bacterials Search Results


95
Zymo Research quick dna fungal bacterial 96 kit
Quick Dna Fungal Bacterial 96 Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/quick dna fungal bacterial 96 kit/product/Zymo Research
Average 95 stars, based on 1 article reviews
quick dna fungal bacterial 96 kit - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

93
Rockland Immunochemicals protein extraction
Protein Extraction, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/protein extraction/product/Rockland Immunochemicals
Average 93 stars, based on 1 article reviews
protein extraction - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
Addgene inc 270 gcaattgttgttgttaaattccgttttgcgacgatgc
270 Gcaattgttgttgttaaattccgttttgcgacgatgc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/270 gcaattgttgttgttaaattccgttttgcgacgatgc/product/Addgene inc
Average 90 stars, based on 1 article reviews
270 gcaattgttgttgttaaattccgttttgcgacgatgc - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

99
Zymo Research quick dna tm fungal
Quick Dna Tm Fungal, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/quick dna tm fungal/product/Zymo Research
Average 99 stars, based on 1 article reviews
quick dna tm fungal - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

94
Beijing Solarbio Science bacterial protein extraction kit
Bacterial Protein Extraction Kit, supplied by Beijing Solarbio Science, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bacterial protein extraction kit/product/Beijing Solarbio Science
Average 94 stars, based on 1 article reviews
bacterial protein extraction kit - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

96
MACHEREY NAGEL viral rna dna isolation nucleomag vet kit
Viral Rna Dna Isolation Nucleomag Vet Kit, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/viral rna dna isolation nucleomag vet kit/product/MACHEREY NAGEL
Average 96 stars, based on 1 article reviews
viral rna dna isolation nucleomag vet kit - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

95
MACHEREY NAGEL nucleomag pathogen kit
Nucleomag Pathogen Kit, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nucleomag pathogen kit/product/MACHEREY NAGEL
Average 95 stars, based on 1 article reviews
nucleomag pathogen kit - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

96
Favorgen Biotech favorprep milk bacterial dna extraction kit
Favorprep Milk Bacterial Dna Extraction Kit, supplied by Favorgen Biotech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/favorprep milk bacterial dna extraction kit/product/Favorgen Biotech
Average 96 stars, based on 1 article reviews
favorprep milk bacterial dna extraction kit - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

95
Qiagen allprep bacterial dna rna proteinmini kit
Allprep Bacterial Dna Rna Proteinmini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/allprep bacterial dna rna proteinmini kit/product/Qiagen
Average 95 stars, based on 1 article reviews
allprep bacterial dna rna proteinmini kit - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

93
Addgene inc e coli c321 δa exp
E Coli C321 δa Exp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e coli c321 δa exp/product/Addgene inc
Average 93 stars, based on 1 article reviews
e coli c321 δa exp - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc c321 δa
C321 δa, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c321 δa/product/Addgene inc
Average 93 stars, based on 1 article reviews
c321 δa - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
Addgene inc dennd3 coding sequence
Dennd3 Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dennd3 coding sequence/product/Addgene inc
Average 90 stars, based on 1 article reviews
dennd3 coding sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results