with blue light. Representative images are shown from n = 3 independent experiments. h-j, U2OS cells stably expressing Opto-Control or Opto-G3BP1 constructs without or with blue light stimulation were immunostained with PABP antibody ( h ), <t>TDP-43</t> antibody ( i ), or RNA fluorescence in situ hybridization using FAM-labelled oligo (dT)20 as a probe ( j ). Scale bars, 10 μm in all micrographs.
Cancer Cells 1857 Anti Chop, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cancer cells 1857 anti chop/product/ProSci Incorporated
Average 90 stars, based on 1 article reviews
cancer cells 1857 anti chop - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

94
Zymo Research unmethylated control template
a , Design of Opto-G3BP1 and Opto-Control constructs. b, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were stimulated with a single 5-msec pulse of 488-nm blue light. Representative images are shown from n = 3 independent experiments. c, Quantification of data in cells treated as in b . Five cells with similar expression levels were counted. Granule numbers are shown relative to the granule number at the peak of OptoGranule assembly. Error bars represent s.e.m. d-f, U2OS cells were stably transfected with Opto-Control or Opto-G3BP1, or stable Opto-G3BP1 cells were transiently transfected with G3BP1-GFP, and stimulated with blue light for 3 mins. Regions marked with yellow circles were photobleached and monitored for fluorescence recovery. Data are shown as representative images ( d ), relative fluorescence intensity of photobleached region over time ( e ), and relative mobile fraction derived from e ( f ). For e,f , n = 15 cells for Opto-Control; n = 12 for Opto-G3BP1; n = 14 for G3BP1-GFP. Data are representative of n = 3 independent experiments. Data shown as mean + s.e.m. ns, not significant by one-way ANOVA with Dunnett’s post test. g, U2OS cells were transiently transfected with Opto-G3BP1 and the stress granule marker GFP-TIA1 and stimulated with blue light. Representative images are shown from n = 3 independent experiments. h-j, U2OS cells stably expressing Opto-Control or Opto-G3BP1 constructs without or with blue light stimulation were immunostained with PABP antibody ( h ), <t>TDP-43</t> antibody ( i ), or RNA fluorescence in situ hybridization using FAM-labelled oligo (dT)20 as a probe ( j ). Scale bars, 10 μm in all micrographs.
Unmethylated Control Template, supplied by Zymo Research, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/unmethylated control template/product/Zymo Research
Average 94 stars, based on 1 article reviews
unmethylated control template - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

95
Proteintech homozygous mice
a , Design of Opto-G3BP1 and Opto-Control constructs. b, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were stimulated with a single 5-msec pulse of 488-nm blue light. Representative images are shown from n = 3 independent experiments. c, Quantification of data in cells treated as in b . Five cells with similar expression levels were counted. Granule numbers are shown relative to the granule number at the peak of OptoGranule assembly. Error bars represent s.e.m. d-f, U2OS cells were stably transfected with Opto-Control or Opto-G3BP1, or stable Opto-G3BP1 cells were transiently transfected with G3BP1-GFP, and stimulated with blue light for 3 mins. Regions marked with yellow circles were photobleached and monitored for fluorescence recovery. Data are shown as representative images ( d ), relative fluorescence intensity of photobleached region over time ( e ), and relative mobile fraction derived from e ( f ). For e,f , n = 15 cells for Opto-Control; n = 12 for Opto-G3BP1; n = 14 for G3BP1-GFP. Data are representative of n = 3 independent experiments. Data shown as mean + s.e.m. ns, not significant by one-way ANOVA with Dunnett’s post test. g, U2OS cells were transiently transfected with Opto-G3BP1 and the stress granule marker GFP-TIA1 and stimulated with blue light. Representative images are shown from n = 3 independent experiments. h-j, U2OS cells stably expressing Opto-Control or Opto-G3BP1 constructs without or with blue light stimulation were immunostained with PABP antibody ( h ), <t>TDP-43</t> antibody ( i ), or RNA fluorescence in situ hybridization using FAM-labelled oligo (dT)20 as a probe ( j ). Scale bars, 10 μm in all micrographs.
Homozygous Mice, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/homozygous mice/product/Proteintech
Average 95 stars, based on 1 article reviews
homozygous mice - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

Image Search Results


Lower limit of detection (LLOD) for the Iso-thermal amplification was calculated using the Probit analysis (A). 2% gel image of amplicons of 100-fold serial dilution of Trichomonas vaginalis DNA template (1, 100bp ladder, 2, 10 2 pg/μl, 3, 1 pg/μl, 4, 10 −2 pg/μl, 5, 10 −4 pg/μl, 6, 10 −6 pg/μl, 7, 10 −8 pg/μl and 8, non-template control). The estimated LLOD for the Isothermal assay was 0.0201 pg/μl.

Journal: PLOS ONE

Article Title: Highly sensitive molecular assay based on Identical Multi-Repeat Sequence (IMRS) algorithm for the detection of Trichomonas vaginalis infection

doi: 10.1371/journal.pone.0317958

Figure Lengend Snippet: Lower limit of detection (LLOD) for the Iso-thermal amplification was calculated using the Probit analysis (A). 2% gel image of amplicons of 100-fold serial dilution of Trichomonas vaginalis DNA template (1, 100bp ladder, 2, 10 2 pg/μl, 3, 1 pg/μl, 4, 10 −2 pg/μl, 5, 10 −4 pg/μl, 6, 10 −6 pg/μl, 7, 10 −8 pg/μl and 8, non-template control). The estimated LLOD for the Isothermal assay was 0.0201 pg/μl.

Article Snippet: Quantitative Genomic DNA from T . vaginalis (ATCC® 30001DQTM) was obtained from the American Type Culture Collection (ATCC) at a concentration of ≥1 x 10 5 copies/μL.

Techniques: Amplification, Serial Dilution, Control

Lower limit of detection for Trichomonas vaginalis using IMRS primers was 0.03 fg/ μ l (A) and 18S rRNA PCR primers was 0.714pg/ μ L (B) respectively.

Journal: PLOS ONE

Article Title: Highly sensitive molecular assay based on Identical Multi-Repeat Sequence (IMRS) algorithm for the detection of Trichomonas vaginalis infection

doi: 10.1371/journal.pone.0317958

Figure Lengend Snippet: Lower limit of detection for Trichomonas vaginalis using IMRS primers was 0.03 fg/ μ l (A) and 18S rRNA PCR primers was 0.714pg/ μ L (B) respectively.

Article Snippet: Quantitative Genomic DNA from T . vaginalis (ATCC® 30001DQTM) was obtained from the American Type Culture Collection (ATCC) at a concentration of ≥1 x 10 5 copies/μL.

Techniques:

Primers for qPCR

Journal: Bioscience Reports

Article Title: Tension induces intervertebral disc degeneration via endoplasmic reticulum stress-mediated autophagy

doi: 10.1042/BSR20190578

Figure Lengend Snippet: Primers for qPCR

Article Snippet: TRIzo1 reagent (CW0580S), ultrapure RNA extraction kit (CW0581M) and HiFiScript first strand cDNA synthesis kit (CW2569M) were purchased from CWBIO, Shanghai, China; TUNEL kit (C1088) was purchased from Keygen, Shanghai, China; rabbit polyclonal antibody against LC3 (bs-8878R, 1/200), mouse monoclonal antibody against Beclin (bs-3315M,1/600) and rabbit polyclonal antibody against Caspase-3 (bs-0081R,1/200) were purchased from Bioss, Beijing, China; rabbit monoclonal antibody against PARP (ab32138, 1/2000) was purchased from Abcam, U.S.A.; rabbit polyclonal antibodies against Caspase-12 (A0556), CHOP (A0221, 1/800), GAPDH (TA-08, 1/2000)), goat anti-mouse IgG (ZB-2305, 1/2000) and goat anti-rabbit IgG (ZB-2301, 1/2000) were purchased from Boster, Wuhan, China; 4-PBA was obtained from MCE, U.S.A.).

Techniques: Sequencing

Figure 8. YBX2 expression in pericytes decreased after acute kidney injury. (A) Representative images showing the immunohistochemistry staining of YBX2 in the Ctrl kidneys. Arrows indicate YBX2+ interstitial cells. Scale bars: 25 μm. Original magnification, ×400. (B) Represen- tative images showing Col1a1-GFP+ qPericytes with YBX2 expression in the Ctrl kidney of Col1a1-GFPTg mice. Scale bars: 25 μm. Original magnification, ×400. (C) Representative images showing the immuno histochemistry staining of YBX2 in kidneys on day 7 after IRI-AKI. Arrowheads indicate YBX2+ tubular epithelial cells while asterisks indicate interstitial cells without YBX2. Scale bars: 25 μm. Original magnification, ×400. (D) Dot chart showing the expression of Ybx2 in the Ctrl and day 7 IRI-AKI kidneys. n = 5. (E and F) Dot chart showing the expression of Ybx2 and Acta2 in purified pericytes from the kidneys at the indicated time points after IRI-AKI. Horizontal bars represent the mean, error bars represent the SEM. n = 4. *P < 0.05, **P < 0.01, ***P < 0.001 by 1-way ANOVA with post hoc Tukey’s correction.

Journal: Journal of Clinical Investigation

Article Title: Methylation in pericytes after acute injury promotes chronic kidney disease

doi: 10.1172/jci135773

Figure Lengend Snippet: Figure 8. YBX2 expression in pericytes decreased after acute kidney injury. (A) Representative images showing the immunohistochemistry staining of YBX2 in the Ctrl kidneys. Arrows indicate YBX2+ interstitial cells. Scale bars: 25 μm. Original magnification, ×400. (B) Represen- tative images showing Col1a1-GFP+ qPericytes with YBX2 expression in the Ctrl kidney of Col1a1-GFPTg mice. Scale bars: 25 μm. Original magnification, ×400. (C) Representative images showing the immuno histochemistry staining of YBX2 in kidneys on day 7 after IRI-AKI. Arrowheads indicate YBX2+ tubular epithelial cells while asterisks indicate interstitial cells without YBX2. Scale bars: 25 μm. Original magnification, ×400. (D) Dot chart showing the expression of Ybx2 in the Ctrl and day 7 IRI-AKI kidneys. n = 5. (E and F) Dot chart showing the expression of Ybx2 and Acta2 in purified pericytes from the kidneys at the indicated time points after IRI-AKI. Horizontal bars represent the mean, error bars represent the SEM. n = 4. *P < 0.05, **P < 0.01, ***P < 0.001 by 1-way ANOVA with post hoc Tukey’s correction.

Article Snippet: Sections were blocked in 10% normal goat serum for 1 hour, and then incubated with the primary antibodies against YBX2 (13538-1-AP, Proteintech) or nonimmunized rabbit IgG (011- 000-003, Jackson ImmunoResearch Laboratories) at 4°C overnight.

Techniques: Expressing, Immunohistochemistry, Staining, Purification

Figure 9. YBX2 repressed the expression of Acta2. (A) Line chart showing the expression of Ybx2 mRNA in the primary kidney pericytes after TGF-β1 exposure and withdrawal at the indicated time points. Data were expressed as the mean ± SEM. n = 3. *P < 0.05 by t test vs. before TGF-β1 withdrawal. (B) Representative images showing the electrophoresis of the PCR products of the Ybx2 gene using MeDIP or input DNA from primary kidney pericytes after TGF-β1 exposure for 24 or 120 hours. Pericytes without TGF-β1 exposure served as the Ctrl. (C) Scheme showing the primer design in the promoter regions of the Acta2 gene. (D) Repre- sentative images showing the electrophoresis of PCR products of the promoter of the Acta2 gene using DNA immunoprecipitated by anti- YBX2 antibody (ChIP) or input DNA from the primary kidney pericytes with or without TGF-β1 exposure for 120 hours. ChIP using isotype IgG served as the Ctrl. (E) Representative Western blot analyses for YBX2, αSMA, and β-actin in pericytes with or without lentiviral transduction for YBX2 expression. (F) Dot chart showing the relative expression of YBX2 and αSMA in pericytes with or without lentiviral transduction for YBX2 expression. Horizontal bars represent the mean, error bars represent the SEM. n = 3. **P < 0.01, ***P < 0.001 by 1-way ANOVA with post hoc Tukey’s correction.

Journal: Journal of Clinical Investigation

Article Title: Methylation in pericytes after acute injury promotes chronic kidney disease

doi: 10.1172/jci135773

Figure Lengend Snippet: Figure 9. YBX2 repressed the expression of Acta2. (A) Line chart showing the expression of Ybx2 mRNA in the primary kidney pericytes after TGF-β1 exposure and withdrawal at the indicated time points. Data were expressed as the mean ± SEM. n = 3. *P < 0.05 by t test vs. before TGF-β1 withdrawal. (B) Representative images showing the electrophoresis of the PCR products of the Ybx2 gene using MeDIP or input DNA from primary kidney pericytes after TGF-β1 exposure for 24 or 120 hours. Pericytes without TGF-β1 exposure served as the Ctrl. (C) Scheme showing the primer design in the promoter regions of the Acta2 gene. (D) Repre- sentative images showing the electrophoresis of PCR products of the promoter of the Acta2 gene using DNA immunoprecipitated by anti- YBX2 antibody (ChIP) or input DNA from the primary kidney pericytes with or without TGF-β1 exposure for 120 hours. ChIP using isotype IgG served as the Ctrl. (E) Representative Western blot analyses for YBX2, αSMA, and β-actin in pericytes with or without lentiviral transduction for YBX2 expression. (F) Dot chart showing the relative expression of YBX2 and αSMA in pericytes with or without lentiviral transduction for YBX2 expression. Horizontal bars represent the mean, error bars represent the SEM. n = 3. **P < 0.01, ***P < 0.001 by 1-way ANOVA with post hoc Tukey’s correction.

Article Snippet: Sections were blocked in 10% normal goat serum for 1 hour, and then incubated with the primary antibodies against YBX2 (13538-1-AP, Proteintech) or nonimmunized rabbit IgG (011- 000-003, Jackson ImmunoResearch Laboratories) at 4°C overnight.

Techniques: Expressing, Electrophoresis, Methylated DNA Immunoprecipitation, Immunoprecipitation, Western Blot, Transduction

a , Design of Opto-G3BP1 and Opto-Control constructs. b, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were stimulated with a single 5-msec pulse of 488-nm blue light. Representative images are shown from n = 3 independent experiments. c, Quantification of data in cells treated as in b . Five cells with similar expression levels were counted. Granule numbers are shown relative to the granule number at the peak of OptoGranule assembly. Error bars represent s.e.m. d-f, U2OS cells were stably transfected with Opto-Control or Opto-G3BP1, or stable Opto-G3BP1 cells were transiently transfected with G3BP1-GFP, and stimulated with blue light for 3 mins. Regions marked with yellow circles were photobleached and monitored for fluorescence recovery. Data are shown as representative images ( d ), relative fluorescence intensity of photobleached region over time ( e ), and relative mobile fraction derived from e ( f ). For e,f , n = 15 cells for Opto-Control; n = 12 for Opto-G3BP1; n = 14 for G3BP1-GFP. Data are representative of n = 3 independent experiments. Data shown as mean + s.e.m. ns, not significant by one-way ANOVA with Dunnett’s post test. g, U2OS cells were transiently transfected with Opto-G3BP1 and the stress granule marker GFP-TIA1 and stimulated with blue light. Representative images are shown from n = 3 independent experiments. h-j, U2OS cells stably expressing Opto-Control or Opto-G3BP1 constructs without or with blue light stimulation were immunostained with PABP antibody ( h ), TDP-43 antibody ( i ), or RNA fluorescence in situ hybridization using FAM-labelled oligo (dT)20 as a probe ( j ). Scale bars, 10 μm in all micrographs.

Journal: bioRxiv

Article Title: OptoGranules reveal the evolution of stress granules to ALS-FTD pathology

doi: 10.1101/348870

Figure Lengend Snippet: a , Design of Opto-G3BP1 and Opto-Control constructs. b, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were stimulated with a single 5-msec pulse of 488-nm blue light. Representative images are shown from n = 3 independent experiments. c, Quantification of data in cells treated as in b . Five cells with similar expression levels were counted. Granule numbers are shown relative to the granule number at the peak of OptoGranule assembly. Error bars represent s.e.m. d-f, U2OS cells were stably transfected with Opto-Control or Opto-G3BP1, or stable Opto-G3BP1 cells were transiently transfected with G3BP1-GFP, and stimulated with blue light for 3 mins. Regions marked with yellow circles were photobleached and monitored for fluorescence recovery. Data are shown as representative images ( d ), relative fluorescence intensity of photobleached region over time ( e ), and relative mobile fraction derived from e ( f ). For e,f , n = 15 cells for Opto-Control; n = 12 for Opto-G3BP1; n = 14 for G3BP1-GFP. Data are representative of n = 3 independent experiments. Data shown as mean + s.e.m. ns, not significant by one-way ANOVA with Dunnett’s post test. g, U2OS cells were transiently transfected with Opto-G3BP1 and the stress granule marker GFP-TIA1 and stimulated with blue light. Representative images are shown from n = 3 independent experiments. h-j, U2OS cells stably expressing Opto-Control or Opto-G3BP1 constructs without or with blue light stimulation were immunostained with PABP antibody ( h ), TDP-43 antibody ( i ), or RNA fluorescence in situ hybridization using FAM-labelled oligo (dT)20 as a probe ( j ). Scale bars, 10 μm in all micrographs.

Article Snippet: Primary antibodies were anti-PABP (Abcam ab21060), anti-G3BP1 (BD Biosciences 6111126), anti-eIF4G (Santa Cruz Biotechnology sc-11373), anti-TDP-43 (Proteintech 12892-1-AP), anti-phospho-TDP-43 (M01) (Cosmo Bio CO TIP-PTD-MO1), anti-phospho-TDP-43 (P01) (Cosmo Bio CO TIP-PTD-PO1), anti-VCP (BD Biosciences 612183), anti-amyloid-oligomer A11 (Thermo Fisher Scientific AHB0052), anti-Ubiquitin (Dako, Z0458), anti-Ubiquitin (Santa Cruz Biotechnology sc-8017), anti-p62 (Abcam 56416), anti-MAP2 (Sigma M9942), anti-TIA1 (Santa Cruz Biotechnology sc-1751), anti-TIAR (BD Biosciences 610352), anti-eIF3η (Santa Cruz Biotechnology sc-16377), anti-ataxin 2 (Proteintech 21776-1-AP), and anti-GLE1 (Abcam 96007).

Techniques: Construct, Stable Transfection, Expressing, Transfection, Fluorescence, Derivative Assay, Marker, In Situ Hybridization

a, Schematic diagram of Opto-FUS constructs. b, U2OS cells were transiently co-transfected with Opto-FUS-IDR and stress granule marker G3BP1-GFP, and imaged before and after blue light stimulation. Representative images are shown from n = 3 independent experiments. c, U2OS cells were transiently transfected with Opto-FUS (full-length, FL) or Opto-FUS (1-371 aa) and imaged before and after blue light stimulation by immunostaining with stress granule marker PABP. Representative images are shown from n = 3 independent experiments. d, Schematic diagram of Opto-TDP-43 constructs. e, U2OS cells were transiently co-transfected with Opto-TDP-43-IDR and stress granule marker G3BP1-GFP, and imaged before and after blue light stimulation. Representative images are shown from n = 3 independent experiments. f, U2OS cells were transiently transfected with Opto-TDP-43 (FL) or Opto-TDP-43 (106-414 aa) and imaged before and after blue light stimulation by immunostaining with stress granule marker PABP. Representative images are shown from n = 3 independent experiments. g, Top: Schematic diagram of Opto-TIA1constructs. Bottom: U2OS cells were transiently co-transfected with Opto-TIA1 (full-length) or Opto-TIA1 (1-267 aa) and stress granule marker G3BP1-GFP, and imaged before and after blue light stimulation. Representative images are shown from n = 3 independent experiments. Scale bars, 10 μm in all micrographs.

Journal: bioRxiv

Article Title: OptoGranules reveal the evolution of stress granules to ALS-FTD pathology

doi: 10.1101/348870

Figure Lengend Snippet: a, Schematic diagram of Opto-FUS constructs. b, U2OS cells were transiently co-transfected with Opto-FUS-IDR and stress granule marker G3BP1-GFP, and imaged before and after blue light stimulation. Representative images are shown from n = 3 independent experiments. c, U2OS cells were transiently transfected with Opto-FUS (full-length, FL) or Opto-FUS (1-371 aa) and imaged before and after blue light stimulation by immunostaining with stress granule marker PABP. Representative images are shown from n = 3 independent experiments. d, Schematic diagram of Opto-TDP-43 constructs. e, U2OS cells were transiently co-transfected with Opto-TDP-43-IDR and stress granule marker G3BP1-GFP, and imaged before and after blue light stimulation. Representative images are shown from n = 3 independent experiments. f, U2OS cells were transiently transfected with Opto-TDP-43 (FL) or Opto-TDP-43 (106-414 aa) and imaged before and after blue light stimulation by immunostaining with stress granule marker PABP. Representative images are shown from n = 3 independent experiments. g, Top: Schematic diagram of Opto-TIA1constructs. Bottom: U2OS cells were transiently co-transfected with Opto-TIA1 (full-length) or Opto-TIA1 (1-267 aa) and stress granule marker G3BP1-GFP, and imaged before and after blue light stimulation. Representative images are shown from n = 3 independent experiments. Scale bars, 10 μm in all micrographs.

Article Snippet: Primary antibodies were anti-PABP (Abcam ab21060), anti-G3BP1 (BD Biosciences 6111126), anti-eIF4G (Santa Cruz Biotechnology sc-11373), anti-TDP-43 (Proteintech 12892-1-AP), anti-phospho-TDP-43 (M01) (Cosmo Bio CO TIP-PTD-MO1), anti-phospho-TDP-43 (P01) (Cosmo Bio CO TIP-PTD-PO1), anti-VCP (BD Biosciences 612183), anti-amyloid-oligomer A11 (Thermo Fisher Scientific AHB0052), anti-Ubiquitin (Dako, Z0458), anti-Ubiquitin (Santa Cruz Biotechnology sc-8017), anti-p62 (Abcam 56416), anti-MAP2 (Sigma M9942), anti-TIA1 (Santa Cruz Biotechnology sc-1751), anti-TIAR (BD Biosciences 610352), anti-eIF3η (Santa Cruz Biotechnology sc-16377), anti-ataxin 2 (Proteintech 21776-1-AP), and anti-GLE1 (Abcam 96007).

Techniques: Construct, Transfection, Marker, Immunostaining

a,b, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were stimulated with blue light and viability was assessed by crystal violet staining ( a ) or CellTiter-Glo 2.0 luminescence ( b ). Error bars represent s.d. from n = 9 biological replicates. **** P < 0.0001.; ns, not significant by Student’s t test. c, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were exposed to chronic persistent blue light stimulation with live cell imaging (left) and assessed for cell survival by counting living cells (right). n = 26 for Opto-Control and n = 28 for Opto-G3BP1. Data are shown from n = 3 independent experiments. **** P < 0.0001 by log-rank (Mantel-Cox) test. d, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were exposed to chronic intermittent blue light stimulation with live cell imaging (left) and assessed for cell survival by counting living cells (right). n = 7 for Opto-Control and n = 10 for Opto-G3BP1. **** P < 0.0001 by log-rank (Mantel-Cox) test. e , Timeline of protein accumulation in OptoGranules. f-h, U2OS cells stably expressing Opto-G3BP1 were stimulated with blue light for indicated times and co-immunostained with p-TDP-43 and A11 antibodies ( f ), p62 and ubiquitin antibodies ( g ), or VCP and TDP-43 antibodies ( h ). Images in f-h are representative of n = 3 independent experiments. Scale bars, 10 μm in all micrographs.

Journal: bioRxiv

Article Title: OptoGranules reveal the evolution of stress granules to ALS-FTD pathology

doi: 10.1101/348870

Figure Lengend Snippet: a,b, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were stimulated with blue light and viability was assessed by crystal violet staining ( a ) or CellTiter-Glo 2.0 luminescence ( b ). Error bars represent s.d. from n = 9 biological replicates. **** P < 0.0001.; ns, not significant by Student’s t test. c, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were exposed to chronic persistent blue light stimulation with live cell imaging (left) and assessed for cell survival by counting living cells (right). n = 26 for Opto-Control and n = 28 for Opto-G3BP1. Data are shown from n = 3 independent experiments. **** P < 0.0001 by log-rank (Mantel-Cox) test. d, U2OS cells stably expressing Opto-Control or Opto-G3BP1 were exposed to chronic intermittent blue light stimulation with live cell imaging (left) and assessed for cell survival by counting living cells (right). n = 7 for Opto-Control and n = 10 for Opto-G3BP1. **** P < 0.0001 by log-rank (Mantel-Cox) test. e , Timeline of protein accumulation in OptoGranules. f-h, U2OS cells stably expressing Opto-G3BP1 were stimulated with blue light for indicated times and co-immunostained with p-TDP-43 and A11 antibodies ( f ), p62 and ubiquitin antibodies ( g ), or VCP and TDP-43 antibodies ( h ). Images in f-h are representative of n = 3 independent experiments. Scale bars, 10 μm in all micrographs.

Article Snippet: Primary antibodies were anti-PABP (Abcam ab21060), anti-G3BP1 (BD Biosciences 6111126), anti-eIF4G (Santa Cruz Biotechnology sc-11373), anti-TDP-43 (Proteintech 12892-1-AP), anti-phospho-TDP-43 (M01) (Cosmo Bio CO TIP-PTD-MO1), anti-phospho-TDP-43 (P01) (Cosmo Bio CO TIP-PTD-PO1), anti-VCP (BD Biosciences 612183), anti-amyloid-oligomer A11 (Thermo Fisher Scientific AHB0052), anti-Ubiquitin (Dako, Z0458), anti-Ubiquitin (Santa Cruz Biotechnology sc-8017), anti-p62 (Abcam 56416), anti-MAP2 (Sigma M9942), anti-TIA1 (Santa Cruz Biotechnology sc-1751), anti-TIAR (BD Biosciences 610352), anti-eIF3η (Santa Cruz Biotechnology sc-16377), anti-ataxin 2 (Proteintech 21776-1-AP), and anti-GLE1 (Abcam 96007).

Techniques: Stable Transfection, Expressing, Staining, Live Cell Imaging

a, U2OS cells stably expressing Opto-Control were stimulated with blue light for 4 h and then immunostained for A11. Representative images are shown from n = 3 independent experiments. b, U2OS cells stably expressing Opto-G3BP1 were stimulated with blue light for 4 h and then immunostained for p-TDP-43 (p01). Representative images are shown from n = 2 independent experiments. c-d, U2OS cells stably expressing Opto-G3BP1 were stimulated with blue light for indicated times and then co-immunostained for TDP-43 and p-TDP-43 (M01) ( c ), or p62 ( d ). Representative images are shown from n = 3 independent experiments. Scale bars, 10 μm in all micrographs.

Journal: bioRxiv

Article Title: OptoGranules reveal the evolution of stress granules to ALS-FTD pathology

doi: 10.1101/348870

Figure Lengend Snippet: a, U2OS cells stably expressing Opto-Control were stimulated with blue light for 4 h and then immunostained for A11. Representative images are shown from n = 3 independent experiments. b, U2OS cells stably expressing Opto-G3BP1 were stimulated with blue light for 4 h and then immunostained for p-TDP-43 (p01). Representative images are shown from n = 2 independent experiments. c-d, U2OS cells stably expressing Opto-G3BP1 were stimulated with blue light for indicated times and then co-immunostained for TDP-43 and p-TDP-43 (M01) ( c ), or p62 ( d ). Representative images are shown from n = 3 independent experiments. Scale bars, 10 μm in all micrographs.

Article Snippet: Primary antibodies were anti-PABP (Abcam ab21060), anti-G3BP1 (BD Biosciences 6111126), anti-eIF4G (Santa Cruz Biotechnology sc-11373), anti-TDP-43 (Proteintech 12892-1-AP), anti-phospho-TDP-43 (M01) (Cosmo Bio CO TIP-PTD-MO1), anti-phospho-TDP-43 (P01) (Cosmo Bio CO TIP-PTD-PO1), anti-VCP (BD Biosciences 612183), anti-amyloid-oligomer A11 (Thermo Fisher Scientific AHB0052), anti-Ubiquitin (Dako, Z0458), anti-Ubiquitin (Santa Cruz Biotechnology sc-8017), anti-p62 (Abcam 56416), anti-MAP2 (Sigma M9942), anti-TIA1 (Santa Cruz Biotechnology sc-1751), anti-TIAR (BD Biosciences 610352), anti-eIF3η (Santa Cruz Biotechnology sc-16377), anti-ataxin 2 (Proteintech 21776-1-AP), and anti-GLE1 (Abcam 96007).

Techniques: Stable Transfection, Expressing

a, iPS cell-derived neurons expressing Opto-G3BP1 were treated with 0.25 mM sodium arsenite (NaAsO 2 ) for 30 min or 42°C heat shock for 1 h and then immunostained for MAP2 along with stress granule marker TIA1 and TDP-43. b, U2OS cells stably expressing Opto-Control (mRuby) or Opto-G3BP1 (mRuby) were stimulated with blue light for 2 h and then immunostained for PABP. c, Schematic of doxycycline-inducible Opto-neuron generation. d, iPS cell-derived neurons expressing doxycycline-inducible Opto-Control (mCherry) or Opto-G3BP1 (mCherry) and stimulated with one 5-msec pulse of 488-nm blue light. Representative images are shown from n = 3 independent experiments. e-h, iPS cell-derived neurons expressing doxycycline-inducible Opto-G3BP1 were stimulated with blue light for indicated times and co-immunostained with MAP2 and TDP-43 antibodies ( e ), MAP2 and A11 antibodies ( f ), p62 and ubiquitin antibodies ( g ), or p-TDP-43 (P01) antibodies ( h ). Images in e-h are representative of n = 3 independent experiments. Scale bars, 10 μm in all micrographs.

Journal: bioRxiv

Article Title: OptoGranules reveal the evolution of stress granules to ALS-FTD pathology

doi: 10.1101/348870

Figure Lengend Snippet: a, iPS cell-derived neurons expressing Opto-G3BP1 were treated with 0.25 mM sodium arsenite (NaAsO 2 ) for 30 min or 42°C heat shock for 1 h and then immunostained for MAP2 along with stress granule marker TIA1 and TDP-43. b, U2OS cells stably expressing Opto-Control (mRuby) or Opto-G3BP1 (mRuby) were stimulated with blue light for 2 h and then immunostained for PABP. c, Schematic of doxycycline-inducible Opto-neuron generation. d, iPS cell-derived neurons expressing doxycycline-inducible Opto-Control (mCherry) or Opto-G3BP1 (mCherry) and stimulated with one 5-msec pulse of 488-nm blue light. Representative images are shown from n = 3 independent experiments. e-h, iPS cell-derived neurons expressing doxycycline-inducible Opto-G3BP1 were stimulated with blue light for indicated times and co-immunostained with MAP2 and TDP-43 antibodies ( e ), MAP2 and A11 antibodies ( f ), p62 and ubiquitin antibodies ( g ), or p-TDP-43 (P01) antibodies ( h ). Images in e-h are representative of n = 3 independent experiments. Scale bars, 10 μm in all micrographs.

Article Snippet: Primary antibodies were anti-PABP (Abcam ab21060), anti-G3BP1 (BD Biosciences 6111126), anti-eIF4G (Santa Cruz Biotechnology sc-11373), anti-TDP-43 (Proteintech 12892-1-AP), anti-phospho-TDP-43 (M01) (Cosmo Bio CO TIP-PTD-MO1), anti-phospho-TDP-43 (P01) (Cosmo Bio CO TIP-PTD-PO1), anti-VCP (BD Biosciences 612183), anti-amyloid-oligomer A11 (Thermo Fisher Scientific AHB0052), anti-Ubiquitin (Dako, Z0458), anti-Ubiquitin (Santa Cruz Biotechnology sc-8017), anti-p62 (Abcam 56416), anti-MAP2 (Sigma M9942), anti-TIA1 (Santa Cruz Biotechnology sc-1751), anti-TIAR (BD Biosciences 610352), anti-eIF3η (Santa Cruz Biotechnology sc-16377), anti-ataxin 2 (Proteintech 21776-1-AP), and anti-GLE1 (Abcam 96007).

Techniques: Derivative Assay, Expressing, Marker, Stable Transfection

a, Schematic of Opto-neuron generation. b, iPS cell-derived neurons expressing Opto-Control (mRuby) or Opto-G3BP1 (mRuby) were exposed to identical blue light stimulation. Representative images are shown from n = 3 independent experiments. c, iPS cell-derived neurons expressing Opto-Control or Opto-G3BP1 were exposed to chronic persistent stimulation and survival was assessed by counting living cells. n = 35 cells for Opto-Control and n = 34 cells for Opto-G3BP1. Data are representative of n = 3 independent experiments. **** P < 0.0001 by log-rank (Mantel-Cox) test. d, Timeline of pathological protein accumulation in OptoGranules in iPS cell-derived neurons. e-h, iPS cell-derived neurons expressing Opto-G3BP1 were stimulated with blue light for indicated times and co-immunostained with MAP2 and TDP-43 antibodies ( e ), MAP2 and A11 antibodies ( f ), MAP2 and p-TDP-43 (P01) antibodies ( g ), or p62 and ubiquitin antibodies ( h ). Images in e-h are representative of n = 3 independent experiments. Scale bars, 10 μm in all micrographs.

Journal: bioRxiv

Article Title: OptoGranules reveal the evolution of stress granules to ALS-FTD pathology

doi: 10.1101/348870

Figure Lengend Snippet: a, Schematic of Opto-neuron generation. b, iPS cell-derived neurons expressing Opto-Control (mRuby) or Opto-G3BP1 (mRuby) were exposed to identical blue light stimulation. Representative images are shown from n = 3 independent experiments. c, iPS cell-derived neurons expressing Opto-Control or Opto-G3BP1 were exposed to chronic persistent stimulation and survival was assessed by counting living cells. n = 35 cells for Opto-Control and n = 34 cells for Opto-G3BP1. Data are representative of n = 3 independent experiments. **** P < 0.0001 by log-rank (Mantel-Cox) test. d, Timeline of pathological protein accumulation in OptoGranules in iPS cell-derived neurons. e-h, iPS cell-derived neurons expressing Opto-G3BP1 were stimulated with blue light for indicated times and co-immunostained with MAP2 and TDP-43 antibodies ( e ), MAP2 and A11 antibodies ( f ), MAP2 and p-TDP-43 (P01) antibodies ( g ), or p62 and ubiquitin antibodies ( h ). Images in e-h are representative of n = 3 independent experiments. Scale bars, 10 μm in all micrographs.

Article Snippet: Primary antibodies were anti-PABP (Abcam ab21060), anti-G3BP1 (BD Biosciences 6111126), anti-eIF4G (Santa Cruz Biotechnology sc-11373), anti-TDP-43 (Proteintech 12892-1-AP), anti-phospho-TDP-43 (M01) (Cosmo Bio CO TIP-PTD-MO1), anti-phospho-TDP-43 (P01) (Cosmo Bio CO TIP-PTD-PO1), anti-VCP (BD Biosciences 612183), anti-amyloid-oligomer A11 (Thermo Fisher Scientific AHB0052), anti-Ubiquitin (Dako, Z0458), anti-Ubiquitin (Santa Cruz Biotechnology sc-8017), anti-p62 (Abcam 56416), anti-MAP2 (Sigma M9942), anti-TIA1 (Santa Cruz Biotechnology sc-1751), anti-TIAR (BD Biosciences 610352), anti-eIF3η (Santa Cruz Biotechnology sc-16377), anti-ataxin 2 (Proteintech 21776-1-AP), and anti-GLE1 (Abcam 96007).

Techniques: Derivative Assay, Expressing