blunt Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78
    Thermo Fisher blunt ended sirnas
    Effect of combinatorial silencing of Ad5 genes on virus output. A549 cells were transfected with the indicated <t>siRNAs</t> either alone or in combination. SiRNA combinations for E1A (A), DNA polymerase (B), <t>pTP</t> (C), IVa2 (D), hexon (E), and protease (F) are depicted. For all transfections, the total concentration of siRNA was 10 nM. For combinations, each siRNA was employed at a concentration of 5 nM. As a control, cells were transfected with the individual siRNAs alone at a concentration of 10 nM, or as a mix of 5 nM targeting siRNA and 5 nM non-targeting negative control siRNA. Subsequently, cells were infected with Ad5 at an MOI of 0.01 TCID 50 /cell, and cells and supernatants were harvested at 48 h post-infection. Numbers of infectious Ad5 particles of triplicate infections were determined on A549 cells by TCID 50 assays (mean ± SD; n = 3).
    Blunt Ended Sirnas, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/blunt ended sirnas/product/Thermo Fisher
    Average 78 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    blunt ended sirnas - by Bioz Stars, 2019-10
    78/100 stars
      Buy from Supplier

    99
    Thermo Fisher zero blunt topo pcr cloning kit
    Schematic of targeting rAAV6 E6V homologous donor to the HBB locus. (A) The human HBB locus on chromosome 11 is depicted at the top of the schematic and consists of three exons (black boxes) and two introns. The rAAV6 E6V donor includes the glutamic acid (E) to valine (V) mutation at codon 6, which is the amino acid change causing sickle cell disease. Other SNPs (all SNPs are capitalized) were introduced to PAM site (blue) and sgRNA binding site (bold) to prevent recutting following HR in HSPCs. To analyze targeted integration frequencies in HSPCs, a 2-step <t>PCR</t> was performed. First, a 3400bp In-Out PCR (green) was performed followed by a nested 685bp PCR (purple) on a gel-purified fragment from the first PCR. This 2 nd PCR fragment was cloned into <t>TOPO</t> vectors, which were sequenced to determine the allele genotype (WT, INDEL, or HR). (B) The sequence of a wild-type HBB allele aligned with the sequence of an allele that has undergone HR. (C) Representative INDELs from the data represented in . The HBB reference sequence is shown in green. Figure 1d
    Zero Blunt Topo Pcr Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 5244 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zero blunt topo pcr cloning kit/product/Thermo Fisher
    Average 99 stars, based on 5244 article reviews
    Price from $9.99 to $1999.99
    zero blunt topo pcr cloning kit - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    TransGen biotech co peasy blunt simple cloning vector
    Detection of viral titers and cccDNA in mouse liver tissue. A. HBV <t>DNA</t> was detected in liver by qPCR. B. Detection of cccDNA by rolling circle amplification-PCR. Lane 1: 100 bp ladder; lane 2: <t>pEASY-HBV/HBeAg-negative</t> plasmid as the template; lane 3: linear HBV as the template. The pEASY-HBV/HBeAg-negative plasmid was digested by BspQI and the products served as a template; lane 4: experimental group at 21 days post-injection (dpi); lane 5: experimental group at 70 dpi; lane 6: circularized DNA served as the template.
    Peasy Blunt Simple Cloning Vector, supplied by TransGen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 120 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/peasy blunt simple cloning vector/product/TransGen biotech co
    Average 99 stars, based on 120 article reviews
    Price from $9.99 to $1999.99
    peasy blunt simple cloning vector - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher pcr blunt ii topo vector
    Expression of <t>efhc2</t> mRNA during zebrafish development. <t>RT-PCR</t> and whole embryo mRNA in situ hybridization (WISH) was carried out on different stages of zebrafish development. a RT-PCR analysis of efhc2 mRNA expression during zebrafish development. ef1α was used as loading control. b Ubiquitous expression of efhc2 at 6 hpf. c efhc2 expression in kupffer’s vesicle (KV) at 9 hpf. d Expression in the intermediate mesoderm (IM), notochord (NC) and otic vesicle (O) at 12 hpf. e Expression of efhc2 in olfactory placode (OP), pronephros (P), epiphysis (E), notochord (NC), otic vesicle (O) and in tailbud (TB) at 24 hpf. f Magnified image of zebrafish trunk show strong expression of efhc2 in PST and DE and low expression in PCT, DL and PD. g Dorsal view of 24 hpf embryos showing its expression in pronephros. h , i Two colour WISH of pdzk1 and efhc2 . J Section through trunk showing efhc2 expression in pronephros (P). k , l Expression of efhc2 in epiphysis, pronephros, notochord, otic vesicle and in tail bud at 36 and 48 hpf. (M) Expression of efhc2 in neuromast cells and olfactory placode at 72 hpf
    Pcr Blunt Ii Topo Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 3325 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr blunt ii topo vector/product/Thermo Fisher
    Average 99 stars, based on 3325 article reviews
    Price from $9.99 to $1999.99
    pcr blunt ii topo vector - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    87
    Qiagen pcr blunt ii topo vector
    DSBs occur at high frequency in S regions of both switching and non-switching B cells. In non-switching B cells, DSBs are blunt and 5'-phosphorylated; in GC B cells undergoing CSR, they include a high proportion of staggered <t>DNA</t> ends. Genomic DNA from freshly isolated human tonsil IgD+ CD38− , IgD+ CD38+ , IgD− CD38+ and IgD− CD38− B cells was treated with nil (T4−) or T4 pol (T4+) before being ligated with BW linker. Linker-ligated genomic DNA (8 ng from 1280 B cells) was serially two-fold diluted into unligated homologous genomic DNA and used as templates in <t>LM-PCR</t> to amplify blunt or total (blunt plus staggered) Sμ, Cμ, Pim1, Pax5 and Afp upstream DSB ends, and Sγ1 downstream DSB ends (lanes 1–8 in each panel). The amplified DNA was blotted and then probed with [γ-32 P]-ATP labeled gene-specific oligonucleotide probes. Germline Iμ-Cμ and Iγ1-Cγ1 transcripts, circle Iγ1-Cμ transcripts from switch Sμ-Sγ1 circles, mature VH DJH -Cδ and VH DJH -Cγ1, as well as Aid and β- actin transcripts were detected using specific RT-PCRs.
    Pcr Blunt Ii Topo Vector, supplied by Qiagen, used in various techniques. Bioz Stars score: 87/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr blunt ii topo vector/product/Qiagen
    Average 87 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    pcr blunt ii topo vector - by Bioz Stars, 2019-10
    87/100 stars
      Buy from Supplier

    80
    TransGen biotech co peasy blunt e1 expression vector
    Growth of E. coli expressing BjHMA4R . BL21 transformants contained a <t>pEASY-Blunt</t> <t>E1</t> expression vector (negative control) and BjHMA4R , respectively. The cultures were adjusted to an OD 600 of 1 and were serially diluted 10-fold in water. Five-microliter aliquots of each dilution were spotted either on nonselective LB plates or on LB plates supplemented with 600 μM CdCl 2 and 2.5 mM ZnCl 2, Ni(NO3) 2 , Co(NO3) 2 and Pb(NO3) 2 . After 1 day of incubation at 37 °C, the plates were imaged. The dilutions are indicated in the above figure, and three individual clones of each E. coli transformant were analyzed
    Peasy Blunt E1 Expression Vector, supplied by TransGen biotech co, used in various techniques. Bioz Stars score: 80/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/peasy blunt e1 expression vector/product/TransGen biotech co
    Average 80 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    peasy blunt e1 expression vector - by Bioz Stars, 2019-10
    80/100 stars
      Buy from Supplier

    79
    Illumina Inc telomeric blunt ends
    Telomere structure in DNA polymerase α mutants. (A) TRF analysis. (B,C) Quantification of G-overhang signal in pol α (B) and icu2-1 (C) mutants. The signals were normalized to the respective wild-type controls. Error bars represent SDs from three (wt-C24, pol α , wt-En-2) or four ( icu2-1 ) independent samples. (D) Detection of blunt-ended telomeres by the hairpin ligation assay [31] . Ligation of a blunt-ended hairpin to chromosome ends covalently links the complementary <t>telomeric</t> DNA strands. Such cross-linked strands were separated from bulk of TRFs by alkaline electrophoresis and detected by Southern hybridization with the (TTTAGGG) 4 probe. Control reactions without the hairpin and in which the hairpin was cleaved by Bam HI are shown. The arrow-heads indicate signal from the blunt-ended telomeres. Asterisks indicates signal from intrachromosomal telomeric DNA. (E) Frequency of telomeric sequence permutations forming the termini of blunt-ended telomeres. Error bars indicate SDs from four biological replicates.
    Telomeric Blunt Ends, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 79/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/telomeric blunt ends/product/Illumina Inc
    Average 79 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    telomeric blunt ends - by Bioz Stars, 2019-10
    79/100 stars
      Buy from Supplier

    77
    Ethicon blunt tip laparoscopic trocar
    In order to retrieve the object, a straight 35 mm <t>laparoscopic</t> grasper was introduced into the lumen and advanced under laparoscopic vision (arrow) in order to avoid iatrogenic injury to the mucosa.
    Blunt Tip Laparoscopic Trocar, supplied by Ethicon, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/blunt tip laparoscopic trocar/product/Ethicon
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    blunt tip laparoscopic trocar - by Bioz Stars, 2019-10
    77/100 stars
      Buy from Supplier

    Image Search Results


    Effect of combinatorial silencing of Ad5 genes on virus output. A549 cells were transfected with the indicated siRNAs either alone or in combination. SiRNA combinations for E1A (A), DNA polymerase (B), pTP (C), IVa2 (D), hexon (E), and protease (F) are depicted. For all transfections, the total concentration of siRNA was 10 nM. For combinations, each siRNA was employed at a concentration of 5 nM. As a control, cells were transfected with the individual siRNAs alone at a concentration of 10 nM, or as a mix of 5 nM targeting siRNA and 5 nM non-targeting negative control siRNA. Subsequently, cells were infected with Ad5 at an MOI of 0.01 TCID 50 /cell, and cells and supernatants were harvested at 48 h post-infection. Numbers of infectious Ad5 particles of triplicate infections were determined on A549 cells by TCID 50 assays (mean ± SD; n = 3).

    Journal: Antiviral Research

    Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery

    doi: 10.1016/j.antiviral.2012.03.011

    Figure Lengend Snippet: Effect of combinatorial silencing of Ad5 genes on virus output. A549 cells were transfected with the indicated siRNAs either alone or in combination. SiRNA combinations for E1A (A), DNA polymerase (B), pTP (C), IVa2 (D), hexon (E), and protease (F) are depicted. For all transfections, the total concentration of siRNA was 10 nM. For combinations, each siRNA was employed at a concentration of 5 nM. As a control, cells were transfected with the individual siRNAs alone at a concentration of 10 nM, or as a mix of 5 nM targeting siRNA and 5 nM non-targeting negative control siRNA. Subsequently, cells were infected with Ad5 at an MOI of 0.01 TCID 50 /cell, and cells and supernatants were harvested at 48 h post-infection. Numbers of infectious Ad5 particles of triplicate infections were determined on A549 cells by TCID 50 assays (mean ± SD; n = 3).

    Article Snippet: With the exception of pTP-si1 to pTP-si4, all siRNAs were 25-mer, blunt-ended siRNAs carrying the Invitrogen “Stealth” modification. pTP-si1 to pTP-si4 were 21-mer, unmodified siRNAs carrying 2 nt TT overhangs at their 3′ ends.

    Techniques: Transfection, Concentration Assay, Negative Control, Infection

    Differential inhibition of Ad5 replication by DNA polymerase siRNAs binding in the immediate vicinity of, or overlapping, the Pol-si2 target sequence. (A) Region of the DNA polymerase open reading frame (indicated as DNA pol) targeted by siRNAs Pol-si2, Pol-si4, Pol-si5, and Pol-si6. The DNA sequences corresponding to the individual siRNA target sites on the target mRNAs are given below. The nucleotides corresponding to the seed regions of the respective siRNAs are shaded in grey. (B) A549 cells were transfected with the viral DNA polymerase-directed siRNAs or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers from triplicate infections (mean ± SD; n = 3) were determined at 48 h post-infection by qPCR using E1A-specific primers. *** p

    Journal: Antiviral Research

    Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery

    doi: 10.1016/j.antiviral.2012.03.011

    Figure Lengend Snippet: Differential inhibition of Ad5 replication by DNA polymerase siRNAs binding in the immediate vicinity of, or overlapping, the Pol-si2 target sequence. (A) Region of the DNA polymerase open reading frame (indicated as DNA pol) targeted by siRNAs Pol-si2, Pol-si4, Pol-si5, and Pol-si6. The DNA sequences corresponding to the individual siRNA target sites on the target mRNAs are given below. The nucleotides corresponding to the seed regions of the respective siRNAs are shaded in grey. (B) A549 cells were transfected with the viral DNA polymerase-directed siRNAs or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers from triplicate infections (mean ± SD; n = 3) were determined at 48 h post-infection by qPCR using E1A-specific primers. *** p

    Article Snippet: With the exception of pTP-si1 to pTP-si4, all siRNAs were 25-mer, blunt-ended siRNAs carrying the Invitrogen “Stealth” modification. pTP-si1 to pTP-si4 were 21-mer, unmodified siRNAs carrying 2 nt TT overhangs at their 3′ ends.

    Techniques: Inhibition, Binding Assay, Sequencing, Transfection, Concentration Assay, Infection, Real-time Polymerase Chain Reaction

    Screening for functional siRNAs. SiRNAs and their respective dual-luciferase target vectors were used to co-transfect HEK293 cells (DNA polymerase, pTP, IVa2, hexon, and protease siRNAs) or A549 cells (E1A siRNAs). A non-targeting control siRNA served as a negative control (neg. ctrl.). All siRNAs were employed at a concentration of 30 nM. Renilla luciferase activities in relation to firefly luciferase activities were determined 48 h post-transfection. Relative light units (RLU; mean ± SD, n = 3) in comparison to a non-targeting control siRNA are shown. Differences between neg. ctrl. siRNA and targeting siRNAs were statistically significant in all cases ( p

    Journal: Antiviral Research

    Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery

    doi: 10.1016/j.antiviral.2012.03.011

    Figure Lengend Snippet: Screening for functional siRNAs. SiRNAs and their respective dual-luciferase target vectors were used to co-transfect HEK293 cells (DNA polymerase, pTP, IVa2, hexon, and protease siRNAs) or A549 cells (E1A siRNAs). A non-targeting control siRNA served as a negative control (neg. ctrl.). All siRNAs were employed at a concentration of 30 nM. Renilla luciferase activities in relation to firefly luciferase activities were determined 48 h post-transfection. Relative light units (RLU; mean ± SD, n = 3) in comparison to a non-targeting control siRNA are shown. Differences between neg. ctrl. siRNA and targeting siRNAs were statistically significant in all cases ( p

    Article Snippet: With the exception of pTP-si1 to pTP-si4, all siRNAs were 25-mer, blunt-ended siRNAs carrying the Invitrogen “Stealth” modification. pTP-si1 to pTP-si4 were 21-mer, unmodified siRNAs carrying 2 nt TT overhangs at their 3′ ends.

    Techniques: Functional Assay, Luciferase, Negative Control, Concentration Assay, Transfection

    Impact of siRNAs on viral DNA replication and virus spreading. (A) A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers were determined at 48 h post-infection by qPCR, using E1A-specific primers. Values represent mean ± SD of three independent experiments, each performed in triplicate. For each experiment, real-time qPCR quantification was performed in duplicate. * p

    Journal: Antiviral Research

    Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery

    doi: 10.1016/j.antiviral.2012.03.011

    Figure Lengend Snippet: Impact of siRNAs on viral DNA replication and virus spreading. (A) A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Virus genome copy numbers were determined at 48 h post-infection by qPCR, using E1A-specific primers. Values represent mean ± SD of three independent experiments, each performed in triplicate. For each experiment, real-time qPCR quantification was performed in duplicate. * p

    Article Snippet: With the exception of pTP-si1 to pTP-si4, all siRNAs were 25-mer, blunt-ended siRNAs carrying the Invitrogen “Stealth” modification. pTP-si1 to pTP-si4 were 21-mer, unmodified siRNAs carrying 2 nt TT overhangs at their 3′ ends.

    Techniques: Transfection, Concentration Assay, Infection, Real-time Polymerase Chain Reaction

    siRNAs decrease mRNA levels directly and indirectly. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Levels of direct targets (A) or indirect targets such as the E1A (B), DNA polymerase (C), pTP (D), and IVa2 (E) mRNAs were determined by RT-qPCR. Relative mRNA levels in comparison to a non-targeting siRNA are shown. Values represent mean ± SD of three independent experiments, each performed in triplicate. For each experiment, real-time qPCR quantification was performed in duplicate. * p

    Journal: Antiviral Research

    Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery

    doi: 10.1016/j.antiviral.2012.03.011

    Figure Lengend Snippet: siRNAs decrease mRNA levels directly and indirectly. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Levels of direct targets (A) or indirect targets such as the E1A (B), DNA polymerase (C), pTP (D), and IVa2 (E) mRNAs were determined by RT-qPCR. Relative mRNA levels in comparison to a non-targeting siRNA are shown. Values represent mean ± SD of three independent experiments, each performed in triplicate. For each experiment, real-time qPCR quantification was performed in duplicate. * p

    Article Snippet: With the exception of pTP-si1 to pTP-si4, all siRNAs were 25-mer, blunt-ended siRNAs carrying the Invitrogen “Stealth” modification. pTP-si1 to pTP-si4 were 21-mer, unmodified siRNAs carrying 2 nt TT overhangs at their 3′ ends.

    Techniques: Transfection, Concentration Assay, Infection, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

    siRNAs decrease the numbers of infectious virus particles. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Numbers of infectious virus particles at 48 h post-infection were determined on A549 cells by TCID 50 assays. Representative data from three independent experiments, each performed in triplicate, are shown (mean ± SD; n = 3). ** p

    Journal: Antiviral Research

    Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery

    doi: 10.1016/j.antiviral.2012.03.011

    Figure Lengend Snippet: siRNAs decrease the numbers of infectious virus particles. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 0.01 TCID 50 /cell. Numbers of infectious virus particles at 48 h post-infection were determined on A549 cells by TCID 50 assays. Representative data from three independent experiments, each performed in triplicate, are shown (mean ± SD; n = 3). ** p

    Article Snippet: With the exception of pTP-si1 to pTP-si4, all siRNAs were 25-mer, blunt-ended siRNAs carrying the Invitrogen “Stealth” modification. pTP-si1 to pTP-si4 were 21-mer, unmodified siRNAs carrying 2 nt TT overhangs at their 3′ ends.

    Techniques: Transfection, Concentration Assay, Infection

    SiRNAs increase the viability of infected cells. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 4 TCID 50 /cell. An MTS assay was performed at 6 days post-infection. The viability of cells from triplicate infection experiments (mean ± SD; n = 3) was calculated in relation to the viability of mock-infected cells. *** p

    Journal: Antiviral Research

    Article Title: Inhibition of adenovirus multiplication by short interfering RNAs directly or indirectly targeting the viral DNA replication machinery

    doi: 10.1016/j.antiviral.2012.03.011

    Figure Lengend Snippet: SiRNAs increase the viability of infected cells. A549 cells were transfected with siRNAs directed against the E1A, DNA polymerase (Pol), pTP, IVa2, hexon (Hex), and protease (Prot) genes, or a non-targeting control siRNA (neg. ctrl.) at a concentration of 10 nM, and then infected with Ad5 at an MOI of 4 TCID 50 /cell. An MTS assay was performed at 6 days post-infection. The viability of cells from triplicate infection experiments (mean ± SD; n = 3) was calculated in relation to the viability of mock-infected cells. *** p

    Article Snippet: With the exception of pTP-si1 to pTP-si4, all siRNAs were 25-mer, blunt-ended siRNAs carrying the Invitrogen “Stealth” modification. pTP-si1 to pTP-si4 were 21-mer, unmodified siRNAs carrying 2 nt TT overhangs at their 3′ ends.

    Techniques: Infection, Transfection, Concentration Assay, MTS Assay

    Schematic of targeting rAAV6 E6V homologous donor to the HBB locus. (A) The human HBB locus on chromosome 11 is depicted at the top of the schematic and consists of three exons (black boxes) and two introns. The rAAV6 E6V donor includes the glutamic acid (E) to valine (V) mutation at codon 6, which is the amino acid change causing sickle cell disease. Other SNPs (all SNPs are capitalized) were introduced to PAM site (blue) and sgRNA binding site (bold) to prevent recutting following HR in HSPCs. To analyze targeted integration frequencies in HSPCs, a 2-step PCR was performed. First, a 3400bp In-Out PCR (green) was performed followed by a nested 685bp PCR (purple) on a gel-purified fragment from the first PCR. This 2 nd PCR fragment was cloned into TOPO vectors, which were sequenced to determine the allele genotype (WT, INDEL, or HR). (B) The sequence of a wild-type HBB allele aligned with the sequence of an allele that has undergone HR. (C) Representative INDELs from the data represented in . The HBB reference sequence is shown in green. Figure 1d

    Journal:

    Article Title: CRISPR/Cas9 Beta-globin Gene Targeting in Human Hematopoietic Stem Cells

    doi: 10.1038/nature20134

    Figure Lengend Snippet: Schematic of targeting rAAV6 E6V homologous donor to the HBB locus. (A) The human HBB locus on chromosome 11 is depicted at the top of the schematic and consists of three exons (black boxes) and two introns. The rAAV6 E6V donor includes the glutamic acid (E) to valine (V) mutation at codon 6, which is the amino acid change causing sickle cell disease. Other SNPs (all SNPs are capitalized) were introduced to PAM site (blue) and sgRNA binding site (bold) to prevent recutting following HR in HSPCs. To analyze targeted integration frequencies in HSPCs, a 2-step PCR was performed. First, a 3400bp In-Out PCR (green) was performed followed by a nested 685bp PCR (purple) on a gel-purified fragment from the first PCR. This 2 nd PCR fragment was cloned into TOPO vectors, which were sequenced to determine the allele genotype (WT, INDEL, or HR). (B) The sequence of a wild-type HBB allele aligned with the sequence of an allele that has undergone HR. (C) Representative INDELs from the data represented in . The HBB reference sequence is shown in green. Figure 1d

    Article Snippet: The PCR product was gel-purified and re-amplified using a nested primer set ( HBB _nested_fw: 5’-GAAGATATGCTTAGAACCGAGG-3’ and HBB _nested_rw: 5’-CCACATGCCCAGTTTCTATTGG-3’) to create a 685bp PCR amplicon (see ) that was gel-purified and cloned into a TOPO plasmid using the Zero Blunt TOPO PCR Cloning Kit (Life Technologies) according to the manufacturer's protocol.

    Techniques: Mutagenesis, Binding Assay, Polymerase Chain Reaction, Purification, Clone Assay, Sequencing

    Correction of the E6V mutation in SCD patient-derived HSPCs. a) gDNA from HBB RNP-treated SCD-HSPCs was harvested and INDELs were analyzed via TIDE software (N=4 different SCD patient donors). b) HBB- targeted SCD-HSPCs were analyzed for GFP expression by flow cytometry (N=4 different SCD patient donors) c) SCD HSPCs were targeted with rAAV6 corrective SNP donor. HBB allele types were analyzed by sequencing of TOPO-cloned PCR fragments derived from In-Out PCR. 50-100 TOPO clones were analyzed from each of three different HSPC donors (N=3 different SCD patient donors). d) SCD HSPCs were targeted with anti-sickling HBB cDNA-EF1-tNGFR correction donor. Frequencies of tNGFR+ cells were analyzed by flow cytometry (N=3 different SCD patient donors). e) SCD Mock HSPCs and sorted SCD tNGFRhigh HSPCs were differentiated into erythrocytes in vitro. Representative FACS plots from Day 21 of differentiation show cell surface markers associated with erythrocytes (GPA+ /CD45- / CD71+ /CD34- ) f) HbS, HbA, and HbAS3 mRNA expression was quantified by RT-qPCR in erythrocytes differentiated from HBB -edited or Mock SCD HSPCs. All mRNA transcript levels were normalized to the RPLP0 input control (N=2-3 different SCD patient donors).

    Journal:

    Article Title: CRISPR/Cas9 Beta-globin Gene Targeting in Human Hematopoietic Stem Cells

    doi: 10.1038/nature20134

    Figure Lengend Snippet: Correction of the E6V mutation in SCD patient-derived HSPCs. a) gDNA from HBB RNP-treated SCD-HSPCs was harvested and INDELs were analyzed via TIDE software (N=4 different SCD patient donors). b) HBB- targeted SCD-HSPCs were analyzed for GFP expression by flow cytometry (N=4 different SCD patient donors) c) SCD HSPCs were targeted with rAAV6 corrective SNP donor. HBB allele types were analyzed by sequencing of TOPO-cloned PCR fragments derived from In-Out PCR. 50-100 TOPO clones were analyzed from each of three different HSPC donors (N=3 different SCD patient donors). d) SCD HSPCs were targeted with anti-sickling HBB cDNA-EF1-tNGFR correction donor. Frequencies of tNGFR+ cells were analyzed by flow cytometry (N=3 different SCD patient donors). e) SCD Mock HSPCs and sorted SCD tNGFRhigh HSPCs were differentiated into erythrocytes in vitro. Representative FACS plots from Day 21 of differentiation show cell surface markers associated with erythrocytes (GPA+ /CD45- / CD71+ /CD34- ) f) HbS, HbA, and HbAS3 mRNA expression was quantified by RT-qPCR in erythrocytes differentiated from HBB -edited or Mock SCD HSPCs. All mRNA transcript levels were normalized to the RPLP0 input control (N=2-3 different SCD patient donors).

    Article Snippet: The PCR product was gel-purified and re-amplified using a nested primer set ( HBB _nested_fw: 5’-GAAGATATGCTTAGAACCGAGG-3’ and HBB _nested_rw: 5’-CCACATGCCCAGTTTCTATTGG-3’) to create a 685bp PCR amplicon (see ) that was gel-purified and cloned into a TOPO plasmid using the Zero Blunt TOPO PCR Cloning Kit (Life Technologies) according to the manufacturer's protocol.

    Techniques: Mutagenesis, Derivative Assay, Software, Expressing, Flow Cytometry, Cytometry, Sequencing, Clone Assay, Polymerase Chain Reaction, In Vitro, FACS, Quantitative RT-PCR

    Recombinant AAV vectors can mediate homology-directed repair (HDR). a Schematic representation of the Tyr locus and location of sgRNA in exon 1. The orange and red lines mark the initiation and termination codons respectively. The green line indicates the location of the sgRNA used to target Tyr . b Strategy to introduce a premature stop codon in the Tyr locus using HDR. The 5′ and 3′ homology arms are marked by a thick line. A G to T nucleotide transversion in the PAM sequence converts a glycine codon (GGA) into a stop codon (TGA) disrupting translation of Tyr . Arrows indicate binding sites of the primers used in PCR-TOPO sequencing. c Strategy to insert the blue fluorescent protein (BFP) gene into the Tyr locus using HDR. Brown and purple arrows depict the binding sites of PCR primers used to confirm the insertion of BFP into Tyr locus. P2A, Porcine teschovirus-1 2A peptide; TAA, Stop codon. d Histogram showing the frequency of single-nucleotide transversion and BFP insertion by HDR using two different mixtures of rAAV vectors. e Analysis of single-nucleotide transversion in individual embryos or pups using PCR-TOPO sequencing. Each bar represents an individual sample. For pups, only DNA from tail snips and ear punches was analyzed. f Confirmation of BFP insertion using PCR. Four out of seven E3.5 embryos tested showed correct insertion of BFP into the Tyr locus. The top panel shows amplification of the 5′-junction of the targeted Tyr locus using a forward primer that binds to genomic DNA upstream of the homology region and a reverse primer that binds to the BFP gene as shown in ( c ). The bottom panel shows amplification of the 3′-junction of the Tyr- edited allele using a forward primer that binds to the BFP gene and a reverse primer that binds to genomic DNA downstream of the homology region

    Journal: Nature Communications

    Article Title: Streamlined ex vivo and in vivo genome editing in mouse embryos using recombinant adeno-associated viruses

    doi: 10.1038/s41467-017-02706-7

    Figure Lengend Snippet: Recombinant AAV vectors can mediate homology-directed repair (HDR). a Schematic representation of the Tyr locus and location of sgRNA in exon 1. The orange and red lines mark the initiation and termination codons respectively. The green line indicates the location of the sgRNA used to target Tyr . b Strategy to introduce a premature stop codon in the Tyr locus using HDR. The 5′ and 3′ homology arms are marked by a thick line. A G to T nucleotide transversion in the PAM sequence converts a glycine codon (GGA) into a stop codon (TGA) disrupting translation of Tyr . Arrows indicate binding sites of the primers used in PCR-TOPO sequencing. c Strategy to insert the blue fluorescent protein (BFP) gene into the Tyr locus using HDR. Brown and purple arrows depict the binding sites of PCR primers used to confirm the insertion of BFP into Tyr locus. P2A, Porcine teschovirus-1 2A peptide; TAA, Stop codon. d Histogram showing the frequency of single-nucleotide transversion and BFP insertion by HDR using two different mixtures of rAAV vectors. e Analysis of single-nucleotide transversion in individual embryos or pups using PCR-TOPO sequencing. Each bar represents an individual sample. For pups, only DNA from tail snips and ear punches was analyzed. f Confirmation of BFP insertion using PCR. Four out of seven E3.5 embryos tested showed correct insertion of BFP into the Tyr locus. The top panel shows amplification of the 5′-junction of the targeted Tyr locus using a forward primer that binds to genomic DNA upstream of the homology region and a reverse primer that binds to the BFP gene as shown in ( c ). The bottom panel shows amplification of the 3′-junction of the Tyr- edited allele using a forward primer that binds to the BFP gene and a reverse primer that binds to genomic DNA downstream of the homology region

    Article Snippet: Purified PCR product was cloned into the pCRTM -Blunt II-TOPO vector using Zero Blunt TOPO PCR Cloning Kit (Thermo Fisher Sci.

    Techniques: Recombinant, Introduce, Sequencing, Binding Assay, Polymerase Chain Reaction, Amplification

    KDM3A directly regulates KLF2 and IRF4 expression through H3K9 demethylation at their promoters in MM cells. ( a ) Heatmap depicting the relative gene expression in RPMI8226 cells transduced with two independent shRNAs targeting KDM3A (shKDM3A #1 and shKDM3A #2) or shLuc. A total of 305 probes were selected based on ≥1.5-fold downregulation in KDM3A -knockdown cells and clustered. ( b – d ) Quantitative real-time PCR ( b ) and immunoblot ( c , d ) analysis of KLF2 and IRF4 in RPMI8226 cells transduced with either shKDM3A or shLuc. After 3 days of infection, which is defined as day 0 in Fig. 2 , cells were harvested for isolation of total RNA or whole-cell lysates. ( b ) Values represent the amount of mRNA relative to shLuc, defined as 1. ( c ) Arrowhead represents KLF2. ( d ) Signal intensity of each immunoblot was quantified using the ImageJ software. Results were normalized by Actin and are shown as relative signal intensity (shLuc=1). Error bars represent s.e.m of three independent experiments. ( e , f ) Quantitative real-time PCR ( e ) and immunoblot ( f ) analysis of KLF2 and IRF4 in MM.1S and U266 cells transduced with either shKDM3A or shLuc. After 3 days of infection, cells were harvested for isolation of total RNA or whole-cell lysates. ( g ) ChIP analysis showing KDM3A occupancy on KLF2 and IRF4 core promoters in RPMI8226 cells. Results were normalized to control IgG. The MYOD1 promoter region was used as negative control. ( h ) KDM3A occupancy is abrogated by KDM3A knockdown on KLF2 and IRF4 promoter regions in RPMI8226 cells. RPMI8226 cells transduced with either shKDM3A or shLuc were used for ChIP, followed by quantitative real-time PCR. ( i ) Enrichment of H3K9 methylation by KDM3A knockdown on KLF2 and IRF4 promoter regions in RPMI8226 cells. ChIP assays were performed with RPMI8226 cells transduced with either shKDM3A or shLuc. The relative enrichment over the input was assessed. Results are shown as fold enrichment compared with control shLuc. For b , e , g – i , error bars represent s.d. of triplicate measurements. For b – i , data are representative of at least two independent experiments. ** P

    Journal: Nature Communications

    Article Title: The KDM3A–KLF2–IRF4 axis maintains myeloma cell survival

    doi: 10.1038/ncomms10258

    Figure Lengend Snippet: KDM3A directly regulates KLF2 and IRF4 expression through H3K9 demethylation at their promoters in MM cells. ( a ) Heatmap depicting the relative gene expression in RPMI8226 cells transduced with two independent shRNAs targeting KDM3A (shKDM3A #1 and shKDM3A #2) or shLuc. A total of 305 probes were selected based on ≥1.5-fold downregulation in KDM3A -knockdown cells and clustered. ( b – d ) Quantitative real-time PCR ( b ) and immunoblot ( c , d ) analysis of KLF2 and IRF4 in RPMI8226 cells transduced with either shKDM3A or shLuc. After 3 days of infection, which is defined as day 0 in Fig. 2 , cells were harvested for isolation of total RNA or whole-cell lysates. ( b ) Values represent the amount of mRNA relative to shLuc, defined as 1. ( c ) Arrowhead represents KLF2. ( d ) Signal intensity of each immunoblot was quantified using the ImageJ software. Results were normalized by Actin and are shown as relative signal intensity (shLuc=1). Error bars represent s.e.m of three independent experiments. ( e , f ) Quantitative real-time PCR ( e ) and immunoblot ( f ) analysis of KLF2 and IRF4 in MM.1S and U266 cells transduced with either shKDM3A or shLuc. After 3 days of infection, cells were harvested for isolation of total RNA or whole-cell lysates. ( g ) ChIP analysis showing KDM3A occupancy on KLF2 and IRF4 core promoters in RPMI8226 cells. Results were normalized to control IgG. The MYOD1 promoter region was used as negative control. ( h ) KDM3A occupancy is abrogated by KDM3A knockdown on KLF2 and IRF4 promoter regions in RPMI8226 cells. RPMI8226 cells transduced with either shKDM3A or shLuc were used for ChIP, followed by quantitative real-time PCR. ( i ) Enrichment of H3K9 methylation by KDM3A knockdown on KLF2 and IRF4 promoter regions in RPMI8226 cells. ChIP assays were performed with RPMI8226 cells transduced with either shKDM3A or shLuc. The relative enrichment over the input was assessed. Results are shown as fold enrichment compared with control shLuc. For b , e , g – i , error bars represent s.d. of triplicate measurements. For b – i , data are representative of at least two independent experiments. ** P

    Article Snippet: The human KLF2 cDNA was amplified using PCR and ligated into pCR-Blunt (Invitrogen), and then cloned into the EcoRI site of pcDNA3 (Invitrogen) or pMSCV retroviral expression vector (Clontech).

    Techniques: Expressing, Transduction, Real-time Polymerase Chain Reaction, Infection, Isolation, Software, Chromatin Immunoprecipitation, Negative Control, Methylation

    IRF4 is a direct transcriptional target of KLF2 in MM cells. ( a ) Microarray analysis in RPMI8226 cells transduced with shKDM3A, shKLF2 or shLuc was performed. The genes significantly downregulated by KDM3A or KLF2 knockdown compared with control were used as gene sets for the GSEA. Normalized enrichment score (NES) and P values are shown. ( b , c ) Quantitative real-time PCR of KLF2 and IRF4 after knockdown ( b ) and overexpression ( c ) of KLF2 in RPMI8226 cells. ( d ) Immunoblot analysis of KLF2 and IRF4 after knockdown of KLF2 in RPMI8226 cells. Shown are the relative signal intensity (shLuc=1) normalized by Actin. Error bars represent s.d. of two independent experiments. ( e ) RPMI8226 cells expressing the KLF2 cDNA carrying synonymous mutations in the shKLF2 #2 target sequence or empty vector were transduced with shKLF2 #2 or shLuc. Whole-cell lysates were subjected to immunoblot analysis. ( f ) Quantitative real-time PCR and immunoblot analysis of KLF2 and IRF4 after knockdown of KLF2 in MM.1S and U266 cells. ( g ) Transactivation of the IRF4 promoter by KLF2. The indicated amounts of KLF2 expression plasmids were transfected into 293T cells together with the human IRF4 promoter-luciferase reporter. The value above each bar indicates the induction level compared with empty vector. ( h ) 293T cells were co-transfected with the indicated IRF4 -luciferase reporter and 0.04 μg of KLF2 expression plasmid or empty vector, and then assayed for luciferase activity. The fold activation (normalized luciferase activity co-transfected with KLF2 expression plasmid relative to empty vector) is shown. ( i ) ChIP analysis showing KLF2 occupancy on IRF4 promoter in RPMI8226 cells. GAPDH promoter was used as negative control. ( j ) KLF2 occupancy is abrogated by KLF2 knockdown on IRF4 promoter in RPMI8226 cells. RPMI8226 cells transduced with either shKLF2 or shLuc were used for ChIP. For b , c , f , i , j , error bars represent s.d. of triplicate measurements. For g , h , data represent mean±s.d. of three ( g ) or two ( h ) biological replicates. For b – j , data are representative of at least two independent experiments. * P

    Journal: Nature Communications

    Article Title: The KDM3A–KLF2–IRF4 axis maintains myeloma cell survival

    doi: 10.1038/ncomms10258

    Figure Lengend Snippet: IRF4 is a direct transcriptional target of KLF2 in MM cells. ( a ) Microarray analysis in RPMI8226 cells transduced with shKDM3A, shKLF2 or shLuc was performed. The genes significantly downregulated by KDM3A or KLF2 knockdown compared with control were used as gene sets for the GSEA. Normalized enrichment score (NES) and P values are shown. ( b , c ) Quantitative real-time PCR of KLF2 and IRF4 after knockdown ( b ) and overexpression ( c ) of KLF2 in RPMI8226 cells. ( d ) Immunoblot analysis of KLF2 and IRF4 after knockdown of KLF2 in RPMI8226 cells. Shown are the relative signal intensity (shLuc=1) normalized by Actin. Error bars represent s.d. of two independent experiments. ( e ) RPMI8226 cells expressing the KLF2 cDNA carrying synonymous mutations in the shKLF2 #2 target sequence or empty vector were transduced with shKLF2 #2 or shLuc. Whole-cell lysates were subjected to immunoblot analysis. ( f ) Quantitative real-time PCR and immunoblot analysis of KLF2 and IRF4 after knockdown of KLF2 in MM.1S and U266 cells. ( g ) Transactivation of the IRF4 promoter by KLF2. The indicated amounts of KLF2 expression plasmids were transfected into 293T cells together with the human IRF4 promoter-luciferase reporter. The value above each bar indicates the induction level compared with empty vector. ( h ) 293T cells were co-transfected with the indicated IRF4 -luciferase reporter and 0.04 μg of KLF2 expression plasmid or empty vector, and then assayed for luciferase activity. The fold activation (normalized luciferase activity co-transfected with KLF2 expression plasmid relative to empty vector) is shown. ( i ) ChIP analysis showing KLF2 occupancy on IRF4 promoter in RPMI8226 cells. GAPDH promoter was used as negative control. ( j ) KLF2 occupancy is abrogated by KLF2 knockdown on IRF4 promoter in RPMI8226 cells. RPMI8226 cells transduced with either shKLF2 or shLuc were used for ChIP. For b , c , f , i , j , error bars represent s.d. of triplicate measurements. For g , h , data represent mean±s.d. of three ( g ) or two ( h ) biological replicates. For b – j , data are representative of at least two independent experiments. * P

    Article Snippet: The human KLF2 cDNA was amplified using PCR and ligated into pCR-Blunt (Invitrogen), and then cloned into the EcoRI site of pcDNA3 (Invitrogen) or pMSCV retroviral expression vector (Clontech).

    Techniques: Microarray, Transduction, Real-time Polymerase Chain Reaction, Over Expression, Expressing, Sequencing, Plasmid Preparation, Transfection, Luciferase, Activity Assay, Activation Assay, Chromatin Immunoprecipitation, Negative Control

    KLF2 is a direct target of IRF4 transactivation in MM cells. ( a , b ) Quantitative real-time PCR and immunoblot analysis of IRF4 and KLF2 in RPMI8226 ( a ), MM.1S and U266 ( b ) cells transduced with either shRNA targeting IRF4 (shIRF4) or shLuc. ( a , right panel) Shown are the relative signal intensity (shLuc=1) normalized by Actin. Error bars represent s.e.m. of three independent experiments. ( c ) Quantitative real-time PCR and immunoblot analysis of IRF4 and KLF2 after overexpression of IRF4 in RPMI8226 cells. ( d ) RPMI8226 cells expressing the IRF4 cDNA or empty vector were transduced with shIRF4 #1 that targets the 3′ untranslated region of IRF4 or shLuc by lentivirus. Whole-cell lysates were subjected to immunoblot analysis with antibodies against IRF4 and KLF2. ( e ) ChIP analysis showing IRF4 occupancy on KLF2 second intron in RPMI8226 cells. ChIP assays were performed for the regions that contain tandem IRF4 motifs on KLF2 promoter and intron (indicated PCR positions are relative to the transcriptional start site). Results were normalized to control IgG. The SUB1 promoter 29 or GAPDH promoter was used as positive or negative control, respectively. ( f ) Significant correlation between the genes downregulated by KLF2 knockdown and IRF4 knockdown in MM cells. The genes significantly downregulated by IRF4 knockdown 29 were used as gene set for GSEA. NES and P values are shown. For a (left panel), b , c , e , error bars represent s.d. of triplicate measurements. For a – e , data are representative of at least two independent experiments. ** P

    Journal: Nature Communications

    Article Title: The KDM3A–KLF2–IRF4 axis maintains myeloma cell survival

    doi: 10.1038/ncomms10258

    Figure Lengend Snippet: KLF2 is a direct target of IRF4 transactivation in MM cells. ( a , b ) Quantitative real-time PCR and immunoblot analysis of IRF4 and KLF2 in RPMI8226 ( a ), MM.1S and U266 ( b ) cells transduced with either shRNA targeting IRF4 (shIRF4) or shLuc. ( a , right panel) Shown are the relative signal intensity (shLuc=1) normalized by Actin. Error bars represent s.e.m. of three independent experiments. ( c ) Quantitative real-time PCR and immunoblot analysis of IRF4 and KLF2 after overexpression of IRF4 in RPMI8226 cells. ( d ) RPMI8226 cells expressing the IRF4 cDNA or empty vector were transduced with shIRF4 #1 that targets the 3′ untranslated region of IRF4 or shLuc by lentivirus. Whole-cell lysates were subjected to immunoblot analysis with antibodies against IRF4 and KLF2. ( e ) ChIP analysis showing IRF4 occupancy on KLF2 second intron in RPMI8226 cells. ChIP assays were performed for the regions that contain tandem IRF4 motifs on KLF2 promoter and intron (indicated PCR positions are relative to the transcriptional start site). Results were normalized to control IgG. The SUB1 promoter 29 or GAPDH promoter was used as positive or negative control, respectively. ( f ) Significant correlation between the genes downregulated by KLF2 knockdown and IRF4 knockdown in MM cells. The genes significantly downregulated by IRF4 knockdown 29 were used as gene set for GSEA. NES and P values are shown. For a (left panel), b , c , e , error bars represent s.d. of triplicate measurements. For a – e , data are representative of at least two independent experiments. ** P

    Article Snippet: The human KLF2 cDNA was amplified using PCR and ligated into pCR-Blunt (Invitrogen), and then cloned into the EcoRI site of pcDNA3 (Invitrogen) or pMSCV retroviral expression vector (Clontech).

    Techniques: Real-time Polymerase Chain Reaction, Transduction, shRNA, Over Expression, Expressing, Plasmid Preparation, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Negative Control

    Maspin knockout mice are ostensibly normal. ( a ) Comparison of maspin mRNA in adult wild-type (wt) and Cre-deleted knockout (ko) mice. Reverse transcriptase PCR analysis demonstrates products of predicted size (wt: 602 bp; ko: 455 bp), validated by DNA sequencing (see Fig. 1d ). ( b ) ko mice do not produce maspin protein, as assessed by immunoblotting using the anti-human maspin monoclonal antibody 13G11 or rabbit anti-peptide antibody H130. Validation of these antibodies is shown in Supplementary Fig. 1 . ( c ) Maspin ko skin lacks maspin in epidermal cells, as assessed by immunohistochemistry of samples from 8-week old mice, using 13G11. Scale bar, 30 μm.

    Journal: Nature Communications

    Article Title: Maspin is not required for embryonic development or tumour suppression

    doi: 10.1038/ncomms4164

    Figure Lengend Snippet: Maspin knockout mice are ostensibly normal. ( a ) Comparison of maspin mRNA in adult wild-type (wt) and Cre-deleted knockout (ko) mice. Reverse transcriptase PCR analysis demonstrates products of predicted size (wt: 602 bp; ko: 455 bp), validated by DNA sequencing (see Fig. 1d ). ( b ) ko mice do not produce maspin protein, as assessed by immunoblotting using the anti-human maspin monoclonal antibody 13G11 or rabbit anti-peptide antibody H130. Validation of these antibodies is shown in Supplementary Fig. 1 . ( c ) Maspin ko skin lacks maspin in epidermal cells, as assessed by immunohistochemistry of samples from 8-week old mice, using 13G11. Scale bar, 30 μm.

    Article Snippet: For the expression of maspin in 231 and 435 cells, a maspin cDNA was amplified by PCR using the oligonucleotide primers 5′-GGGAGATCTCATGGATGCCCTGCAACTAGC-3′ and 5′-CCCGCGGTTAAGGAGAACAGAATTTGCC-3′ and Taq DNA polymerase (New England Biolabs) for 25 cycles of 95 °C for 45 s, 55 °C for 45 s and 72 °C for 90 s. The resulting 1.15-kb product was cloned into pCR-Blunt (Invitrogen), confirmed to be maspin by sequencing, then released and purified as an Eco RI–Eco RI fragment.

    Techniques: Knock-Out, Mouse Assay, Gene Knockout, Polymerase Chain Reaction, DNA Sequencing, Immunohistochemistry

    Construction and validation of maspin knockout mice. ( a ) Structure of the maspin locus on mouse chromosome 1. ( b ) Diagrams of the maspin gene and predicted gene structure after insertion of the targeting vector ( Serpinb5 tm1Pib (targ)); deletion of exon 4 and the neomycin (neo) cassette after exposure to cre recombinase ( Serpinb5 tm1.1Pib (flox)) or deletion of the neo cassette alone after exposure to flp recombinase ( Serpinb5 tm1.2Pib (FLP)). Sequences cloned and used as external or internal (int.) probes (pr) are indicated. Coordinates are from the mouse genomic reference sequence GRCm38.p1 C57/BL6. ( c ) Validation of mouse genotypes by Southern blotting. DNA from wild type (wt) and Serpinb5 tm1Pib /Serpinb5 wt embryonic stem (ES) cells was used as a control. ( d ) Structure of maspin mRNA in ko tissue. RT–PCR product from mammary tissue was sequenced directly. Shown is a portion of the sequencing trace covering the deletion break point, with the nucleotide and inferred peptide sequences compared with the reference wt sequence below.

    Journal: Nature Communications

    Article Title: Maspin is not required for embryonic development or tumour suppression

    doi: 10.1038/ncomms4164

    Figure Lengend Snippet: Construction and validation of maspin knockout mice. ( a ) Structure of the maspin locus on mouse chromosome 1. ( b ) Diagrams of the maspin gene and predicted gene structure after insertion of the targeting vector ( Serpinb5 tm1Pib (targ)); deletion of exon 4 and the neomycin (neo) cassette after exposure to cre recombinase ( Serpinb5 tm1.1Pib (flox)) or deletion of the neo cassette alone after exposure to flp recombinase ( Serpinb5 tm1.2Pib (FLP)). Sequences cloned and used as external or internal (int.) probes (pr) are indicated. Coordinates are from the mouse genomic reference sequence GRCm38.p1 C57/BL6. ( c ) Validation of mouse genotypes by Southern blotting. DNA from wild type (wt) and Serpinb5 tm1Pib /Serpinb5 wt embryonic stem (ES) cells was used as a control. ( d ) Structure of maspin mRNA in ko tissue. RT–PCR product from mammary tissue was sequenced directly. Shown is a portion of the sequencing trace covering the deletion break point, with the nucleotide and inferred peptide sequences compared with the reference wt sequence below.

    Article Snippet: For the expression of maspin in 231 and 435 cells, a maspin cDNA was amplified by PCR using the oligonucleotide primers 5′-GGGAGATCTCATGGATGCCCTGCAACTAGC-3′ and 5′-CCCGCGGTTAAGGAGAACAGAATTTGCC-3′ and Taq DNA polymerase (New England Biolabs) for 25 cycles of 95 °C for 45 s, 55 °C for 45 s and 72 °C for 90 s. The resulting 1.15-kb product was cloned into pCR-Blunt (Invitrogen), confirmed to be maspin by sequencing, then released and purified as an Eco RI–Eco RI fragment.

    Techniques: Knock-Out, Mouse Assay, Plasmid Preparation, Clone Assay, Sequencing, Southern Blot, Gene Knockout, Reverse Transcription Polymerase Chain Reaction

    Role of three UPR sensors in DLL4 IRES translation activation by ER Stress. ( A ) HeLa cells were transfected with PERK, ATF6, IRE1 or control (Scr) siRNA. The knockdown efficiency of the targeted transcripts was determined by western blotting with PERK, IRE1 and β-ACTIN antibodies, and by semi-quantitative RT-PCR against ATF6 and GAPDH as a control. ( B ) Western blot analysis of phosphorylated eIF2α and total eIF2α and RT-PCR analysis of XBP1 splicing performed after transfection of HeLa cells either with siRNA specific for PERK, ATF6, or IRE1 or with control siRNA (Scr), after treatment with DTT. ( C ) Relative IRES activities in HeLa cells treated with DTT/control after co-transfection with siRNA specific for PERK, ATF6 or IRE1, or with control siRNA (scr) and DLL4 or EMCV bicistronic vectors. ( D ) Western blot analysis of phosphorylated eIF2α and total eIF2α and RT-PCR analysis of XBP1 splicing performed after transfection of HeLa cells with DLL4 or EMCV bicistronic vectors, after treatment with DTT and increasing concentration of the PERK inhibitor GSK2606414. ( E ) Western blot analysis of phosphorylated eIF2α and total eIF2α and RT-PCR analysis of XBP1 splicing performed after transfection of HeLa cells with DLL4 or EMCV bicistronic vectors, after treatment with increasing concentration of the PERK activator CCT020312. ( F ) Relative IRES activities in HeLa cells treated with DTT/control after transfection with DLL4 or EMCV bicistronic vectors and treatment with PERK activator (CCT020312) or inhibitor (GSK2606414). The results represent the means of three independent experiments (±SEM), * p

    Journal: Cancers

    Article Title: The PERK Branch of the Unfolded Protein Response Promotes DLL4 Expression by Activating an Alternative Translation Mechanism

    doi: 10.3390/cancers11020142

    Figure Lengend Snippet: Role of three UPR sensors in DLL4 IRES translation activation by ER Stress. ( A ) HeLa cells were transfected with PERK, ATF6, IRE1 or control (Scr) siRNA. The knockdown efficiency of the targeted transcripts was determined by western blotting with PERK, IRE1 and β-ACTIN antibodies, and by semi-quantitative RT-PCR against ATF6 and GAPDH as a control. ( B ) Western blot analysis of phosphorylated eIF2α and total eIF2α and RT-PCR analysis of XBP1 splicing performed after transfection of HeLa cells either with siRNA specific for PERK, ATF6, or IRE1 or with control siRNA (Scr), after treatment with DTT. ( C ) Relative IRES activities in HeLa cells treated with DTT/control after co-transfection with siRNA specific for PERK, ATF6 or IRE1, or with control siRNA (scr) and DLL4 or EMCV bicistronic vectors. ( D ) Western blot analysis of phosphorylated eIF2α and total eIF2α and RT-PCR analysis of XBP1 splicing performed after transfection of HeLa cells with DLL4 or EMCV bicistronic vectors, after treatment with DTT and increasing concentration of the PERK inhibitor GSK2606414. ( E ) Western blot analysis of phosphorylated eIF2α and total eIF2α and RT-PCR analysis of XBP1 splicing performed after transfection of HeLa cells with DLL4 or EMCV bicistronic vectors, after treatment with increasing concentration of the PERK activator CCT020312. ( F ) Relative IRES activities in HeLa cells treated with DTT/control after transfection with DLL4 or EMCV bicistronic vectors and treatment with PERK activator (CCT020312) or inhibitor (GSK2606414). The results represent the means of three independent experiments (±SEM), * p

    Article Snippet: DLL4 5′-UTR was amplified by PCR using Phusion High-Fidelity (New England Biolabs, Evry, France) polymerase using the primers DLL4+1-F and DLL4 ATG-R. PCR product was subcloned into the pCR™-Blunt shuttle vector (Thermo Fisher Scientific, Dardilly, France), which was sequenced and then cloned into a bicistronic vector using the SpeI and NcoI restriction sites to give the pCRD4L vector.

    Techniques: Activation Assay, Transfection, Western Blot, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction, Cotransfection, Concentration Assay

    The DLL4 IRES is activated by ER stress. HeLa cells were transfected by bicistronic constructs containing either the EMCV or the DLL4 IRES and treated or not for 6 h with increasing concentrations of DTT. ( A ) ER stress induction was verified by monitoring both cytoplasmic XBP1 splicing by RT-PCR and eIF2 phosphorylation by western blotting ( B ) Relative luciferase activities (LucR, LucF or LucF/LucR ratio) after ER stress induction by treatment with increasing amounts of DTT for 6 h. IRES activities were determined by calculating the LucF/LucR ratios and are expressed as fold change versus untreated cells. The results represent the means of three independent experiments (±SEM), ** p

    Journal: Cancers

    Article Title: The PERK Branch of the Unfolded Protein Response Promotes DLL4 Expression by Activating an Alternative Translation Mechanism

    doi: 10.3390/cancers11020142

    Figure Lengend Snippet: The DLL4 IRES is activated by ER stress. HeLa cells were transfected by bicistronic constructs containing either the EMCV or the DLL4 IRES and treated or not for 6 h with increasing concentrations of DTT. ( A ) ER stress induction was verified by monitoring both cytoplasmic XBP1 splicing by RT-PCR and eIF2 phosphorylation by western blotting ( B ) Relative luciferase activities (LucR, LucF or LucF/LucR ratio) after ER stress induction by treatment with increasing amounts of DTT for 6 h. IRES activities were determined by calculating the LucF/LucR ratios and are expressed as fold change versus untreated cells. The results represent the means of three independent experiments (±SEM), ** p

    Article Snippet: DLL4 5′-UTR was amplified by PCR using Phusion High-Fidelity (New England Biolabs, Evry, France) polymerase using the primers DLL4+1-F and DLL4 ATG-R. PCR product was subcloned into the pCR™-Blunt shuttle vector (Thermo Fisher Scientific, Dardilly, France), which was sequenced and then cloned into a bicistronic vector using the SpeI and NcoI restriction sites to give the pCRD4L vector.

    Techniques: Transfection, Construct, Reverse Transcription Polymerase Chain Reaction, Western Blot, Luciferase

    Generation of site #13 mutant mice. ( a ) Thymuses and livers isolated from E14.5 embryos were liberase-digested. Protein–DNA complexes were immunoprecipitated with goat anti-Foxn1 antibody (filled bars) or control IgG (open bars) and PCR-amplified for site #8 or site #13. Graph shows fold enrichment (means±s.e.m., n =9) of anti-Foxn1-precipitated signals normalized to the signals by control IgG. ( b ) CD45 − CD326 + UEA1 − CD249 + cTECs and CD45 − CD326 + UEA1 + CD249 − mTECs were isolated from 2-week-old C57BL/6 mice. Protein–DNA complexes were immunoprecipitated with anti-Foxn1 antibody (filled bars) or control IgG (open bars) and PCR-amplified for site #13 or site #18. Graph shows fold enrichment (means±s.e.m., n =3) of anti-Foxn1-precipitated signals normalized to the signals by control IgG. *** P

    Journal: Nature Communications

    Article Title: Foxn1-β5t transcriptional axis controls CD8+ T-cell production in the thymus

    doi: 10.1038/ncomms14419

    Figure Lengend Snippet: Generation of site #13 mutant mice. ( a ) Thymuses and livers isolated from E14.5 embryos were liberase-digested. Protein–DNA complexes were immunoprecipitated with goat anti-Foxn1 antibody (filled bars) or control IgG (open bars) and PCR-amplified for site #8 or site #13. Graph shows fold enrichment (means±s.e.m., n =9) of anti-Foxn1-precipitated signals normalized to the signals by control IgG. ( b ) CD45 − CD326 + UEA1 − CD249 + cTECs and CD45 − CD326 + UEA1 + CD249 − mTECs were isolated from 2-week-old C57BL/6 mice. Protein–DNA complexes were immunoprecipitated with anti-Foxn1 antibody (filled bars) or control IgG (open bars) and PCR-amplified for site #13 or site #18. Graph shows fold enrichment (means±s.e.m., n =3) of anti-Foxn1-precipitated signals normalized to the signals by control IgG. *** P

    Article Snippet: Full-length Foxn1 complementary DNA was PCR-amplified from C57BL/6 mouse cTECs by PrimeSTAR DNA polymerase (Takara) and cloned into pCR-blunt vector (Invitrogen) and into CMV-promoter-driven bicistronic ires-tdTomato-containing plasmid.

    Techniques: Mutagenesis, Mouse Assay, Isolation, Immunoprecipitation, Polymerase Chain Reaction, Amplification

    Foxn1 binds to β5t-proximal site #13. ( a ) Schematic diagram of the locations of 18 sites that contain the Foxn1-binding invariant core ACGC tetranucleotide within the 14-kb region proximal to β5t-encoding gene between two neighbouring genes in the mouse genome. Arrows indicate the orientation of the transcription. ( b ) Distances of the 18 sites from β5t translation initiation site are listed. The nucleotide sequences of those sites and their mismatches from the Foxn1-binding consensus 11-bp sequence previously reported 21 are also listed. ( c , d ) HEK293T cells were transfected with a vector that expressed Foxn1 and a plasmid that contained mouse genomic DNA fragment proximal to β5t-encoding gene, as illustrated schematically ( c ). Forty-eight hours after the transfection, formaldehyde-fixed cell lysates that contained protein–DNA complexes were immunoprecipitated with either goat anti-Foxn1 antibody (filled bars) or control IgG (open bars) and PCR-amplified for the indicated candidate sites of the Foxn1-binding sequences. Graphs show the frequency of immunoprecipitated DNA in input DNA (mean±s.e.m., n =5), which was sonicated at mild or strong amplitude ( d ). * P

    Journal: Nature Communications

    Article Title: Foxn1-β5t transcriptional axis controls CD8+ T-cell production in the thymus

    doi: 10.1038/ncomms14419

    Figure Lengend Snippet: Foxn1 binds to β5t-proximal site #13. ( a ) Schematic diagram of the locations of 18 sites that contain the Foxn1-binding invariant core ACGC tetranucleotide within the 14-kb region proximal to β5t-encoding gene between two neighbouring genes in the mouse genome. Arrows indicate the orientation of the transcription. ( b ) Distances of the 18 sites from β5t translation initiation site are listed. The nucleotide sequences of those sites and their mismatches from the Foxn1-binding consensus 11-bp sequence previously reported 21 are also listed. ( c , d ) HEK293T cells were transfected with a vector that expressed Foxn1 and a plasmid that contained mouse genomic DNA fragment proximal to β5t-encoding gene, as illustrated schematically ( c ). Forty-eight hours after the transfection, formaldehyde-fixed cell lysates that contained protein–DNA complexes were immunoprecipitated with either goat anti-Foxn1 antibody (filled bars) or control IgG (open bars) and PCR-amplified for the indicated candidate sites of the Foxn1-binding sequences. Graphs show the frequency of immunoprecipitated DNA in input DNA (mean±s.e.m., n =5), which was sonicated at mild or strong amplitude ( d ). * P

    Article Snippet: Full-length Foxn1 complementary DNA was PCR-amplified from C57BL/6 mouse cTECs by PrimeSTAR DNA polymerase (Takara) and cloned into pCR-blunt vector (Invitrogen) and into CMV-promoter-driven bicistronic ires-tdTomato-containing plasmid.

    Techniques: Binding Assay, Sequencing, Transfection, Plasmid Preparation, Immunoprecipitation, Polymerase Chain Reaction, Amplification, Sonication

    Construction of chimeric cDNA between pPVS-H-FL-β and pPVS-H-FL-H, and the infectivity of RNA transcripts. A unique Bsi WI restriction site was introduced by C5850G substitution without an amino acid change by PCR. Two chimeric cDNA clones between pPVS-H-FL-β and pPVS-H-FL-H were constructed by exchanging ORF1 sequence at the Bsi WI restriction site. The length of each poly(A) tail was determined by DNA sequence analysis. Capped RNA transcribed from each clone was used to inoculate N. occidentalis plants

    Journal: Virology Journal

    Article Title: Construction and characterization of an infectious cDNA clone of potato virus S developed from selected populations that survived genetic bottlenecks

    doi: 10.1186/s12985-019-1124-x

    Figure Lengend Snippet: Construction of chimeric cDNA between pPVS-H-FL-β and pPVS-H-FL-H, and the infectivity of RNA transcripts. A unique Bsi WI restriction site was introduced by C5850G substitution without an amino acid change by PCR. Two chimeric cDNA clones between pPVS-H-FL-β and pPVS-H-FL-H were constructed by exchanging ORF1 sequence at the Bsi WI restriction site. The length of each poly(A) tail was determined by DNA sequence analysis. Capped RNA transcribed from each clone was used to inoculate N. occidentalis plants

    Article Snippet: The 3′ terminal sequence downstream of the Sna BI site in pPVS-37P38M was replaced with that from pPVSH-37P3ESpe2, which was constructed by cloning the 3′ terminal half of PVS-H00 cDNA into a pCR-Blunt vector (Invitrogen, USA), resulting in the introduction of a unique Spe I restriction site immediately after the poly(A) tail comprising 66 adenines at the 3′ terminus (Fig. ).

    Techniques: Infection, Polymerase Chain Reaction, Clone Assay, Construct, Sequencing

    Schematic illustration of the construction of full-length cDNA clone of PVS-H00. Genome organization of PVS-H95 or PVS-H00 is shown at the top. The 3′ terminal half of PVS-H00 cDNA was amplified by PCR using PVS-37P and PVS-38 M as primers, and cloned to produce pPVS-37P38M. The 3′ terminal sequence downstream of the Sna BI restriction site in pPVS-H-37P38M was replaced with the 3′ terminal sequence containing a unique Spe I site immediately after the poly(A) tail of 66 adenine residues from pPVS-H-37P3ESpe2, which was a cDNA clone of PVS-H00. The 5′ terminal half of PVS-H00 cDNA was amplified by PCR using primers T7-PVS-H and PVS-37 M, and cloned to produce pPVS-T737 M. Finally, the 3′ terminal half of cDNA with the poly(A) tail and Spe I site from pPVS-H-37P38MSpe was connected with pPVS-T737 M via a unique Eco O65I site to produce the full-length cDNA clone pPVS-H-FL-β

    Journal: Virology Journal

    Article Title: Construction and characterization of an infectious cDNA clone of potato virus S developed from selected populations that survived genetic bottlenecks

    doi: 10.1186/s12985-019-1124-x

    Figure Lengend Snippet: Schematic illustration of the construction of full-length cDNA clone of PVS-H00. Genome organization of PVS-H95 or PVS-H00 is shown at the top. The 3′ terminal half of PVS-H00 cDNA was amplified by PCR using PVS-37P and PVS-38 M as primers, and cloned to produce pPVS-37P38M. The 3′ terminal sequence downstream of the Sna BI restriction site in pPVS-H-37P38M was replaced with the 3′ terminal sequence containing a unique Spe I site immediately after the poly(A) tail of 66 adenine residues from pPVS-H-37P3ESpe2, which was a cDNA clone of PVS-H00. The 5′ terminal half of PVS-H00 cDNA was amplified by PCR using primers T7-PVS-H and PVS-37 M, and cloned to produce pPVS-T737 M. Finally, the 3′ terminal half of cDNA with the poly(A) tail and Spe I site from pPVS-H-37P38MSpe was connected with pPVS-T737 M via a unique Eco O65I site to produce the full-length cDNA clone pPVS-H-FL-β

    Article Snippet: The 3′ terminal sequence downstream of the Sna BI site in pPVS-37P38M was replaced with that from pPVSH-37P3ESpe2, which was constructed by cloning the 3′ terminal half of PVS-H00 cDNA into a pCR-Blunt vector (Invitrogen, USA), resulting in the introduction of a unique Spe I restriction site immediately after the poly(A) tail comprising 66 adenines at the 3′ terminus (Fig. ).

    Techniques: Amplification, Polymerase Chain Reaction, Clone Assay, Sequencing

    Representative PCR enrichment of HEFs. ChIP was performed in HOXA13-FLAG, HOX (−) and HOXD13-FLAG cell lines using anti-FLAG agarose. PCR detection was performed using primers specific to each HEF, NEF1 and NEF2. NEF1 resulted in no detectable product for each cellular sample and NEF2 resulted in product with no detectable difference between the HOXA13-FLAG or HOXD13-FLAG cell lines and the HOX (−) cells. Water was used as a negative PCR control and input ChIP DNA from the HOX (−) cells was used as the positive PCR control.

    Journal: Nucleic Acids Research

    Article Title: A genomic approach to the identification and characterization of HOXA13 functional binding elements

    doi: 10.1093/nar/gki979

    Figure Lengend Snippet: Representative PCR enrichment of HEFs. ChIP was performed in HOXA13-FLAG, HOX (−) and HOXD13-FLAG cell lines using anti-FLAG agarose. PCR detection was performed using primers specific to each HEF, NEF1 and NEF2. NEF1 resulted in no detectable product for each cellular sample and NEF2 resulted in product with no detectable difference between the HOXA13-FLAG or HOXD13-FLAG cell lines and the HOX (−) cells. Water was used as a negative PCR control and input ChIP DNA from the HOX (−) cells was used as the positive PCR control.

    Article Snippet: Immunoprecipitated material was treated with T4 DNA polymerase and cloned into PCR-blunt vector (Invitrogen) in 2 µl total volume.

    Techniques: Polymerase Chain Reaction, Chromatin Immunoprecipitation

    Candidate HOXA13 binding sites in the Enpp2 upstream region are enriched in HOXA13-FLAG expressing cells. ( A ) Candidate in vivo binding sites for HOXA13 were identified upstream of the mouse Enpp2 translational start methionine (ATG) using in vitro core sequence variations ( 9 , 20 ) and are labeled with their position relative to the ATG. The plot resulting from an analysis using Advanced Pipmaker ( ) shows sequence conservation to the region upstream of the human Enpp2 start codon. The candidate HOXA13 binding sites' locations in the mouse sequence are shown as vertical colored lines. The site conserved between mouse and human is labeled in blue (B). Sites that were found in the mouse sequence but were not fully conserved to human are labeled in red (A and C). Candidate sites that were found in the human sequence but are not fully conserved in mouse are labeled in green. PCR primers were designed around each mouse candidate sites (A–C) as well as one additional sequence within the mouse Enpp2 promoter region without a putative HOXA13 binding motif (D). ( B ) Chromatin was prepared from HOXA13-FLAG expressing and HOX (−) cells and subjected to anti-FLAG ChIP. The DNA recovered from the ChIP experiments was used in PCR for the sites upstream of the Enpp2 mouse promoter (A–D). Reproducible enrichment ( n = 4) of sites ‘A’ and ‘B’ and to a lesser extent ‘C’ was observed in HOXA13-FLAG expressing cells. Site ‘D’ was not detectably enriched between cell lines.

    Journal: Nucleic Acids Research

    Article Title: A genomic approach to the identification and characterization of HOXA13 functional binding elements

    doi: 10.1093/nar/gki979

    Figure Lengend Snippet: Candidate HOXA13 binding sites in the Enpp2 upstream region are enriched in HOXA13-FLAG expressing cells. ( A ) Candidate in vivo binding sites for HOXA13 were identified upstream of the mouse Enpp2 translational start methionine (ATG) using in vitro core sequence variations ( 9 , 20 ) and are labeled with their position relative to the ATG. The plot resulting from an analysis using Advanced Pipmaker ( ) shows sequence conservation to the region upstream of the human Enpp2 start codon. The candidate HOXA13 binding sites' locations in the mouse sequence are shown as vertical colored lines. The site conserved between mouse and human is labeled in blue (B). Sites that were found in the mouse sequence but were not fully conserved to human are labeled in red (A and C). Candidate sites that were found in the human sequence but are not fully conserved in mouse are labeled in green. PCR primers were designed around each mouse candidate sites (A–C) as well as one additional sequence within the mouse Enpp2 promoter region without a putative HOXA13 binding motif (D). ( B ) Chromatin was prepared from HOXA13-FLAG expressing and HOX (−) cells and subjected to anti-FLAG ChIP. The DNA recovered from the ChIP experiments was used in PCR for the sites upstream of the Enpp2 mouse promoter (A–D). Reproducible enrichment ( n = 4) of sites ‘A’ and ‘B’ and to a lesser extent ‘C’ was observed in HOXA13-FLAG expressing cells. Site ‘D’ was not detectably enriched between cell lines.

    Article Snippet: Immunoprecipitated material was treated with T4 DNA polymerase and cloned into PCR-blunt vector (Invitrogen) in 2 µl total volume.

    Techniques: Binding Assay, Expressing, In Vivo, In Vitro, Sequencing, Labeling, Polymerase Chain Reaction, Chromatin Immunoprecipitation

    The knocked-in GalR1 -mCherry gene is expressed and correctly spliced in adult DRG by RT-PCR analysis. Wild-type control (lanes 3 and 4), heterozygous GalR1 -mCherry-[ neo + ] knock-in (lanes 5 and 6) and homozygous GalR1 -mCherry-[Δ neo ] knock-in mice (lanes 7 and 8) each expressed the correctly spliced product of GalR1 exons 1–3 coding sequences ( top panel , lanes 4, 6 and 8; 430 bp), whereas only knock-in mice express both the spliced product of GalR1 exons 1–3 fused to mCherry (637 bp) and mCherry to the heterologous 3′-UTR (431 bp) ( middle panels , lanes 6 and 8). Expression of neo was only detected in heterozygous GalR1 -mCherry-[ neo + ] knock-in mice ( bottom panel , lane 6; 630 bp). Knock-in mice were each of line 33. Lane 1 is a DNA ladder (1 kb Plus, Life Technologies) showing bands of 400, 500 and 650 bp; lane 2 is a water control; other even-numbered lanes are RT-PCRs using reverse transcribed RNA; and other odd-numbered lanes are corresponding reactions using RNA that has not been reverse transcribed (RT − controls), in which no products were detected.

    Journal: Molecular and Cellular Neurosciences

    Article Title: The generation of knock-in mice expressing fluorescently tagged galanin receptors 1 and 2

    doi: 10.1016/j.mcn.2015.08.006

    Figure Lengend Snippet: The knocked-in GalR1 -mCherry gene is expressed and correctly spliced in adult DRG by RT-PCR analysis. Wild-type control (lanes 3 and 4), heterozygous GalR1 -mCherry-[ neo + ] knock-in (lanes 5 and 6) and homozygous GalR1 -mCherry-[Δ neo ] knock-in mice (lanes 7 and 8) each expressed the correctly spliced product of GalR1 exons 1–3 coding sequences ( top panel , lanes 4, 6 and 8; 430 bp), whereas only knock-in mice express both the spliced product of GalR1 exons 1–3 fused to mCherry (637 bp) and mCherry to the heterologous 3′-UTR (431 bp) ( middle panels , lanes 6 and 8). Expression of neo was only detected in heterozygous GalR1 -mCherry-[ neo + ] knock-in mice ( bottom panel , lane 6; 630 bp). Knock-in mice were each of line 33. Lane 1 is a DNA ladder (1 kb Plus, Life Technologies) showing bands of 400, 500 and 650 bp; lane 2 is a water control; other even-numbered lanes are RT-PCRs using reverse transcribed RNA; and other odd-numbered lanes are corresponding reactions using RNA that has not been reverse transcribed (RT − controls), in which no products were detected.

    Article Snippet: Retrieval from the recombined BAC clones by gap repair ( ) into PCR-amplified vector pCR-Blunt (Invitrogen) was mediated by either GalR1 target sequences with adjacent introduced rare SwaI restriction sites, or GalR2 target sequences with adjacent introduced BstZ17I restriction sites.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Knock-In, Mouse Assay, Expressing

    Southern blot analysis of ES cell clones validates correct insertion of the GalR1 -mCherry-[ neo + ] targeting construct. (A) Schematic diagram of the knock-in GalR1 -mCherry-[ neo + ] allele showing the relative locations of: the targeting construct (grey horizontal thickened line); GalR1 exon 3 coding sequence (CDS; black filled box); mCherry CDS (diagonal banded box); the heterologous 3′-UTR (grey filled box); downstream FRT sites (right arrowheads) flanking an SV40- neo cassette selection marker; the endogenous 3′-UTR (UTR); restriction sites AseI (A), BsrGI (Bs), BamHI (B) and an introduced AseI restriction site immediately downstream of the 3′ FRT site ( A ); external 5′ and 3′ probes, neo probe, and hybridizing DNA fragments (see main article, Fig. 1 A, for corresponding diagram of the endogenous allele). (B) DNA from six potential heterozygous GalR1 -mCherry-[ neo + ] knock-in ES cell clones (33, 51, 63, 69, 93 and 97) and control wild-type mouse tail (wt) were digested and hybridized with: BsrGI and GalR1 5′ external probe (endogenous 7821 bp and knock-in 6158 bp; under-exposure for clone 93); AseI and GalR1 3′ external probe (endogenous 12,924 bp and knock-in 5386 bp); BamHI and neo probe (knock-in 3030 bp); or AseI and neo probe (knock-in 10,637 bp). The relative distance travelled by DNA ladder fragments (1 kb Plus, Life Technologies) are indicated in kb on the left of each panel. Neo was not detected in control wild-type mouse tail DNA, but an additional insertion of neo -hybridizing DNA was detected in ES cell clone 69 (arrowed) that was distinguishable from the correctly inserted knock-in fragment by digestion with BamHI or AseI. This additional neo insertion is due to only a fragment of introduced DNA ( Fig. 1 A, a grey horizontal thickened line), as the neo -hybridizing portion of AseI-digested DNA must be of at least 7366 bp which is larger than the additional hybridizing band of approximately 5500 bp, and quantitative genomic PCR detected only one copy of GalR1 -mCherry.

    Journal: Molecular and Cellular Neurosciences

    Article Title: The generation of knock-in mice expressing fluorescently tagged galanin receptors 1 and 2

    doi: 10.1016/j.mcn.2015.08.006

    Figure Lengend Snippet: Southern blot analysis of ES cell clones validates correct insertion of the GalR1 -mCherry-[ neo + ] targeting construct. (A) Schematic diagram of the knock-in GalR1 -mCherry-[ neo + ] allele showing the relative locations of: the targeting construct (grey horizontal thickened line); GalR1 exon 3 coding sequence (CDS; black filled box); mCherry CDS (diagonal banded box); the heterologous 3′-UTR (grey filled box); downstream FRT sites (right arrowheads) flanking an SV40- neo cassette selection marker; the endogenous 3′-UTR (UTR); restriction sites AseI (A), BsrGI (Bs), BamHI (B) and an introduced AseI restriction site immediately downstream of the 3′ FRT site ( A ); external 5′ and 3′ probes, neo probe, and hybridizing DNA fragments (see main article, Fig. 1 A, for corresponding diagram of the endogenous allele). (B) DNA from six potential heterozygous GalR1 -mCherry-[ neo + ] knock-in ES cell clones (33, 51, 63, 69, 93 and 97) and control wild-type mouse tail (wt) were digested and hybridized with: BsrGI and GalR1 5′ external probe (endogenous 7821 bp and knock-in 6158 bp; under-exposure for clone 93); AseI and GalR1 3′ external probe (endogenous 12,924 bp and knock-in 5386 bp); BamHI and neo probe (knock-in 3030 bp); or AseI and neo probe (knock-in 10,637 bp). The relative distance travelled by DNA ladder fragments (1 kb Plus, Life Technologies) are indicated in kb on the left of each panel. Neo was not detected in control wild-type mouse tail DNA, but an additional insertion of neo -hybridizing DNA was detected in ES cell clone 69 (arrowed) that was distinguishable from the correctly inserted knock-in fragment by digestion with BamHI or AseI. This additional neo insertion is due to only a fragment of introduced DNA ( Fig. 1 A, a grey horizontal thickened line), as the neo -hybridizing portion of AseI-digested DNA must be of at least 7366 bp which is larger than the additional hybridizing band of approximately 5500 bp, and quantitative genomic PCR detected only one copy of GalR1 -mCherry.

    Article Snippet: Retrieval from the recombined BAC clones by gap repair ( ) into PCR-amplified vector pCR-Blunt (Invitrogen) was mediated by either GalR1 target sequences with adjacent introduced rare SwaI restriction sites, or GalR2 target sequences with adjacent introduced BstZ17I restriction sites.

    Techniques: Southern Blot, Clone Assay, Construct, Knock-In, Sequencing, Selection, Marker, Polymerase Chain Reaction

    In Vivo Validation of Lentiviral CRISPR/cas9 Targeting of RPE Cells (A) Schematics of the experimental workflow for in vivo evaluation of genomic knockout. Subretinal injections of LV/Cas9-sgRNA1, LV/Cas9-sgRNA2, LV/Cas9-sgRNA3, or LV/Cas9-sgRNA-Irr in C57BL/6J mice, 8–9 weeks of age at day 0. Funduscopic eGFP assessment at days 14, 21, 28, and 35 PI. At day 35, PI mice were euthanized, and their retinas were dissected followed by FACS-mediated isolation of eGFP + RPE cells. Following PCR, amplification of gDNA Vegfa -specific amplicons was used for TIDE analysis and TOPO cloning. (B and C) Immunofluorescence assessment of eGFP expression in RPE following cryosectioning. At day 35 PI, non-injected control (control) mice (n = 3) and LV/Cas9-sgRNA1 (sgRNA1) subretinally injected C57BL/6J mice (n = 3) were euthanized, and the eyes were enucleated and fixated in PFA for cryosectioning. eGFP signals were evaluated following nuclear staining with DAPI. Scale bar, 20 μm. PFA, paraformaldehyde.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: In Vivo Knockout of the Vegfa Gene by Lentiviral Delivery of CRISPR/Cas9 in Mouse Retinal Pigment Epithelium Cells

    doi: 10.1016/j.omtn.2017.08.016

    Figure Lengend Snippet: In Vivo Validation of Lentiviral CRISPR/cas9 Targeting of RPE Cells (A) Schematics of the experimental workflow for in vivo evaluation of genomic knockout. Subretinal injections of LV/Cas9-sgRNA1, LV/Cas9-sgRNA2, LV/Cas9-sgRNA3, or LV/Cas9-sgRNA-Irr in C57BL/6J mice, 8–9 weeks of age at day 0. Funduscopic eGFP assessment at days 14, 21, 28, and 35 PI. At day 35, PI mice were euthanized, and their retinas were dissected followed by FACS-mediated isolation of eGFP + RPE cells. Following PCR, amplification of gDNA Vegfa -specific amplicons was used for TIDE analysis and TOPO cloning. (B and C) Immunofluorescence assessment of eGFP expression in RPE following cryosectioning. At day 35 PI, non-injected control (control) mice (n = 3) and LV/Cas9-sgRNA1 (sgRNA1) subretinally injected C57BL/6J mice (n = 3) were euthanized, and the eyes were enucleated and fixated in PFA for cryosectioning. eGFP signals were evaluated following nuclear staining with DAPI. Scale bar, 20 μm. PFA, paraformaldehyde.

    Article Snippet: Exon 3-specific amplicons of the Vegfa gene generated by PCR using gDNA obtained from eGFP+ FACS-sorted RPE cells from mice treated with LV/Cas9-sgRNA1, LV/Cas9-sgRNA2, or LV/Cas9-sgRNA3 were TOPO cloned into the pCR-Blunt-II-TOPO (Invitrogen, Taastrup, Denmark) vector and transformed in E. coli .

    Techniques: In Vivo, CRISPR, Knock-Out, Mouse Assay, FACS, Isolation, Polymerase Chain Reaction, Amplification, Clone Assay, Immunofluorescence, Expressing, Injection, Staining

    In Vivo Gene Editing following FACS Analysis (A–E) Following subretinal injection of LV/Cas9-sgRNA1 (n = 13), LV/Cas9-sgRNA2 (n = 5), LV/Cas9-sgRNA3 (n = 5), or LV/Cas9-sgRNA-Irr (n = 10) in C57BL/6J mice, animals were euthanized at day 35 PI, and the retinas were dissected. (A) FACS analysis of the resultant RPE cells. The RPE cells from all mice in each group were pooled before FACS analysis. Representative results from the FACS analysis (LV/Cas9-sgRNA3). No cells were excluded because of size (forward-scattered light [FSC]) or granularity (side-scattered light [SSC]). (B) Illustration of eGFP versus SSC FACS analysis (LV/Cas9-sgRNA3), including thresholds for eGFP + and eGFP − cells. Because of these criteria, cells were marked as eGFP + or eGFP − . (C) Numbers of FACS-mediated isolation of eGFP + RPE cells from the four groups resulted in LV/Cas9-sgRNA-Irr 10,285 cells (n = 10), LV/Cas9-Cas9-sgRNA1 11,554 cells (n = 10), LV/Cas9-sgRNA2 1,936 cells (n = 5), and LV/Cas9-sgRNA3 10,842 cells (n = 5). (D) Sequencing chromatograms of PCR amplicons following administration of LV/Cas9-sgRNA1, LV/Cas9-sgRNA2, or LV/Cas9-sgRNA3. Chromatograms were assessed for indels by TIDE in comparison to LV/Cas9-sgRNA-Irr. (E) Sequencing analysis of TOPO-cloned PCR amplicons obtained from FACS-isolated eGFP + RPE cells. PCR amplicons following delivery of LV/Cas9-sgRNA1, LV/Cas9-sgRNA2, or LV/Cas9-sgRNA3 were TOPO cloned into the pCR-Blunt-II-TOPO vector. Purified DNA samples were amplified by means of PCR and Vegfa exon 3-specific amplicons sequenced. The resultant sequences were designated with the number of sequences (1× by default), altered length, and overall indel formation frequency. The wild-type is shown in red; insertions and deletions are indicated in bold and cyan. Top: schematic overview of the three target sites in Vegfa exon 3. Blue arrows shown on top of the sequence represent the different Cas9-sgRNAs. PAM sequences are underlined and indicated beneath the sequence. PAM, protospacer-adjacent motif; FSC, forward-scattered light; SSC, side-scattered light.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: In Vivo Knockout of the Vegfa Gene by Lentiviral Delivery of CRISPR/Cas9 in Mouse Retinal Pigment Epithelium Cells

    doi: 10.1016/j.omtn.2017.08.016

    Figure Lengend Snippet: In Vivo Gene Editing following FACS Analysis (A–E) Following subretinal injection of LV/Cas9-sgRNA1 (n = 13), LV/Cas9-sgRNA2 (n = 5), LV/Cas9-sgRNA3 (n = 5), or LV/Cas9-sgRNA-Irr (n = 10) in C57BL/6J mice, animals were euthanized at day 35 PI, and the retinas were dissected. (A) FACS analysis of the resultant RPE cells. The RPE cells from all mice in each group were pooled before FACS analysis. Representative results from the FACS analysis (LV/Cas9-sgRNA3). No cells were excluded because of size (forward-scattered light [FSC]) or granularity (side-scattered light [SSC]). (B) Illustration of eGFP versus SSC FACS analysis (LV/Cas9-sgRNA3), including thresholds for eGFP + and eGFP − cells. Because of these criteria, cells were marked as eGFP + or eGFP − . (C) Numbers of FACS-mediated isolation of eGFP + RPE cells from the four groups resulted in LV/Cas9-sgRNA-Irr 10,285 cells (n = 10), LV/Cas9-Cas9-sgRNA1 11,554 cells (n = 10), LV/Cas9-sgRNA2 1,936 cells (n = 5), and LV/Cas9-sgRNA3 10,842 cells (n = 5). (D) Sequencing chromatograms of PCR amplicons following administration of LV/Cas9-sgRNA1, LV/Cas9-sgRNA2, or LV/Cas9-sgRNA3. Chromatograms were assessed for indels by TIDE in comparison to LV/Cas9-sgRNA-Irr. (E) Sequencing analysis of TOPO-cloned PCR amplicons obtained from FACS-isolated eGFP + RPE cells. PCR amplicons following delivery of LV/Cas9-sgRNA1, LV/Cas9-sgRNA2, or LV/Cas9-sgRNA3 were TOPO cloned into the pCR-Blunt-II-TOPO vector. Purified DNA samples were amplified by means of PCR and Vegfa exon 3-specific amplicons sequenced. The resultant sequences were designated with the number of sequences (1× by default), altered length, and overall indel formation frequency. The wild-type is shown in red; insertions and deletions are indicated in bold and cyan. Top: schematic overview of the three target sites in Vegfa exon 3. Blue arrows shown on top of the sequence represent the different Cas9-sgRNAs. PAM sequences are underlined and indicated beneath the sequence. PAM, protospacer-adjacent motif; FSC, forward-scattered light; SSC, side-scattered light.

    Article Snippet: Exon 3-specific amplicons of the Vegfa gene generated by PCR using gDNA obtained from eGFP+ FACS-sorted RPE cells from mice treated with LV/Cas9-sgRNA1, LV/Cas9-sgRNA2, or LV/Cas9-sgRNA3 were TOPO cloned into the pCR-Blunt-II-TOPO (Invitrogen, Taastrup, Denmark) vector and transformed in E. coli .

    Techniques: In Vivo, FACS, Injection, Mouse Assay, Isolation, Sequencing, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Purification, Amplification

    Alternative TAPBPR transcripts. (a, b) TAPBPR was amplified from cDNA generated from the indicated cell lines using primers specific for exon 1 and exon 7 of TAPBPR. The PCR products were cloned into the pCR-blunt-II TOPO vector and colonies containing inserts were identified by PCR using primers Sp6 and T7. A selection of colonies was further screened by sequence analysis. PCR products identified as alternative TAPBPR isoforms are highlighted with a symbol on the PCR screen. (c) Exon structure of seven human TAPBPR transcripts. cDNA sequences were aligned against human TAPBPL gene on chromosome 12p13.3 (OMIM:607081) using spidey mRNA genomic alignment software ( http://www.ncbi.nlm.nih.gov/spidey/ ) using default settings. The transcript for TAPBPR α has previously been reported (NM_018009.4). β , γ , δ , ε , ζ , η mRNA products have not been described previously.

    Journal: Immunology

    Article Title: TAPBPR isoforms exhibit altered association with MHC class I

    doi: 10.1111/imm.12253

    Figure Lengend Snippet: Alternative TAPBPR transcripts. (a, b) TAPBPR was amplified from cDNA generated from the indicated cell lines using primers specific for exon 1 and exon 7 of TAPBPR. The PCR products were cloned into the pCR-blunt-II TOPO vector and colonies containing inserts were identified by PCR using primers Sp6 and T7. A selection of colonies was further screened by sequence analysis. PCR products identified as alternative TAPBPR isoforms are highlighted with a symbol on the PCR screen. (c) Exon structure of seven human TAPBPR transcripts. cDNA sequences were aligned against human TAPBPL gene on chromosome 12p13.3 (OMIM:607081) using spidey mRNA genomic alignment software ( http://www.ncbi.nlm.nih.gov/spidey/ ) using default settings. The transcript for TAPBPR α has previously been reported (NM_018009.4). β , γ , δ , ε , ζ , η mRNA products have not been described previously.

    Article Snippet: Blunt TAPBPL PCR products obtained as above were ligated into pCR®-Blunt II TOPO® (Invitrogen, Carlsbad, CA) as per the manufacturer's instructions.

    Techniques: Amplification, Generated, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Selection, Sequencing, Software

    Detection of alternative TAPBPR transcript in peripheral blood mononuclear cells (PBMCs) and dendritic cells (DCs). TAPBPR was amplified from cDNA generated from PBMCs and DCs treated as indicated using primers specific for exon 1 and exon7 of TAPBPR. The PCR products were cloned into the pCR-blunt-II TOPO vector and colonies containing inserts were identified by PCR using primers Sp6 and T7. A selection of colonies was further screened by sequence analysis. Sequenced inserts are highlighted with a symbol above indicating the TAPBPR transcript identified. δ + contains bridged exon 4 and an alternative exon 7b which at a protein levels looks identical to delta. δ * contains bridged exon 4 and exon 7b which at a protein level looks identical to δ .

    Journal: Immunology

    Article Title: TAPBPR isoforms exhibit altered association with MHC class I

    doi: 10.1111/imm.12253

    Figure Lengend Snippet: Detection of alternative TAPBPR transcript in peripheral blood mononuclear cells (PBMCs) and dendritic cells (DCs). TAPBPR was amplified from cDNA generated from PBMCs and DCs treated as indicated using primers specific for exon 1 and exon7 of TAPBPR. The PCR products were cloned into the pCR-blunt-II TOPO vector and colonies containing inserts were identified by PCR using primers Sp6 and T7. A selection of colonies was further screened by sequence analysis. Sequenced inserts are highlighted with a symbol above indicating the TAPBPR transcript identified. δ + contains bridged exon 4 and an alternative exon 7b which at a protein levels looks identical to delta. δ * contains bridged exon 4 and exon 7b which at a protein level looks identical to δ .

    Article Snippet: Blunt TAPBPL PCR products obtained as above were ligated into pCR®-Blunt II TOPO® (Invitrogen, Carlsbad, CA) as per the manufacturer's instructions.

    Techniques: Amplification, Generated, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Selection, Sequencing

    Detection of viral titers and cccDNA in mouse liver tissue. A. HBV DNA was detected in liver by qPCR. B. Detection of cccDNA by rolling circle amplification-PCR. Lane 1: 100 bp ladder; lane 2: pEASY-HBV/HBeAg-negative plasmid as the template; lane 3: linear HBV as the template. The pEASY-HBV/HBeAg-negative plasmid was digested by BspQI and the products served as a template; lane 4: experimental group at 21 days post-injection (dpi); lane 5: experimental group at 70 dpi; lane 6: circularized DNA served as the template.

    Journal: PLoS ONE

    Article Title: A new model mimicking persistent HBV e antigen-negative infection using covalently closed circular DNA in immunocompetent mice

    doi: 10.1371/journal.pone.0175992

    Figure Lengend Snippet: Detection of viral titers and cccDNA in mouse liver tissue. A. HBV DNA was detected in liver by qPCR. B. Detection of cccDNA by rolling circle amplification-PCR. Lane 1: 100 bp ladder; lane 2: pEASY-HBV/HBeAg-negative plasmid as the template; lane 3: linear HBV as the template. The pEASY-HBV/HBeAg-negative plasmid was digested by BspQI and the products served as a template; lane 4: experimental group at 21 days post-injection (dpi); lane 5: experimental group at 70 dpi; lane 6: circularized DNA served as the template.

    Article Snippet: Subsequently, full-length DNA from the HBeAg-negative virus was cloned into the pEASY-Blunt Simple Cloning vector (TransGen Biotech, Beijing, China).

    Techniques: Real-time Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Injection

    Identification of the viral strain. (A) Results of genotype identification: red, green, blue, and black peaks indicate the bases T, A, G, and C, respectively. (B) The BLAST sequence search using PubMed. JX661478.1 is from GenBank. Sample 11061008 is the sequence of the pEASY-HBV/HBeAg-negative plasmid. (C) Amino acid sequence of the protein BLAST. JX661478.1 is the partial sequence of the e protein from GenBank. Sample 11061008 is the partial sequence of the e protein in the pEASY-HBV/HBeAg-negative plasmid.

    Journal: PLoS ONE

    Article Title: A new model mimicking persistent HBV e antigen-negative infection using covalently closed circular DNA in immunocompetent mice

    doi: 10.1371/journal.pone.0175992

    Figure Lengend Snippet: Identification of the viral strain. (A) Results of genotype identification: red, green, blue, and black peaks indicate the bases T, A, G, and C, respectively. (B) The BLAST sequence search using PubMed. JX661478.1 is from GenBank. Sample 11061008 is the sequence of the pEASY-HBV/HBeAg-negative plasmid. (C) Amino acid sequence of the protein BLAST. JX661478.1 is the partial sequence of the e protein from GenBank. Sample 11061008 is the partial sequence of the e protein in the pEASY-HBV/HBeAg-negative plasmid.

    Article Snippet: Subsequently, full-length DNA from the HBeAg-negative virus was cloned into the pEASY-Blunt Simple Cloning vector (TransGen Biotech, Beijing, China).

    Techniques: Sequencing, Plasmid Preparation

    Expression of efhc2 mRNA during zebrafish development. RT-PCR and whole embryo mRNA in situ hybridization (WISH) was carried out on different stages of zebrafish development. a RT-PCR analysis of efhc2 mRNA expression during zebrafish development. ef1α was used as loading control. b Ubiquitous expression of efhc2 at 6 hpf. c efhc2 expression in kupffer’s vesicle (KV) at 9 hpf. d Expression in the intermediate mesoderm (IM), notochord (NC) and otic vesicle (O) at 12 hpf. e Expression of efhc2 in olfactory placode (OP), pronephros (P), epiphysis (E), notochord (NC), otic vesicle (O) and in tailbud (TB) at 24 hpf. f Magnified image of zebrafish trunk show strong expression of efhc2 in PST and DE and low expression in PCT, DL and PD. g Dorsal view of 24 hpf embryos showing its expression in pronephros. h , i Two colour WISH of pdzk1 and efhc2 . J Section through trunk showing efhc2 expression in pronephros (P). k , l Expression of efhc2 in epiphysis, pronephros, notochord, otic vesicle and in tail bud at 36 and 48 hpf. (M) Expression of efhc2 in neuromast cells and olfactory placode at 72 hpf

    Journal: Cell & Bioscience

    Article Title: EF-hand domain containing 2 (Efhc2) is crucial for distal segmentation of pronephros in zebrafish

    doi: 10.1186/s13578-018-0253-z

    Figure Lengend Snippet: Expression of efhc2 mRNA during zebrafish development. RT-PCR and whole embryo mRNA in situ hybridization (WISH) was carried out on different stages of zebrafish development. a RT-PCR analysis of efhc2 mRNA expression during zebrafish development. ef1α was used as loading control. b Ubiquitous expression of efhc2 at 6 hpf. c efhc2 expression in kupffer’s vesicle (KV) at 9 hpf. d Expression in the intermediate mesoderm (IM), notochord (NC) and otic vesicle (O) at 12 hpf. e Expression of efhc2 in olfactory placode (OP), pronephros (P), epiphysis (E), notochord (NC), otic vesicle (O) and in tailbud (TB) at 24 hpf. f Magnified image of zebrafish trunk show strong expression of efhc2 in PST and DE and low expression in PCT, DL and PD. g Dorsal view of 24 hpf embryos showing its expression in pronephros. h , i Two colour WISH of pdzk1 and efhc2 . J Section through trunk showing efhc2 expression in pronephros (P). k , l Expression of efhc2 in epiphysis, pronephros, notochord, otic vesicle and in tail bud at 36 and 48 hpf. (M) Expression of efhc2 in neuromast cells and olfactory placode at 72 hpf

    Article Snippet: Additional file 1: Figure S1. efhc2 -Mo inhibits pre-mRNA splicing. (A) Schematic representation of zebrafish efhc2 exon/intron organization, the target site of the splice-blocking efhc2 morpholino (efhc2 -Mo) and the forward and reverse primers used in RT-PCR for amplification of efhc2 . (B) cDNA was prepared from embryos injected with efhc2 -Mo and efhc2 -MM, PCR amplified, cloned into pCR Blunt II Topo vector (Invitrogen) and sequenced using SP6 and T7 primers.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, In Situ Hybridization

    Effect of Efhc2 knock-down on pronephros development and function. a Schematic representation of the binding of the splice-blocking efhc2 morpholino ( efhc2 -MO) targeting exon-3 and the forward and reverse primers used in RT-PCR to verify its effect. RT-PCR on RNA extracted from 24 hpf uninjected embryos or embryos injected with efhc2 -MM control showed a 651 bp product as expected. The embryos injected with efhc2 -MO showed a 311 bp fragment confirming the blocking of normal splicing of efhc2 by this morpholino. b efhc2 -Mo morphants showed morpholino dose-dependent developmental defects as compared with wild-type and mismatch controls. Arrow indicates mild pericardial oedema and arrowhead indicates hydrocephalus. c Fluorescent 40 kDa dextran was injected into cardinal vain of control and efhc2 -Mo morphants at 48 hpf. Accumulation of dextran in yolk and oedema shows defects in pronephros function in efhc2 -Mo morphants at 72 and 96 hpf

    Journal: Cell & Bioscience

    Article Title: EF-hand domain containing 2 (Efhc2) is crucial for distal segmentation of pronephros in zebrafish

    doi: 10.1186/s13578-018-0253-z

    Figure Lengend Snippet: Effect of Efhc2 knock-down on pronephros development and function. a Schematic representation of the binding of the splice-blocking efhc2 morpholino ( efhc2 -MO) targeting exon-3 and the forward and reverse primers used in RT-PCR to verify its effect. RT-PCR on RNA extracted from 24 hpf uninjected embryos or embryos injected with efhc2 -MM control showed a 651 bp product as expected. The embryos injected with efhc2 -MO showed a 311 bp fragment confirming the blocking of normal splicing of efhc2 by this morpholino. b efhc2 -Mo morphants showed morpholino dose-dependent developmental defects as compared with wild-type and mismatch controls. Arrow indicates mild pericardial oedema and arrowhead indicates hydrocephalus. c Fluorescent 40 kDa dextran was injected into cardinal vain of control and efhc2 -Mo morphants at 48 hpf. Accumulation of dextran in yolk and oedema shows defects in pronephros function in efhc2 -Mo morphants at 72 and 96 hpf

    Article Snippet: Additional file 1: Figure S1. efhc2 -Mo inhibits pre-mRNA splicing. (A) Schematic representation of zebrafish efhc2 exon/intron organization, the target site of the splice-blocking efhc2 morpholino (efhc2 -Mo) and the forward and reverse primers used in RT-PCR for amplification of efhc2 . (B) cDNA was prepared from embryos injected with efhc2 -Mo and efhc2 -MM, PCR amplified, cloned into pCR Blunt II Topo vector (Invitrogen) and sequenced using SP6 and T7 primers.

    Techniques: Binding Assay, Blocking Assay, Reverse Transcription Polymerase Chain Reaction, Injection

    DSBs occur at high frequency in S regions of both switching and non-switching B cells. In non-switching B cells, DSBs are blunt and 5'-phosphorylated; in GC B cells undergoing CSR, they include a high proportion of staggered DNA ends. Genomic DNA from freshly isolated human tonsil IgD+ CD38− , IgD+ CD38+ , IgD− CD38+ and IgD− CD38− B cells was treated with nil (T4−) or T4 pol (T4+) before being ligated with BW linker. Linker-ligated genomic DNA (8 ng from 1280 B cells) was serially two-fold diluted into unligated homologous genomic DNA and used as templates in LM-PCR to amplify blunt or total (blunt plus staggered) Sμ, Cμ, Pim1, Pax5 and Afp upstream DSB ends, and Sγ1 downstream DSB ends (lanes 1–8 in each panel). The amplified DNA was blotted and then probed with [γ-32 P]-ATP labeled gene-specific oligonucleotide probes. Germline Iμ-Cμ and Iγ1-Cγ1 transcripts, circle Iγ1-Cμ transcripts from switch Sμ-Sγ1 circles, mature VH DJH -Cδ and VH DJH -Cγ1, as well as Aid and β- actin transcripts were detected using specific RT-PCRs.

    Journal:

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID

    doi: 10.1016/j.molimm.2008.07.003

    Figure Lengend Snippet: DSBs occur at high frequency in S regions of both switching and non-switching B cells. In non-switching B cells, DSBs are blunt and 5'-phosphorylated; in GC B cells undergoing CSR, they include a high proportion of staggered DNA ends. Genomic DNA from freshly isolated human tonsil IgD+ CD38− , IgD+ CD38+ , IgD− CD38+ and IgD− CD38− B cells was treated with nil (T4−) or T4 pol (T4+) before being ligated with BW linker. Linker-ligated genomic DNA (8 ng from 1280 B cells) was serially two-fold diluted into unligated homologous genomic DNA and used as templates in LM-PCR to amplify blunt or total (blunt plus staggered) Sμ, Cμ, Pim1, Pax5 and Afp upstream DSB ends, and Sγ1 downstream DSB ends (lanes 1–8 in each panel). The amplified DNA was blotted and then probed with [γ-32 P]-ATP labeled gene-specific oligonucleotide probes. Germline Iμ-Cμ and Iγ1-Cγ1 transcripts, circle Iγ1-Cμ transcripts from switch Sμ-Sγ1 circles, mature VH DJH -Cδ and VH DJH -Cγ1, as well as Aid and β- actin transcripts were detected using specific RT-PCRs.

    Article Snippet: To analyze DNA-dC deamination, the 59 bp DNA fragment 5'-AGCT GGCAGGCTAGCAAGTTGGTTGGCAAGCAGGTAAGCAGGCAAGCTGGCTGAATTCC-3' ( ) was cloned into pCR-Blunt II-TOPO® vector.

    Techniques: Gas Chromatography, Isolation, Polymerase Chain Reaction, Amplification, Labeling

    The methods used to detect DSBs in S region are highly specific and allow for differential amplification of blunt and staggered DNA ends. A , Sμ plasmid DNA construct was generated by inserting the 4.3 kb human Sμ DNA into the pCR-Blunt II-TOPO® vector. This human Sμ plasmid DNA construct was digested with Pvu II to generate blunt ends or Apa I to generate staggered ends. To amplify DSB free ends, the digested DNAs were treated with nil or T4 pol, which trims back 3' overhangs while “filling in” 3'-recessed ends, thereby yielding blunt 5'-phosphorylated DNA ends, before ligation with BW linker and amplification by LM-PCR using the Sμ specific forward primers and the linker specific BW1 primer. The differential amplification of DNA treated with nil and DNA treated with T4 pol provided a measure of the occurrence of blunt 5'-phosphorylated or staggered DSB ends. B , The digested hu Sμ-pCR-Blunt II plasmid DNA was mixed with undigested plasmid DNA at ratios of 1:20, 1:80 and 1:160, and followed by ligation with BW linker and amplification by specific Sμ upstream DSB end LM-PCR, with or without pre-treatment with T4 pol. This LM-PCR amplifies only dsDNA ends that are blunt and 5'-phosphorylated. Staggered DSB ends can be amplified only after the treatment with T4 pol, which converts staggered DSB ends to blunt ends. For LM-PCR, samples consisted of 2.1 × 10−4 , 1.05 × 10−4 , 5.3 × 10−5 , 2.6 × 10−5 , 1.3 × 10−5 , 6.6 × 10−6 , 3.3 × 10−6 and 1.6 × 10−6 ng of plasmid DNA, which was digested and then linker-ligated; these amount of digested and linker-ligated plasmid contained Sμ DNA copies equivalent to those in genomic DNA of 1280, 640, 320, 160, 80, 40, 20 and 10 cells, respectively. C , DSBs occur in the Sμ region but not in the Cμ region of human IgD− CD38+ B cells. DSBs were detected by LM-PCR using BW1 primer targeting the BW linker sequence and reverse Cμ primers targeting 300–320 bp (first round PCR) and 274–296 bp (second round PCR) of Cμ DNA. LM-PCR products smaller than 296 bp (shorter pink line) reflected the amplification of DSB ends in Cμ DNA; LM-PCR products between 300 bp to about 4.8 kb (longer pink line) reflected the amplification of DSB ends in Sμ DNA.

    Journal:

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID

    doi: 10.1016/j.molimm.2008.07.003

    Figure Lengend Snippet: The methods used to detect DSBs in S region are highly specific and allow for differential amplification of blunt and staggered DNA ends. A , Sμ plasmid DNA construct was generated by inserting the 4.3 kb human Sμ DNA into the pCR-Blunt II-TOPO® vector. This human Sμ plasmid DNA construct was digested with Pvu II to generate blunt ends or Apa I to generate staggered ends. To amplify DSB free ends, the digested DNAs were treated with nil or T4 pol, which trims back 3' overhangs while “filling in” 3'-recessed ends, thereby yielding blunt 5'-phosphorylated DNA ends, before ligation with BW linker and amplification by LM-PCR using the Sμ specific forward primers and the linker specific BW1 primer. The differential amplification of DNA treated with nil and DNA treated with T4 pol provided a measure of the occurrence of blunt 5'-phosphorylated or staggered DSB ends. B , The digested hu Sμ-pCR-Blunt II plasmid DNA was mixed with undigested plasmid DNA at ratios of 1:20, 1:80 and 1:160, and followed by ligation with BW linker and amplification by specific Sμ upstream DSB end LM-PCR, with or without pre-treatment with T4 pol. This LM-PCR amplifies only dsDNA ends that are blunt and 5'-phosphorylated. Staggered DSB ends can be amplified only after the treatment with T4 pol, which converts staggered DSB ends to blunt ends. For LM-PCR, samples consisted of 2.1 × 10−4 , 1.05 × 10−4 , 5.3 × 10−5 , 2.6 × 10−5 , 1.3 × 10−5 , 6.6 × 10−6 , 3.3 × 10−6 and 1.6 × 10−6 ng of plasmid DNA, which was digested and then linker-ligated; these amount of digested and linker-ligated plasmid contained Sμ DNA copies equivalent to those in genomic DNA of 1280, 640, 320, 160, 80, 40, 20 and 10 cells, respectively. C , DSBs occur in the Sμ region but not in the Cμ region of human IgD− CD38+ B cells. DSBs were detected by LM-PCR using BW1 primer targeting the BW linker sequence and reverse Cμ primers targeting 300–320 bp (first round PCR) and 274–296 bp (second round PCR) of Cμ DNA. LM-PCR products smaller than 296 bp (shorter pink line) reflected the amplification of DSB ends in Cμ DNA; LM-PCR products between 300 bp to about 4.8 kb (longer pink line) reflected the amplification of DSB ends in Sμ DNA.

    Article Snippet: To analyze DNA-dC deamination, the 59 bp DNA fragment 5'-AGCT GGCAGGCTAGCAAGTTGGTTGGCAAGCAGGTAAGCAGGCAAGCTGGCTGAATTCC-3' ( ) was cloned into pCR-Blunt II-TOPO® vector.

    Techniques: Amplification, Plasmid Preparation, Construct, Generated, Polymerase Chain Reaction, Ligation, Sequencing

    AID can process blunt DSBs to generate staggered DSBs. A 59 bp DNA fragment containing 13 RGYW repeats was cloned into pCR-Blunt II-TOPO ® vector. A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate and the dU contained control DNA substrate were generated by PCR amplification of the pCR-Blunt IITOPO® vector containing the 59 bp fragment DNA using the forward 5'-phosphorylated primer A or primer A1 (containing a dU instead of a dC at position 3), specific for the 5' region of the 59 bp DNA fragment and the reverse primer B, specific for the vector sequence 116 bp downstream of the inserted 59 bp DNA fragment. The linearized DNA substrate was incubated with nil or recombinant GST-mouse AID fusion protein, then treated with SAP and Antarctic Phosphatase. These catalyze the release of 5'-phosphate groups from DNA yielding non-phosphorylated DNA ends, which cannot been amplified by LM-PCR. Incubation of DNA pretreated with nil or AID with recombinant E. coli Ung, followed by treatment with Endo VIII showed that AID could process blunt DSBs to yield staggered DSB ends. Such staggered DSB ends were amplified by specific LM-PCR after treatment with T4 pol.

    Journal:

    Article Title: AID- and Ung-dependent generation of staggered double-strand DNA breaks in immunoglobulin class switch DNA recombination: a post-cleavage role for AID

    doi: 10.1016/j.molimm.2008.07.003

    Figure Lengend Snippet: AID can process blunt DSBs to generate staggered DSBs. A 59 bp DNA fragment containing 13 RGYW repeats was cloned into pCR-Blunt II-TOPO ® vector. A 191 bp 5'-phosphorylated blunt-ended linearized DNA substrate and the dU contained control DNA substrate were generated by PCR amplification of the pCR-Blunt IITOPO® vector containing the 59 bp fragment DNA using the forward 5'-phosphorylated primer A or primer A1 (containing a dU instead of a dC at position 3), specific for the 5' region of the 59 bp DNA fragment and the reverse primer B, specific for the vector sequence 116 bp downstream of the inserted 59 bp DNA fragment. The linearized DNA substrate was incubated with nil or recombinant GST-mouse AID fusion protein, then treated with SAP and Antarctic Phosphatase. These catalyze the release of 5'-phosphate groups from DNA yielding non-phosphorylated DNA ends, which cannot been amplified by LM-PCR. Incubation of DNA pretreated with nil or AID with recombinant E. coli Ung, followed by treatment with Endo VIII showed that AID could process blunt DSBs to yield staggered DSB ends. Such staggered DSB ends were amplified by specific LM-PCR after treatment with T4 pol.

    Article Snippet: To analyze DNA-dC deamination, the 59 bp DNA fragment 5'-AGCT GGCAGGCTAGCAAGTTGGTTGGCAAGCAGGTAAGCAGGCAAGCTGGCTGAATTCC-3' ( ) was cloned into pCR-Blunt II-TOPO® vector.

    Techniques: Clone Assay, Polymerase Chain Reaction, Plasmid Preparation, Generated, Amplification, Sequencing, Incubation, Recombinant

    Growth of E. coli expressing BjHMA4R . BL21 transformants contained a pEASY-Blunt E1 expression vector (negative control) and BjHMA4R , respectively. The cultures were adjusted to an OD 600 of 1 and were serially diluted 10-fold in water. Five-microliter aliquots of each dilution were spotted either on nonselective LB plates or on LB plates supplemented with 600 μM CdCl 2 and 2.5 mM ZnCl 2, Ni(NO3) 2 , Co(NO3) 2 and Pb(NO3) 2 . After 1 day of incubation at 37 °C, the plates were imaged. The dilutions are indicated in the above figure, and three individual clones of each E. coli transformant were analyzed

    Journal: BMC Plant Biology

    Article Title: A repeat region from the Brassica juncea HMA4 gene BjHMA4R is specifically involved in Cd2+ binding in the cytosol under low heavy metal concentrations

    doi: 10.1186/s12870-019-1674-5

    Figure Lengend Snippet: Growth of E. coli expressing BjHMA4R . BL21 transformants contained a pEASY-Blunt E1 expression vector (negative control) and BjHMA4R , respectively. The cultures were adjusted to an OD 600 of 1 and were serially diluted 10-fold in water. Five-microliter aliquots of each dilution were spotted either on nonselective LB plates or on LB plates supplemented with 600 μM CdCl 2 and 2.5 mM ZnCl 2, Ni(NO3) 2 , Co(NO3) 2 and Pb(NO3) 2 . After 1 day of incubation at 37 °C, the plates were imaged. The dilutions are indicated in the above figure, and three individual clones of each E. coli transformant were analyzed

    Article Snippet: The BjHMA4R cDNAs were cloned into a pYES2 vector (Invitrogen) and a pEASY-Blunt E1 expression vector (Transgen Biotech, China), which were subsequently transformed into yeast and E. coli , respectively, using chemical methods [ , ].

    Techniques: Expressing, Plasmid Preparation, Negative Control, Incubation, Clone Assay

    Dry weight of yeast and E. coli expressing BjHMA4R . a , b Yeast BY4741 and YK44 cells transformed with a pYES2 plasmid and a pYES2 plasmid that harbored BjHMA4R were grown in liquid YPD medium supplemented with 30 μM CdCl 2 . The cells were incubated at 30 °C for 10 h and 21 h. Fifteen milliliters of yeast fluid was collected by centrifugation and then dried at 95 °C for 48 h for determination of the dry weight. c , d , e E. coli BL21 cells transformed with a pEASY-Blunt E1 expression plasmid or with a pEASY-Blunt E1 expression plasmid that harbored BjHMA4R were grown in liquid LB medium supplemented with normal LB, 50 μM CdCl 2 and 100 μM CdCl 2 . The cells were incubated at 37 °C for 10 h and 20 h. Fifteen milliliters of E. coli fluid was collected by centrifugation and then dried at 95 °C for 48 h to determine the dry weight. The results are the means ± SEs of four independent experiments performed with four different colonies. Different letters above the columns indicate significant differences ( P

    Journal: BMC Plant Biology

    Article Title: A repeat region from the Brassica juncea HMA4 gene BjHMA4R is specifically involved in Cd2+ binding in the cytosol under low heavy metal concentrations

    doi: 10.1186/s12870-019-1674-5

    Figure Lengend Snippet: Dry weight of yeast and E. coli expressing BjHMA4R . a , b Yeast BY4741 and YK44 cells transformed with a pYES2 plasmid and a pYES2 plasmid that harbored BjHMA4R were grown in liquid YPD medium supplemented with 30 μM CdCl 2 . The cells were incubated at 30 °C for 10 h and 21 h. Fifteen milliliters of yeast fluid was collected by centrifugation and then dried at 95 °C for 48 h for determination of the dry weight. c , d , e E. coli BL21 cells transformed with a pEASY-Blunt E1 expression plasmid or with a pEASY-Blunt E1 expression plasmid that harbored BjHMA4R were grown in liquid LB medium supplemented with normal LB, 50 μM CdCl 2 and 100 μM CdCl 2 . The cells were incubated at 37 °C for 10 h and 20 h. Fifteen milliliters of E. coli fluid was collected by centrifugation and then dried at 95 °C for 48 h to determine the dry weight. The results are the means ± SEs of four independent experiments performed with four different colonies. Different letters above the columns indicate significant differences ( P

    Article Snippet: The BjHMA4R cDNAs were cloned into a pYES2 vector (Invitrogen) and a pEASY-Blunt E1 expression vector (Transgen Biotech, China), which were subsequently transformed into yeast and E. coli , respectively, using chemical methods [ , ].

    Techniques: Expressing, Transformation Assay, Plasmid Preparation, Incubation, Centrifugation

    Cd and Zn contents of E. coli expressing BjHMA4R . E. coli BL21 cells transformed with a pEASY-Blunt E1 expression plasmid or a pEASY-Blunt E1 expression plasmid that harbored BjHMA4R were grown in normal liquid LB medium overnight, then supplemented with 50 μM CdCl 2 ( b ), 100 μM CdCl 2 ( c ), 200 μM ZnCl 2 ( e ) and normal LB ( a , d ). The cells were incubated at 37 °C for 10 h and 20 h. The metal contents of the samples were analyzed with inductively coupled plasma-mass spectrometry (ICP-MS). The results are the means ± SEs of four independent experiments performed with four different colonies. Different letters above the columns indicate significant differences ( P

    Journal: BMC Plant Biology

    Article Title: A repeat region from the Brassica juncea HMA4 gene BjHMA4R is specifically involved in Cd2+ binding in the cytosol under low heavy metal concentrations

    doi: 10.1186/s12870-019-1674-5

    Figure Lengend Snippet: Cd and Zn contents of E. coli expressing BjHMA4R . E. coli BL21 cells transformed with a pEASY-Blunt E1 expression plasmid or a pEASY-Blunt E1 expression plasmid that harbored BjHMA4R were grown in normal liquid LB medium overnight, then supplemented with 50 μM CdCl 2 ( b ), 100 μM CdCl 2 ( c ), 200 μM ZnCl 2 ( e ) and normal LB ( a , d ). The cells were incubated at 37 °C for 10 h and 20 h. The metal contents of the samples were analyzed with inductively coupled plasma-mass spectrometry (ICP-MS). The results are the means ± SEs of four independent experiments performed with four different colonies. Different letters above the columns indicate significant differences ( P

    Article Snippet: The BjHMA4R cDNAs were cloned into a pYES2 vector (Invitrogen) and a pEASY-Blunt E1 expression vector (Transgen Biotech, China), which were subsequently transformed into yeast and E. coli , respectively, using chemical methods [ , ].

    Techniques: Expressing, Transformation Assay, Plasmid Preparation, Incubation, Mass Spectrometry

    Telomere structure in DNA polymerase α mutants. (A) TRF analysis. (B,C) Quantification of G-overhang signal in pol α (B) and icu2-1 (C) mutants. The signals were normalized to the respective wild-type controls. Error bars represent SDs from three (wt-C24, pol α , wt-En-2) or four ( icu2-1 ) independent samples. (D) Detection of blunt-ended telomeres by the hairpin ligation assay [31] . Ligation of a blunt-ended hairpin to chromosome ends covalently links the complementary telomeric DNA strands. Such cross-linked strands were separated from bulk of TRFs by alkaline electrophoresis and detected by Southern hybridization with the (TTTAGGG) 4 probe. Control reactions without the hairpin and in which the hairpin was cleaved by Bam HI are shown. The arrow-heads indicate signal from the blunt-ended telomeres. Asterisks indicates signal from intrachromosomal telomeric DNA. (E) Frequency of telomeric sequence permutations forming the termini of blunt-ended telomeres. Error bars indicate SDs from four biological replicates.

    Journal: PLoS Genetics

    Article Title: Role of STN1 and DNA Polymerase α in Telomere Stability and Genome-Wide Replication in Arabidopsis

    doi: 10.1371/journal.pgen.1004682

    Figure Lengend Snippet: Telomere structure in DNA polymerase α mutants. (A) TRF analysis. (B,C) Quantification of G-overhang signal in pol α (B) and icu2-1 (C) mutants. The signals were normalized to the respective wild-type controls. Error bars represent SDs from three (wt-C24, pol α , wt-En-2) or four ( icu2-1 ) independent samples. (D) Detection of blunt-ended telomeres by the hairpin ligation assay [31] . Ligation of a blunt-ended hairpin to chromosome ends covalently links the complementary telomeric DNA strands. Such cross-linked strands were separated from bulk of TRFs by alkaline electrophoresis and detected by Southern hybridization with the (TTTAGGG) 4 probe. Control reactions without the hairpin and in which the hairpin was cleaved by Bam HI are shown. The arrow-heads indicate signal from the blunt-ended telomeres. Asterisks indicates signal from intrachromosomal telomeric DNA. (E) Frequency of telomeric sequence permutations forming the termini of blunt-ended telomeres. Error bars indicate SDs from four biological replicates.

    Article Snippet: Sequence analysis of the telomeric blunt-ends by Illumina sequencing revealed that the TTTAGGG-3′ permutation is even more prevalent in C24 than in Col-0 wild-type plants (58% vs. 42%, respectively).

    Techniques: Ligation, Electrophoresis, Hybridization, Sequencing

    STN1 acts in the C-strand fill-in synthesis after G-strand extension by telomerase. (A) Frequency of phenotypic categories in G1 stn1 tert and G1 exo1 stn1 tert populations. (B) TRF analysis; the asterisks indicate signal from interstitial telomeric DNA. Average telomere length for each sample calculated by TeloTool is shown below the autoradiogram (C,D) Quantification of G-overhang signals from native gels ( Figure S3 ). Errors represent SDs from three independent samples (two samples in the case of exo1 stn1 tert ). Significance difference is indicated (two-tailed Student's test).

    Journal: PLoS Genetics

    Article Title: Role of STN1 and DNA Polymerase α in Telomere Stability and Genome-Wide Replication in Arabidopsis

    doi: 10.1371/journal.pgen.1004682

    Figure Lengend Snippet: STN1 acts in the C-strand fill-in synthesis after G-strand extension by telomerase. (A) Frequency of phenotypic categories in G1 stn1 tert and G1 exo1 stn1 tert populations. (B) TRF analysis; the asterisks indicate signal from interstitial telomeric DNA. Average telomere length for each sample calculated by TeloTool is shown below the autoradiogram (C,D) Quantification of G-overhang signals from native gels ( Figure S3 ). Errors represent SDs from three independent samples (two samples in the case of exo1 stn1 tert ). Significance difference is indicated (two-tailed Student's test).

    Article Snippet: Sequence analysis of the telomeric blunt-ends by Illumina sequencing revealed that the TTTAGGG-3′ permutation is even more prevalent in C24 than in Col-0 wild-type plants (58% vs. 42%, respectively).

    Techniques: Two Tailed Test

    Effect of EXO1 on the structure of STN1-depleted telomeres. (A) TRF analysis; the asterisks indicate signal from interstitial telomeric DNA. (B) Quantification of the telomeric C-strand by dot-blot hybridization in G1 stn1 and G1 exo1 stn1 plants. Error bars show SDs from two independent samples; the P-value was calculated using a Student's t-test. (C) G-overhang analysis by the in gel hybridization technique. DNA samples pretreated with T4 DNA polymerase to remove 3′G-overhangs are indicated (3′ exo). The gels were first hybridized under nondenaturing conditions (top panels) and then denatured and hybridized again (bottom panels). (D) Quantification of G-overhang signals from a native gel. Error bars represent SDs from three (wt) and four ( stn1 ; stn1 exo1 ) independent samples. (E) Frequency of telomeric sequence permutations forming the termini of blunt-ended telomeres. Error bars indicate SDs from five (wild-type) or four ( stn1 , exo stn1 ) biological replicates. Wild-type data are from [31] .

    Journal: PLoS Genetics

    Article Title: Role of STN1 and DNA Polymerase α in Telomere Stability and Genome-Wide Replication in Arabidopsis

    doi: 10.1371/journal.pgen.1004682

    Figure Lengend Snippet: Effect of EXO1 on the structure of STN1-depleted telomeres. (A) TRF analysis; the asterisks indicate signal from interstitial telomeric DNA. (B) Quantification of the telomeric C-strand by dot-blot hybridization in G1 stn1 and G1 exo1 stn1 plants. Error bars show SDs from two independent samples; the P-value was calculated using a Student's t-test. (C) G-overhang analysis by the in gel hybridization technique. DNA samples pretreated with T4 DNA polymerase to remove 3′G-overhangs are indicated (3′ exo). The gels were first hybridized under nondenaturing conditions (top panels) and then denatured and hybridized again (bottom panels). (D) Quantification of G-overhang signals from a native gel. Error bars represent SDs from three (wt) and four ( stn1 ; stn1 exo1 ) independent samples. (E) Frequency of telomeric sequence permutations forming the termini of blunt-ended telomeres. Error bars indicate SDs from five (wild-type) or four ( stn1 , exo stn1 ) biological replicates. Wild-type data are from [31] .

    Article Snippet: Sequence analysis of the telomeric blunt-ends by Illumina sequencing revealed that the TTTAGGG-3′ permutation is even more prevalent in C24 than in Col-0 wild-type plants (58% vs. 42%, respectively).

    Techniques: Dot Blot, Hybridization, Sequencing

    Impaired function of DNA polymerase α results in telomere deprotection. (A) Frequency of anaphases with bridges in floral tissues. (B,C) Amplification of chromosome end-to-end fusions by PCR in pol α and icu2-1 mutants. Two combinations of subtelomeric primers specific for different chromosome arms (3L+1R and 2R+1L) were used. PCR products were detected by Southern hybridization with a telomeric probe. (D) Increased level of t-circles in pol α and icu2-1 mutants measured by TCA. Signals from t-circles (arrowhead), TRFs, and interstitial telomeric DNA (asterisks) are indicated.

    Journal: PLoS Genetics

    Article Title: Role of STN1 and DNA Polymerase α in Telomere Stability and Genome-Wide Replication in Arabidopsis

    doi: 10.1371/journal.pgen.1004682

    Figure Lengend Snippet: Impaired function of DNA polymerase α results in telomere deprotection. (A) Frequency of anaphases with bridges in floral tissues. (B,C) Amplification of chromosome end-to-end fusions by PCR in pol α and icu2-1 mutants. Two combinations of subtelomeric primers specific for different chromosome arms (3L+1R and 2R+1L) were used. PCR products were detected by Southern hybridization with a telomeric probe. (D) Increased level of t-circles in pol α and icu2-1 mutants measured by TCA. Signals from t-circles (arrowhead), TRFs, and interstitial telomeric DNA (asterisks) are indicated.

    Article Snippet: Sequence analysis of the telomeric blunt-ends by Illumina sequencing revealed that the TTTAGGG-3′ permutation is even more prevalent in C24 than in Col-0 wild-type plants (58% vs. 42%, respectively).

    Techniques: Amplification, Polymerase Chain Reaction, Hybridization

    In order to retrieve the object, a straight 35 mm laparoscopic grasper was introduced into the lumen and advanced under laparoscopic vision (arrow) in order to avoid iatrogenic injury to the mucosa.

    Journal: Case Reports in Emergency Medicine

    Article Title: Colonic Foreign Body Retrieval Using a Modified TAMIS Technique with Standard Instruments and Trocars

    doi: 10.1155/2015/815616

    Figure Lengend Snippet: In order to retrieve the object, a straight 35 mm laparoscopic grasper was introduced into the lumen and advanced under laparoscopic vision (arrow) in order to avoid iatrogenic injury to the mucosa.

    Article Snippet: The patient was placed in lithotomy position and a 12 mm blunt-tip laparoscopic trocar (Endopath Excel, Ethicon, Somerville, NJ, USA) was inserted into the anus.

    Techniques:

    A photograph of the perineum. The patient is in lithotomy position and surgical drapes are applied. A 12 mm laparoscopic trocar is inserted into the anus and the trocar sleeve is fully advanced until the adjustable sleeve hub was pressed against the anus, creating a seal. A straight 35 mm laparoscopic grasper can be seen sliding beside the optical trocar into the anus. The seal is maintained by pressure from the anal sphincter.

    Journal: Case Reports in Emergency Medicine

    Article Title: Colonic Foreign Body Retrieval Using a Modified TAMIS Technique with Standard Instruments and Trocars

    doi: 10.1155/2015/815616

    Figure Lengend Snippet: A photograph of the perineum. The patient is in lithotomy position and surgical drapes are applied. A 12 mm laparoscopic trocar is inserted into the anus and the trocar sleeve is fully advanced until the adjustable sleeve hub was pressed against the anus, creating a seal. A straight 35 mm laparoscopic grasper can be seen sliding beside the optical trocar into the anus. The seal is maintained by pressure from the anal sphincter.

    Article Snippet: The patient was placed in lithotomy position and a 12 mm blunt-tip laparoscopic trocar (Endopath Excel, Ethicon, Somerville, NJ, USA) was inserted into the anus.

    Techniques:

    Laparoscopic graspers were used to grasp the rim of the cigar sheath and extract it under laparoscopic vision.

    Journal: Case Reports in Emergency Medicine

    Article Title: Colonic Foreign Body Retrieval Using a Modified TAMIS Technique with Standard Instruments and Trocars

    doi: 10.1155/2015/815616

    Figure Lengend Snippet: Laparoscopic graspers were used to grasp the rim of the cigar sheath and extract it under laparoscopic vision.

    Article Snippet: The patient was placed in lithotomy position and a 12 mm blunt-tip laparoscopic trocar (Endopath Excel, Ethicon, Somerville, NJ, USA) was inserted into the anus.

    Techniques: