95
|
Zymo Research
quick dna fungal bacterial 96 kit Quick Dna Fungal Bacterial 96 Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/quick dna fungal bacterial 96 kit/product/Zymo Research Average 95 stars, based on 1 article reviews
quick dna fungal bacterial 96 kit - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
93
|
Rockland Immunochemicals
protein extraction Protein Extraction, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/protein extraction/product/Rockland Immunochemicals Average 93 stars, based on 1 article reviews
protein extraction - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
90
|
Addgene inc
270 gcaattgttgttgttaaattccgttttgcgacgatgc 270 Gcaattgttgttgttaaattccgttttgcgacgatgc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/270 gcaattgttgttgttaaattccgttttgcgacgatgc/product/Addgene inc Average 90 stars, based on 1 article reviews
270 gcaattgttgttgttaaattccgttttgcgacgatgc - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
99
|
Zymo Research
quick dna tm fungal Quick Dna Tm Fungal, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/quick dna tm fungal/product/Zymo Research Average 99 stars, based on 1 article reviews
quick dna tm fungal - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
94
|
Beijing Solarbio Science
bacterial protein extraction kit Bacterial Protein Extraction Kit, supplied by Beijing Solarbio Science, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bacterial protein extraction kit/product/Beijing Solarbio Science Average 94 stars, based on 1 article reviews
bacterial protein extraction kit - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
96
|
MACHEREY NAGEL
viral rna dna isolation nucleomag vet kit Viral Rna Dna Isolation Nucleomag Vet Kit, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/viral rna dna isolation nucleomag vet kit/product/MACHEREY NAGEL Average 96 stars, based on 1 article reviews
viral rna dna isolation nucleomag vet kit - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
95
|
MACHEREY NAGEL
nucleomag pathogen kit Nucleomag Pathogen Kit, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nucleomag pathogen kit/product/MACHEREY NAGEL Average 95 stars, based on 1 article reviews
nucleomag pathogen kit - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
96
|
Favorgen Biotech
favorprep milk bacterial dna extraction kit Favorprep Milk Bacterial Dna Extraction Kit, supplied by Favorgen Biotech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/favorprep milk bacterial dna extraction kit/product/Favorgen Biotech Average 96 stars, based on 1 article reviews
favorprep milk bacterial dna extraction kit - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
95
|
Qiagen
allprep bacterial dna rna proteinmini kit Allprep Bacterial Dna Rna Proteinmini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/allprep bacterial dna rna proteinmini kit/product/Qiagen Average 95 stars, based on 1 article reviews
allprep bacterial dna rna proteinmini kit - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
93
|
Addgene inc
e coli c321 δa exp E Coli C321 δa Exp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/e coli c321 δa exp/product/Addgene inc Average 93 stars, based on 1 article reviews
e coli c321 δa exp - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
93
|
Addgene inc
c321 δa C321 δa, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c321 δa/product/Addgene inc Average 93 stars, based on 1 article reviews
c321 δa - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
90
|
Addgene inc
dennd3 coding sequence Dennd3 Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dennd3 coding sequence/product/Addgene inc Average 90 stars, based on 1 article reviews
dennd3 coding sequence - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |